The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	326305	336633	5233637	transposase	Enterobacteria_phage(20.0%)	11	NA	NA
AWZ55678.1|326305_327361_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	7.0e-119
AWZ55679.1|327648_328752_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AWZ55680.1|328763_330017_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
AWZ55681.1|330372_331587_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	56.5	7.5e-133
AWZ55682.1|331729_332611_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55683.1|332808_333006_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
AWZ55684.1|333005_333437_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	5.1e-28
AWZ55685.1|333449_333845_+	hypothetical protein	NA	A0A139ZPI9	Marinitoga_camini_virus	36.6	2.1e-07
AWZ55686.1|333870_335083_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ55687.1|335049_335313_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	75.7	3.4e-06
AWZ55688.1|335562_336633_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
>prophage 2
CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	550431	630323	5233637	transposase,protease,tail,capsid,tRNA,head	Escherichia_phage(33.33%)	74	NA	NA
AWZ55889.1|550431_550911_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AWZ55890.1|550926_551205_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ55891.1|551114_551909_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ55892.1|552046_552388_+	addiction module antidote protein, HigA family	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
AWZ55893.1|552501_555006_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
AWZ55894.1|555267_556200_+	glutaminase	NA	NA	NA	NA	NA
AWZ55895.1|556202_557495_+	amino acid permease	NA	NA	NA	NA	NA
AWZ55896.1|557619_558027_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ55897.1|558027_558486_-	NfeD family protein	NA	NA	NA	NA	NA
AWZ55898.1|558482_559400_-	paraslipin	NA	NA	NA	NA	NA
AWZ55899.1|559545_560223_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
AWZ55900.1|560209_560992_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AWZ55901.1|561054_561909_-	co-chaperone YbbN	NA	NA	NA	NA	NA
AWZ55902.1|561969_562779_-	oxidoreductase	NA	NA	NA	NA	NA
AWZ55903.1|562768_563395_-	arylesterase	NA	NA	NA	NA	NA
AWZ55904.1|563362_564049_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
AWZ55905.1|564045_566460_+	ABC transporter permease	NA	NA	NA	NA	NA
AWZ55906.1|571081_571342_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55907.1|571380_571572_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55908.1|572573_573668_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AWZ55909.1|573736_574663_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
AWZ55910.1|574892_575375_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
AWZ55911.1|575452_576268_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ55912.1|576357_578139_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
AWZ55913.1|578151_578928_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AWZ55914.1|579027_579906_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AWZ55915.1|580074_581529_+	putative allantoin permease	NA	NA	NA	NA	NA
AWZ55916.1|581588_582950_+	cyclic amidohydrolase	NA	NA	NA	NA	NA
AWZ55917.1|583006_584308_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
AWZ55918.1|584329_585475_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
AWZ55919.1|585603_586389_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
AWZ55920.1|586399_587635_-	allantoate amidohydrolase	NA	NA	NA	NA	NA
AWZ55921.1|587656_588706_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AWZ55922.1|589022_590690_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AWZ55923.1|590699_591959_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AWZ55924.1|591969_592785_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AWZ55925.1|592781_593675_+	carbamate kinase	NA	NA	NA	NA	NA
AWZ55926.1|593811_594879_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AWZ55927.1|594875_595385_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AWZ55928.1|595502_596225_-	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AWZ55929.1|596227_596722_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AWZ55930.1|596895_598281_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
AWZ55931.1|598316_598838_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWZ55932.1|598945_599158_-	ribosome-associated protein	NA	NA	NA	NA	NA
AWZ55933.1|599159_600026_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AWZ55934.1|600506_601049_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AWZ55935.1|601268_601961_+	molecular chaperone FimC	NA	NA	NA	NA	NA
AWZ55936.1|601991_604601_+	outer membrane usher protein	NA	NA	NA	NA	NA
AWZ55937.1|605652_606168_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AWZ55938.1|606170_606803_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWZ55939.1|608013_608346_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
AWZ55940.1|608401_609427_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
AWZ55941.1|609468_609864_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
AWZ55942.1|609875_610175_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
AWZ55943.1|610195_611408_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
AWZ55944.1|611501_612080_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
AWZ55945.1|612076_612472_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
AWZ60284.1|612479_613220_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
AWZ55946.1|613235_613658_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
AWZ55947.1|613639_614074_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AWZ55948.1|614066_616247_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
AWZ55949.1|616252_617465_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ60283.1|617535_618162_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWZ55950.1|618260_618566_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
AWZ55951.1|618749_620234_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWZ55952.1|620420_621374_-|protease	protease 7	protease	NA	NA	NA	NA
AWZ55953.1|621399_621591_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55954.1|621776_621893_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ55955.1|621886_622648_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWZ55956.1|622704_622917_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55957.1|622830_623721_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ55958.1|623721_626694_-	phage receptor	NA	NA	NA	NA	NA
AWZ55959.1|626680_628918_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
AWZ55960.1|629186_630323_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	849748	869073	5233637	integrase,transposase,holin	Enterobacteria_phage(54.55%)	28	854988:855002	868389:868403
AWZ56159.1|849748_850825_-|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.8e-199
AWZ56160.1|850838_851249_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.2	1.1e-64
AWZ56161.1|852534_852825_+	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
AWZ56162.1|853121_853484_+	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	67.9	4.4e-33
AWZ56163.1|853455_853866_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	2.1e-71
AWZ56164.1|853862_854039_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
AWZ56165.1|854041_854401_+	DUF2591 domain-containing protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
AWZ56166.1|854400_854577_+	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
AWZ56167.1|854569_854782_+	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
AWZ56168.1|854774_855065_+	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
854988:855002	attL	GACGCCAGACTTTAC	NA	NA	NA	NA
AWZ56169.1|855061_855424_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	3.5e-62
AWZ56170.1|855420_855609_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
AWZ56171.1|855820_856780_-	DUF2219 domain-containing protein	NA	NA	NA	NA	NA
AWZ56172.1|857119_857242_+	YlcG family protein	NA	NA	NA	NA	NA
AWZ56173.1|857256_857946_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
AWZ56174.1|858157_858874_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ56175.1|858959_859118_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AWZ56176.1|859416_861267_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
AWZ56177.1|861545_861707_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56178.1|861705_861921_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
AWZ56179.1|861920_862109_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	1.9e-19
AWZ56180.1|862111_863325_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ56181.1|863378_863582_+	hypothetical protein	NA	A0A1I9LJT0	Stx_converting_phage	97.0	1.4e-28
AWZ56182.1|863687_864569_+	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
AWZ56183.1|864792_865623_+	cell division protein	NA	A5LH49	Enterobacteria_phage	97.8	7.6e-153
AWZ56184.1|865746_866118_-|integrase	integrase	integrase	K7PH54	Enterobacteria_phage	95.1	1.1e-58
AWZ56185.1|867336_867717_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ56186.1|867860_869073_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
868389:868403	attR	GTAAAGTCTGGCGTC	NA	NA	NA	NA
>prophage 4
CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	1079727	1122286	5233637	lysis,transposase,protease,holin	Escherichia_phage(37.93%)	62	NA	NA
AWZ56364.1|1079727_1081488_-|protease	Lon protease	protease	NA	NA	NA	NA
AWZ56365.1|1081673_1082126_+	macrodomain Ter protein	NA	NA	NA	NA	NA
AWZ56366.1|1082201_1083242_-	outer membrane protein A	NA	NA	NA	NA	NA
AWZ56367.1|1083396_1083615_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ56368.1|1083598_1084108_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AWZ56369.1|1084380_1084956_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AWZ60296.1|1084918_1087072_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AWZ56370.1|1087090_1087537_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AWZ56371.1|1087659_1089714_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
AWZ56372.1|1089745_1090204_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AWZ56373.1|1090299_1090962_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AWZ56374.1|1091134_1091548_+	CoA-binding protein	NA	NA	NA	NA	NA
AWZ56375.1|1091592_1091910_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
AWZ56376.1|1091967_1093158_-	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AWZ56377.1|1093252_1093531_+	acylphosphatase	NA	NA	NA	NA	NA
AWZ56378.1|1093527_1093857_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AWZ56379.1|1093947_1094607_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
AWZ56380.1|1097412_1098626_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ56381.1|1098677_1100102_-	exonuclease	NA	NA	NA	NA	NA
AWZ56382.1|1100194_1100386_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWZ56383.1|1100382_1100571_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWZ60297.1|1101102_1101477_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56384.1|1101488_1101641_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
AWZ56385.1|1101678_1101873_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56386.1|1101913_1102630_-	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
AWZ56387.1|1102679_1102895_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ56388.1|1102891_1103317_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWZ56389.1|1103388_1104459_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
AWZ56390.1|1104499_1104922_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
AWZ56391.1|1104918_1105215_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	7.5e-47
AWZ56392.1|1105211_1105673_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
AWZ56393.1|1105650_1106007_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
AWZ56394.1|1106057_1106270_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
AWZ56395.1|1106355_1106520_+	O-polysaccharide acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
AWZ56396.1|1106521_1106785_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
AWZ56397.1|1106795_1107665_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
AWZ56398.1|1107780_1107885_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ56399.1|1107873_1108029_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	83.8	1.9e-09
AWZ56400.1|1108073_1108286_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
AWZ56401.1|1108453_1108714_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ56402.1|1108733_1109783_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
AWZ56403.1|1109795_1110167_+	hypothetical protein	NA	V5URS4	Shigella_phage	63.7	1.3e-35
AWZ56404.1|1110156_1110528_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
AWZ56405.1|1110679_1111498_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWZ56406.1|1111784_1111982_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
AWZ56407.1|1112119_1112833_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWZ56408.1|1113279_1113483_-	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
AWZ56409.1|1113600_1115451_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
AWZ56410.1|1115729_1115891_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56411.1|1115889_1116105_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
AWZ56412.1|1116067_1116412_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56413.1|1116360_1116597_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56414.1|1116565_1116748_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ56415.1|1116792_1117326_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
AWZ56416.1|1117546_1117660_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	97.3	5.6e-11
AWZ56417.1|1117661_1118129_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
AWZ56418.1|1118211_1118352_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ56419.1|1118593_1118908_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWZ60298.1|1118989_1119214_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
AWZ56420.1|1119263_1120477_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ56421.1|1120563_1121457_-	molecular chaperone Tir	NA	NA	NA	NA	NA
AWZ56422.1|1121902_1122286_-	secretion protein EspV	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
>prophage 5
CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	1345862	1410547	5233637	transposase,terminase,integrase,tail,capsid,lysis,holin,tRNA,head	Stx2-converting_phage(36.0%)	73	1340956:1340970	1347437:1347451
1340956:1340970	attL	GATCGCGATGTACGC	NA	NA	NA	NA
AWZ56646.1|1345862_1346981_-|integrase	integrase	integrase	Q77Z04	Phage_21	43.9	2.9e-83
AWZ56647.1|1346949_1347219_-	excisionase	NA	NA	NA	NA	NA
AWZ56648.1|1347280_1349746_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	8.8e-56
1347437:1347451	attR	GCGTACATCGCGATC	NA	NA	NA	NA
AWZ56649.1|1349838_1350030_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWZ56650.1|1350026_1350215_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWZ56651.1|1350698_1350917_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56652.1|1350957_1351347_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56653.1|1351273_1351438_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56654.1|1351642_1351921_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWZ56655.1|1351922_1352150_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56656.1|1352134_1352569_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56657.1|1352603_1352906_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.5e-05
AWZ56658.1|1352902_1353328_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWZ60317.1|1353350_1354313_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
AWZ56659.1|1354807_1356021_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ56660.1|1356058_1356199_+	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.0	2.2e-12
AWZ56661.1|1356240_1356420_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56662.1|1356366_1356639_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
AWZ56663.1|1356640_1357696_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
AWZ56664.1|1357696_1358062_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
AWZ56665.1|1358070_1358601_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
AWZ56666.1|1358719_1359040_+	lipoprotein	NA	S5MQK8	Escherichia_phage	97.4	2.5e-35
AWZ56667.1|1359190_1360249_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
AWZ56668.1|1360740_1360926_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
AWZ56669.1|1361045_1362896_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
AWZ56670.1|1363174_1363336_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56671.1|1363334_1363550_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWZ56672.1|1363554_1363899_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AWZ56673.1|1363949_1364483_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
AWZ56674.1|1364753_1365323_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AWZ56675.1|1365476_1365944_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	100.0	6.9e-79
AWZ56676.1|1366306_1366534_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
AWZ56677.1|1366575_1366941_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
AWZ56678.1|1366909_1367116_+	hypothetical protein	NA	H6WZK7	Escherichia_phage	83.8	7.4e-25
AWZ56679.1|1367231_1367795_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
AWZ56680.1|1367791_1369453_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
AWZ56681.1|1369516_1371454_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.7	0.0e+00
AWZ60318.1|1371498_1371720_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AWZ56682.1|1374408_1374735_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AWZ56683.1|1374744_1375095_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWZ56684.1|1375091_1375538_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWZ56685.1|1375534_1375879_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWZ56686.1|1375945_1376662_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
AWZ56687.1|1376667_1377042_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
AWZ56688.1|1377065_1377347_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AWZ56689.1|1377398_1380641_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.5	0.0e+00
AWZ56690.1|1380633_1380975_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
AWZ56691.1|1380974_1381673_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	4.4e-130
AWZ60319.1|1381689_1382010_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
AWZ56692.1|1382117_1382291_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
AWZ56693.1|1383338_1384076_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
AWZ56694.1|1383973_1384654_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.2	8.7e-115
AWZ56695.1|1384890_1388370_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.4	0.0e+00
AWZ56696.1|1388436_1389036_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
AWZ56697.1|1389100_1390423_+|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	99.1	2.4e-76
AWZ56698.1|1390424_1390694_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
AWZ56699.1|1390909_1393258_+	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
AWZ56700.1|1393848_1397250_+	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.0e-219
AWZ56701.1|1397406_1397997_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ56702.1|1398019_1398145_+	NleB	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
AWZ56703.1|1398224_1398500_-	secretion protein EspO	NA	NA	NA	NA	NA
AWZ56704.1|1398560_1399922_-	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
AWZ56705.1|1400042_1400255_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56706.1|1400285_1401149_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AWZ56707.1|1401132_1402269_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
AWZ60320.1|1402247_1402463_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56708.1|1402518_1403748_+	peptidase T	NA	NA	NA	NA	NA
AWZ56709.1|1403893_1405015_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AWZ56710.1|1405090_1406551_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AWZ56711.1|1406550_1407222_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AWZ56712.1|1407389_1408760_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
AWZ60321.1|1408763_1409405_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AWZ56713.1|1409440_1410547_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	1511763	1584785	5233637	transposase,terminase,protease,tail,portal,lysis,holin	Enterobacteria_phage(45.1%)	79	NA	NA
AWZ56807.1|1511763_1512312_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
AWZ56808.1|1513822_1514011_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56809.1|1514158_1515371_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ56810.1|1515435_1515972_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	71.9	4.1e-59
AWZ60331.1|1516004_1516286_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.8	1.6e-30
AWZ56811.1|1516282_1516579_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
AWZ56812.1|1516575_1517037_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	6.9e-39
AWZ56813.1|1517014_1517371_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
AWZ56814.1|1517466_1517838_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
AWZ56815.1|1517834_1518188_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
AWZ56816.1|1518393_1518693_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
AWZ56817.1|1518698_1518956_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
AWZ56818.1|1519091_1519370_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.9e-10
AWZ56819.1|1519371_1520421_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
AWZ56820.1|1520433_1520808_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
AWZ56821.1|1520804_1521626_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
AWZ56822.1|1521852_1522050_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
AWZ56823.1|1522200_1523259_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.0	1.7e-205
AWZ56824.1|1523853_1525800_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.1	0.0e+00
AWZ56825.1|1525937_1526117_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AWZ56826.1|1526157_1526403_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
AWZ56827.1|1526480_1526696_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
AWZ56828.1|1526970_1528183_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ56829.1|1528606_1529140_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
AWZ56830.1|1529438_1529906_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	96.1	3.9e-74
AWZ56831.1|1530319_1530796_+	DUF1441 domain-containing protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
AWZ56832.1|1530792_1532916_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
AWZ56833.1|1532888_1533125_+	hypothetical protein	NA	Q687G1	Enterobacteria_phage	100.0	4.5e-34
AWZ56834.1|1533124_1534627_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
AWZ60332.1|1534640_1536596_+	peptidase S14	NA	S5M7Q8	Escherichia_phage	99.8	0.0e+00
AWZ56835.1|1536683_1537010_+	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
AWZ56836.1|1537002_1537284_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
AWZ56837.1|1537286_1537910_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
AWZ56838.1|1537922_1538321_+|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
AWZ56839.1|1538328_1539081_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
AWZ56840.1|1539094_1539517_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
AWZ56841.1|1539543_1539852_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
AWZ56842.1|1539895_1542541_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.4	0.0e+00
AWZ56843.1|1542537_1542867_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWZ56844.1|1543574_1544318_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
AWZ56845.1|1544215_1544896_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.2	8.7e-115
AWZ56846.1|1545132_1548609_+	DUF1983 domain-containing protein	NA	Q687E8	Enterobacteria_phage	96.6	0.0e+00
AWZ56847.1|1548676_1549276_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
AWZ56848.1|1549340_1550654_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
AWZ56849.1|1550655_1550925_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
AWZ56850.1|1552060_1552651_+	protein kinase	NA	NA	NA	NA	NA
AWZ56851.1|1553687_1554194_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AWZ56852.1|1554239_1554740_-	YciE/YciF family protein	NA	NA	NA	NA	NA
AWZ56853.1|1554825_1555005_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56854.1|1555385_1556192_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AWZ56855.1|1556191_1557385_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AWZ60333.1|1557396_1558755_-	bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
AWZ56856.1|1558758_1560354_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AWZ56857.1|1560353_1561916_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AWZ60334.1|1562007_1562052_-	trp operon leader peptide	NA	NA	NA	NA	NA
AWZ56858.1|1562189_1563071_+	phosphatase	NA	NA	NA	NA	NA
AWZ56859.1|1563067_1563688_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AWZ56860.1|1563788_1564661_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AWZ56861.1|1564700_1565291_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AWZ56862.1|1565287_1566046_-	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
AWZ56863.1|1566265_1567315_+|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AWZ56864.1|1567350_1567602_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56865.1|1567646_1567859_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ56866.1|1567981_1570579_+	DNA topoisomerase 1	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
AWZ56867.1|1570788_1571763_+	LysR family transcriptional regulator CysB	NA	NA	NA	NA	NA
AWZ56868.1|1572057_1572222_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
AWZ56869.1|1572224_1572392_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ56870.1|1572528_1572711_+	acnA regulatory region 60-length spurious protein	NA	NA	NA	NA	NA
AWZ56871.1|1572764_1575440_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
AWZ56872.1|1575503_1576094_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
AWZ56873.1|1576263_1577028_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
AWZ56874.1|1577176_1577485_+	LPS assembly protein A	NA	NA	NA	NA	NA
AWZ56875.1|1577491_1578661_+	LPS assembly protein B	NA	NA	NA	NA	NA
AWZ56876.1|1578852_1579590_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AWZ56877.1|1579589_1579916_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
AWZ56878.1|1580041_1580260_-	osmotically-inducible lipoprotein B	NA	NA	NA	NA	NA
AWZ56879.1|1580528_1581278_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ56880.1|1581367_1581541_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56881.1|1583571_1584785_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 7
CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	1645169	1740929	5233637	transposase,terminase,integrase,tail,capsid,lysis,holin,tRNA,head	Escherichia_phage(40.45%)	121	1703878:1703937	1734622:1735933
AWZ60336.1|1645169_1646402_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
AWZ56940.1|1646656_1647640_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AWZ56941.1|1647914_1648088_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ56942.1|1648117_1649491_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AWZ56943.1|1649619_1650555_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AWZ56944.1|1650606_1651842_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
AWZ56945.1|1651843_1652059_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AWZ60338.1|1652158_1652347_-	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
AWZ60337.1|1652384_1652534_-	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
AWZ56946.1|1652589_1653399_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
AWZ56947.1|1653391_1655992_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
AWZ56948.1|1656093_1656369_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
AWZ60339.1|1656443_1656614_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AWZ56949.1|1656613_1656835_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AWZ56950.1|1656963_1657242_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ56951.1|1657276_1657765_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
AWZ56952.1|1657761_1657917_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AWZ56953.1|1657927_1658107_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56954.1|1658094_1658313_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56955.1|1658349_1658769_-	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
AWZ56956.1|1658848_1659103_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AWZ56957.1|1659099_1659522_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
AWZ56958.1|1659599_1660388_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
AWZ56959.1|1660394_1661141_+	replication protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
AWZ56960.1|1661112_1661925_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.5e-121
AWZ56961.1|1661940_1662363_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
AWZ56962.1|1662468_1662681_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
AWZ56963.1|1662766_1662931_+	O-polysaccharide acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
AWZ56964.1|1662932_1663196_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
AWZ56965.1|1663206_1663368_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
AWZ56966.1|1663446_1663692_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
AWZ56967.1|1664123_1665275_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
AWZ56968.1|1665242_1666232_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ56969.1|1666231_1667623_-	ATPase	NA	NA	NA	NA	NA
AWZ56970.1|1668122_1668722_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
AWZ56971.1|1668721_1669012_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
AWZ56972.1|1669008_1669563_+	antiterminator	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
AWZ56973.1|1670124_1670556_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
AWZ56974.1|1671126_1672980_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
AWZ56975.1|1673129_1673345_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
AWZ56976.1|1673349_1673694_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
AWZ56977.1|1673744_1674278_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
AWZ56978.1|1674551_1675091_+	ant domain protein	NA	Q5MBW0	Stx1-converting_phage	99.4	3.0e-86
AWZ56979.1|1675093_1676307_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ56980.1|1676383_1676560_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	98.3	3.3e-26
AWZ60340.1|1676788_1677256_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
AWZ60341.1|1677285_1677486_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	71.8	7.2e-09
AWZ56981.1|1677407_1677659_+	hypothetical protein	NA	H6WZK4	Escherichia_phage	95.7	3.2e-30
AWZ56982.1|1677594_1677921_+	hypothetical protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
AWZ56983.1|1678052_1678253_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
AWZ56984.1|1678294_1678660_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
AWZ56985.1|1678948_1679512_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
AWZ56986.1|1679508_1681170_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
AWZ56987.1|1681233_1683171_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
AWZ60342.1|1683215_1683437_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
AWZ56988.1|1685801_1686128_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
AWZ56989.1|1686137_1686488_+|head,tail	head-tail adaptor protein	head,tail	H6WZL5	Escherichia_phage	100.0	2.0e-59
AWZ56990.1|1686484_1686931_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWZ56991.1|1686927_1687272_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
AWZ56992.1|1687340_1688057_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	1.4e-126
AWZ56993.1|1688062_1688437_+|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
AWZ56994.1|1688460_1688742_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AWZ56995.1|1688793_1692036_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.0	0.0e+00
AWZ56996.1|1692028_1692370_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
AWZ56997.1|1692369_1693068_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
AWZ56998.1|1693078_1693822_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
AWZ56999.1|1693719_1694400_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	91.1	5.7e-106
AWZ57000.1|1694353_1694560_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ57001.1|1694590_1695118_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
AWZ57002.1|1695251_1698725_+|tail	phage tail protein	tail	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
AWZ57003.1|1698792_1699392_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
AWZ57004.1|1699543_1700848_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	95.4	1.2e-72
AWZ57005.1|1700849_1701119_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
AWZ60343.1|1702233_1702356_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
AWZ57006.1|1702462_1703374_+	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
1703878:1703937	attL	CTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCAT	NA	NA	NA	NA
AWZ57007.1|1703920_1705134_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ57008.1|1706160_1706439_-	secretion protein EspO	NA	NA	NA	NA	NA
AWZ57009.1|1706827_1707013_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ57010.1|1707149_1707797_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
AWZ57011.1|1707980_1708571_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
AWZ60344.1|1710299_1710728_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
AWZ57012.1|1711076_1711430_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ60345.1|1711520_1712240_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
AWZ57013.1|1712279_1712678_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
AWZ57014.1|1712782_1713322_-	intracellular septation protein A	NA	NA	NA	NA	NA
AWZ57015.1|1713351_1714095_-	UPF0259 family protein	NA	NA	NA	NA	NA
AWZ57016.1|1714451_1715090_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
AWZ57017.1|1715135_1716266_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
AWZ57018.1|1716243_1716492_-	excisionase	NA	NA	NA	NA	NA
AWZ57019.1|1716556_1719028_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	5.5e-58
AWZ57020.1|1719123_1719312_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWZ57021.1|1719308_1719497_-	cell division inhibitor	NA	NA	NA	NA	NA
AWZ57022.1|1719767_1720064_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ57023.1|1720057_1720291_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ57024.1|1720268_1720676_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
AWZ57025.1|1720698_1720917_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ60346.1|1720989_1721289_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ57026.1|1721553_1721961_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
AWZ57027.1|1722105_1722264_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ57028.1|1722247_1722799_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ57029.1|1723599_1724265_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.9e-85
AWZ57030.1|1724298_1725033_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
AWZ57031.1|1725892_1726651_+	accessory colonization factor AcfC	NA	NA	NA	NA	NA
AWZ57032.1|1726929_1727142_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
AWZ57033.1|1727362_1727620_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ57034.1|1727689_1727968_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.8e-11
AWZ57035.1|1727969_1729025_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
AWZ57036.1|1729025_1729391_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
AWZ57037.1|1729387_1730077_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
AWZ57038.1|1730107_1730254_+	antiterminator	NA	NA	NA	NA	NA
AWZ57039.1|1731426_1731555_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ57040.1|1731603_1733373_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	0.0e+00
AWZ57041.1|1733424_1734637_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ57042.1|1734603_1734726_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	86.1	4.3e-09
AWZ57043.1|1734727_1734997_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
AWZ57044.1|1735137_1736013_+	secretion protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
1734622:1735933	attR	ATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAGGGGCTGAATGAAGTGGGCAGTGATACAGGCAGAACAGGAGAATGACATGAATATACTAAAAAAACTTATGCAGCGTCTGTGTGGTTGCGGAAAGCATGATGGCCGTGAACACGTGCAGTCGCTTACAGCACAACTGCGACTGGGGCCGGCAGACATCCTGGAGTCCGATGAGAATGGTATTATTCCGGAGCAGGACAGGGTAATCACGCAGGTGGTGATACTGGATGCGGATAAAAAGCAGATACAGTGCGTGGTAAGACCGCTGCAAATTCTGCGTGCTGACGGGAGGTGGGAAAATATTGGCGGAATGAAATAGCCGACAGCTTCACAAAAACCGGAGTCCGGCTCCGGTTTTTGTTGTCATGTCCGGTGGATGTTTGTTAGGAATGTTCAGACAGGTTTATTTTGAATTTACACAGAATCCTAAACAGGTTCGAAAATTAAGAAAGAGGTTGTATGTTTAGCATAAGAACCCTACTACCTATTAGCGCCAGCGTATCAGTTCCGACAAAACAATCTCAATCCATCCCAATAACTTTAGCAGGGAGAACAATCGAAAAAGCGCAAGAGAAAGAAGGATTACTTGTTTTTTTAGGAATGAAATCCGTTAATGACTATACTCTTAATATTCTTGGCCAAAATGTTTCAAGAGTCACAACGGGGAAAAAACCGTATGATTTATTATTCCTGAATGATGCTACAAAACAAGATTTTGATAAAAGGAAAATGGAGTTTACATATCCTGGAGCAAATAAAAGCCATCTACAATCAAGTAATAGCGATGTTGTTGCTGCTGCAGCTATAAGTATTACAGCGACAGAGATGAAAACCATCCTGCCAGATGATTTAACACTAGGAAAATACAACAAAATTTATCTGTCTGGGCATGGTTCTGCTGGTCTACCTCTTCTTAAGTGCGGAGATGAATTTTTATCACCGTCAGATATTGTCGACCGCATTGTTCAGCATAATCTTCATGAAATAGATGATATCAGATTAACATCCTGTAACTCAGCCAACATAATAAAAAACAAAGACTTCTCTCCTGATGAAATAGAAAAATCCGCAAATATGAATAACGGCTGGTTGGCCAGGGCATTATTTGGTCAAAAGAGGTCTTTAGCAGAACACGTCTATGCCGAGTTTGAACGTCGCGGAATTAACGTTTCTATATCAGGTTACCATGGCACTGGCGTTTTTTATGTACCAGAGCATGGTAAACCAACAACGCATCTACGCTCCACAACTGTGC	NA	NA	NA	NA
AWZ60347.1|1736237_1736609_-	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	99.2	1.7e-67
AWZ60348.1|1737483_1737798_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
AWZ57045.1|1737857_1739141_+	MFS transporter	NA	NA	NA	NA	NA
AWZ57046.1|1739229_1740690_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
AWZ57047.1|1740725_1740929_-	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	1939038	1991803	5233637	transposase,terminase,tail,portal,capsid,lysis,holin,head	Stx2-converting_phage(45.65%)	63	NA	NA
AWZ57209.1|1939038_1940172_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.3	1.2e-116
AWZ57210.1|1940312_1940747_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AWZ57211.1|1941327_1941969_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
AWZ57212.1|1942050_1942680_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
AWZ57213.1|1942752_1943328_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
AWZ57214.1|1943440_1943710_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
AWZ57215.1|1943711_1945025_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	7.9e-80
AWZ57216.1|1945089_1945689_-	outer membrane protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
AWZ57217.1|1945759_1949257_-|tail	phage tail protein	tail	A0A0P0ZEQ8	Stx2-converting_phage	94.8	0.0e+00
AWZ57218.1|1949599_1950280_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.8	1.0e-110
AWZ57219.1|1950177_1950921_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.1e-147
AWZ57220.1|1950926_1951625_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
AWZ57221.1|1951624_1951966_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
AWZ57222.1|1951958_1953401_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	5.1e-229
AWZ57223.1|1953419_1953785_+|transposase	transposase	transposase	NA	NA	NA	NA
AWZ57224.1|1953784_1954972_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWZ57225.1|1955151_1957029_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.5	5.9e-278
AWZ57226.1|1957080_1957362_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	98.9	3.9e-45
AWZ57227.1|1957385_1957760_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	5.0e-64
AWZ57228.1|1957765_1958482_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	96.6	1.2e-125
AWZ57229.1|1958548_1958893_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
AWZ57230.1|1958889_1959336_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWZ57231.1|1959332_1959683_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWZ57232.1|1959692_1960019_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
AWZ57233.1|1960021_1962601_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.8	0.0e+00
AWZ57234.1|1962546_1962768_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AWZ57235.1|1962812_1964750_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
AWZ57236.1|1964813_1966475_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
AWZ57237.1|1966471_1967035_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
AWZ57238.1|1967218_1967362_-	DNase	NA	NA	NA	NA	NA
AWZ57239.1|1967324_1967690_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
AWZ57240.1|1967731_1967959_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
AWZ57241.1|1968327_1968552_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ57242.1|1968548_1969043_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	93.8	4.0e-77
AWZ57243.1|1969044_1969263_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	91.1	3.0e-16
AWZ57244.1|1969340_1969874_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
AWZ57245.1|1969924_1970269_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AWZ57246.1|1970273_1970489_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
AWZ57247.1|1970925_1972776_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
AWZ57248.1|1973614_1974827_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ57249.1|1975511_1976033_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ57250.1|1976016_1976244_-	transcriptional regulator	NA	NA	NA	NA	NA
AWZ57251.1|1976321_1976729_+	transcriptional regulator	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
AWZ57252.1|1976921_1977074_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
AWZ60357.1|1977085_1977451_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ57253.1|1977419_1977707_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ57254.1|1978122_1978311_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AWZ57255.1|1978307_1978499_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWZ57256.1|1978592_1979036_+	exonuclease VIII	NA	NA	NA	NA	NA
AWZ57257.1|1979075_1980289_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ57258.1|1980352_1982377_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	2.7e-58
AWZ57259.1|1982449_1982701_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AWZ57260.1|1982720_1984016_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
AWZ57261.1|1984035_1984146_-	transporter	NA	NA	NA	NA	NA
AWZ57262.1|1984203_1985223_-	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
AWZ57263.1|1985234_1986449_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWZ57264.1|1986429_1986618_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ57265.1|1986654_1986981_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AWZ57266.1|1987115_1987457_+	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWZ57267.1|1987491_1988052_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWZ60358.1|1988054_1988765_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWZ57268.1|1988872_1989178_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWZ57269.1|1989376_1991803_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
>prophage 9
CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	2127570	2165654	5233637	transposase,terminase,plate,tail,portal,capsid,holin,tRNA	Enterobacteria_phage(86.11%)	46	NA	NA
AWZ60365.1|2127570_2127849_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	93.4	6.2e-27
AWZ57396.1|2127859_2128138_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
AWZ57397.1|2128149_2128392_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AWZ57398.1|2128456_2129338_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	92.6	1.9e-114
AWZ57399.1|2130910_2131870_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
AWZ57400.1|2131874_2132186_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
AWZ57401.1|2132550_2132820_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ57402.1|2133382_2133907_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ57403.1|2133921_2134968_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
AWZ57404.1|2134967_2136719_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.3	0.0e+00
AWZ57405.1|2136873_2137710_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
AWZ57406.1|2137733_2138786_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
AWZ57407.1|2138831_2139632_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
AWZ57408.1|2139734_2140229_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
AWZ57409.1|2140228_2140429_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AWZ57410.1|2140431_2140755_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AWZ57411.1|2140751_2141144_+	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AWZ57412.1|2141140_2141548_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
AWZ60366.1|2141519_2141699_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ57413.1|2141685_2142153_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
AWZ57414.1|2142145_2142781_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
AWZ57415.1|2142777_2143359_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
AWZ57416.1|2143355_2143706_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AWZ57417.1|2143709_2144606_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
AWZ57418.1|2144598_2145129_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
AWZ57419.1|2145131_2147264_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
AWZ57420.1|2147263_2147842_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
AWZ60367.1|2147885_2148362_-	serine acetyltransferase	NA	NA	NA	NA	NA
AWZ57421.1|2148614_2149109_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	1.8e-85
AWZ57422.1|2149115_2151923_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.8	0.0e+00
AWZ57423.1|2151909_2152146_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AWZ57424.1|2152073_2152448_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
AWZ57425.1|2152503_2153016_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.2	7.8e-92
AWZ57426.1|2153015_2154200_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
AWZ57427.1|2154357_2155467_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
AWZ57428.1|2155692_2157195_+	DNA-binding protein	NA	NA	NA	NA	NA
AWZ57429.1|2157438_2157699_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ57430.1|2157889_2158030_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
AWZ57431.1|2158336_2158636_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AWZ57432.1|2158640_2161028_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWZ57433.1|2161042_2162026_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AWZ60368.1|2162309_2162354_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AWZ57434.1|2162476_2162833_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWZ57435.1|2162885_2163083_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWZ57436.1|2163179_2163722_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AWZ57437.1|2163725_2165654_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 10
CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	2385277	2472010	5233637	transposase,terminase,tail,portal,capsid,lysis,holin,head	Enterobacteria_phage(37.1%)	109	NA	NA
AWZ57654.1|2385277_2386491_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ57655.1|2389012_2389810_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWZ57656.1|2389819_2390371_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AWZ57657.1|2390539_2390872_-	multidrug SMR transporter	NA	NA	NA	NA	NA
AWZ57658.1|2391205_2391520_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AWZ57659.1|2391733_2393392_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
AWZ57660.1|2393384_2394380_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AWZ57661.1|2394372_2395059_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AWZ57662.1|2395058_2396432_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
AWZ57663.1|2396450_2396894_+	flagellar protein FliJ	NA	NA	NA	NA	NA
AWZ57664.1|2396890_2398018_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
AWZ57665.1|2398122_2398587_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AWZ57666.1|2398591_2399596_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AWZ57667.1|2399592_2400006_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AWZ57668.1|2400008_2400374_+	flagellar protein FliO	NA	NA	NA	NA	NA
AWZ57669.1|2400373_2401111_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AWZ57670.1|2401120_2401390_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AWZ57671.1|2401397_2402183_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
AWZ57672.1|2402472_2403096_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
AWZ57673.1|2403139_2403382_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ57674.1|2403490_2403718_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AWZ57675.1|2404015_2404831_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AWZ57676.1|2404827_2406522_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
AWZ57677.1|2406442_2406631_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ57678.1|2406692_2406875_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AWZ57679.1|2406953_2407871_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AWZ57680.1|2408043_2408964_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AWZ57681.1|2408952_2409423_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
AWZ57682.1|2409403_2410822_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
AWZ57683.1|2410888_2411584_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
AWZ57684.1|2411623_2411989_-	permease	NA	NA	NA	NA	NA
AWZ57685.1|2412555_2413719_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
AWZ57686.1|2414309_2415161_+	Molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
AWZ57687.1|2415268_2416627_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
AWZ60379.1|2416626_2417298_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AWZ57688.1|2417430_2417844_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AWZ57689.1|2417952_2418957_+	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AWZ57690.1|2418957_2419593_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AWZ57691.1|2419849_2420500_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AWZ57692.1|2420842_2421373_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
AWZ57693.1|2421395_2421638_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ57694.1|2422607_2423594_-	peptidase M85	NA	NA	NA	NA	NA
AWZ57695.1|2424026_2424296_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
AWZ57696.1|2424297_2425611_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
AWZ57697.1|2425675_2426275_-	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
AWZ57698.1|2426342_2429819_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
AWZ57699.1|2430065_2430746_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.2	8.7e-115
AWZ57700.1|2430643_2431387_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
AWZ57701.1|2431392_2432091_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
AWZ57702.1|2432090_2432420_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWZ57703.1|2432416_2435029_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
AWZ57704.1|2435009_2435423_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
AWZ57705.1|2435449_2435872_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
AWZ57706.1|2435885_2436638_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
AWZ57707.1|2436645_2437041_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AWZ57708.1|2437586_2437940_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
AWZ57709.1|2437932_2438316_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
AWZ57710.1|2438367_2439396_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
AWZ57711.1|2439453_2439801_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
AWZ57712.1|2439837_2441343_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
AWZ57713.1|2441332_2442925_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
AWZ57714.1|2442921_2443128_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AWZ57715.1|2443111_2445040_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
AWZ60380.1|2445011_2445518_-	DNA-packaging protein	NA	O64316	Escherichia_phage	47.3	7.4e-34
AWZ57716.1|2445944_2446169_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
AWZ57717.1|2446250_2446565_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWZ57718.1|2446805_2446946_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ57719.1|2447028_2447496_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	89.0	5.5e-68
AWZ57720.1|2447497_2447716_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	93.3	1.0e-16
AWZ57721.1|2447793_2448327_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
AWZ57722.1|2448369_2448774_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	8.2e-52
AWZ57723.1|2448757_2449971_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ57724.1|2450202_2450418_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
AWZ57725.1|2450494_2450767_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
AWZ57726.1|2450807_2450987_-	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AWZ57727.1|2451124_2453062_-	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	96.4	0.0e+00
AWZ57728.1|2453110_2453239_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ57729.1|2453540_2453972_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
AWZ57730.1|2454059_2454485_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AWZ57731.1|2454481_2454832_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	3.1e-39
AWZ57732.1|2454862_2456476_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
AWZ57733.1|2456961_2457675_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWZ57734.1|2457809_2458007_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
AWZ57735.1|2458230_2458785_-	antiterminator	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
AWZ57736.1|2458793_2459153_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
AWZ57737.1|2459165_2460215_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
AWZ57738.1|2460216_2460489_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
AWZ57739.1|2460610_2460955_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
AWZ57740.1|2461074_2461287_-	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
AWZ57741.1|2461520_2462078_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
AWZ57742.1|2462079_2462298_-	sugar acetyltransferase inhibitor	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
AWZ57743.1|2462425_2462737_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
AWZ57744.1|2462729_2462957_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
AWZ60381.1|2462953_2463235_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
AWZ57745.1|2463267_2463984_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
AWZ57746.1|2464005_2464752_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
AWZ57747.1|2464758_2465829_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
AWZ57748.1|2465900_2466326_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWZ57749.1|2466309_2466591_-	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
AWZ57750.1|2466690_2467110_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
AWZ60382.1|2467375_2467528_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
AWZ57751.1|2467539_2468178_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
AWZ60384.1|2468178_2468388_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ60383.1|2468436_2468697_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ57752.1|2468958_2469147_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWZ57753.1|2469143_2469335_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWZ57754.1|2469427_2470423_+	exonuclease	NA	NA	NA	NA	NA
AWZ57755.1|2470457_2470823_+|transposase	transposase	transposase	NA	NA	NA	NA
AWZ57756.1|2470822_2472010_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	2708727	2770264	5233637	transposase,terminase,integrase,capsid,lysis,holin	Enterobacteria_phage(23.08%)	57	2739306:2739341	2771204:2771239
AWZ57961.1|2708727_2709216_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
AWZ60397.1|2709378_2710302_+|capsid	phage major capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
AWZ57962.1|2710766_2710991_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AWZ57963.1|2713387_2713645_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ57964.1|2713676_2714324_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWZ57965.1|2714358_2715411_-	cytochrome c biogenesis protein CcmH	NA	NA	NA	NA	NA
AWZ57966.1|2715407_2715965_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AWZ57967.1|2715961_2717905_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
AWZ57968.1|2717901_2718381_-	cytochrome c-type biogenesis protein CcmE	NA	NA	NA	NA	NA
AWZ57969.1|2718377_2718587_-	heme exporter protein D	NA	NA	NA	NA	NA
AWZ57970.1|2718583_2719321_-	heme exporter protein C	NA	NA	NA	NA	NA
AWZ57971.1|2719362_2720025_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
AWZ57972.1|2720021_2720645_-	cytochrome c biogenesis ATP-binding export protein CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.0e-12
AWZ57973.1|2720657_2721260_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
AWZ57974.1|2721269_2721719_-	nitrate reductase	NA	NA	NA	NA	NA
AWZ57975.1|2721715_2722579_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
AWZ57976.1|2722565_2723261_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
AWZ57977.1|2723267_2725754_-	periplasmic nitrate reductase subunit alpha	NA	NA	NA	NA	NA
AWZ57978.1|2725750_2726014_-	protein NapD	NA	NA	NA	NA	NA
AWZ57979.1|2726003_2726498_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
AWZ57980.1|2726597_2726771_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ57981.1|2726906_2727395_+	ecotin	NA	NA	NA	NA	NA
AWZ57982.1|2727543_2729190_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AWZ57983.1|2729407_2731051_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
AWZ57984.1|2731126_2731777_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
AWZ57985.1|2731776_2732841_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
AWZ57986.1|2732914_2733970_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AWZ57987.1|2734081_2735173_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
AWZ57988.1|2735453_2735681_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ57989.1|2735655_2735895_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ57990.1|2735911_2738584_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
AWZ57991.1|2738600_2739251_+	DNA-binding response regulator	NA	NA	NA	NA	NA
2739306:2739341	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
AWZ57992.1|2739450_2742300_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
AWZ57993.1|2742574_2743351_-	DUF2135 domain-containing protein	NA	NA	NA	NA	NA
AWZ57994.1|2743355_2745005_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
AWZ57995.1|2745005_2749520_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ57996.1|2750201_2751524_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
AWZ57997.1|2752217_2752751_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	42.0	6.4e-28
AWZ57998.1|2752893_2754106_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ57999.1|2754146_2754671_-	hypothetical protein	NA	A0A0N7CEE8	Salmonella_phage	89.7	1.2e-84
AWZ58000.1|2754820_2755258_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	5.0e-71
AWZ58001.1|2755254_2755752_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
AWZ60398.1|2755751_2755967_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
AWZ58002.1|2756588_2756747_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AWZ58003.1|2757839_2758463_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
AWZ58004.1|2758459_2759125_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
AWZ58005.1|2759121_2759724_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
AWZ58006.1|2759698_2760265_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
AWZ58007.1|2760824_2761757_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.1e-151
AWZ58008.1|2761795_2762623_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
AWZ60399.1|2763126_2763309_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
AWZ58009.1|2763465_2763810_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
AWZ58010.1|2763915_2764134_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
AWZ58011.1|2764111_2765182_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
AWZ58012.1|2765176_2765803_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
AWZ58013.1|2765799_2767488_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
AWZ58014.1|2767636_2770264_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
2771204:2771239	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 12
CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	3119984	3204609	5233637	transposase,terminase,integrase,tail,portal,lysis,tRNA	Enterobacteria_phage(68.52%)	90	3187966:3187981	3211413:3211428
AWZ58328.1|3119984_3120722_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AWZ58329.1|3120853_3122188_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AWZ58330.1|3122397_3123279_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ58331.1|3123382_3123970_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AWZ58332.1|3124025_3124409_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
AWZ58333.1|3124712_3125402_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
AWZ58334.1|3125449_3126487_-	methyltransferase	NA	NA	NA	NA	NA
AWZ58335.1|3126476_3126680_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ58336.1|3126693_3127113_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AWZ60409.1|3127181_3127880_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AWZ58337.1|3127911_3130572_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AWZ58338.1|3130685_3132041_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
AWZ58339.1|3132086_3132410_+	lipoprotein	NA	NA	NA	NA	NA
AWZ58340.1|3132406_3133705_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
AWZ58341.1|3133686_3133800_-	alpha-ketoglutarate permease	NA	NA	NA	NA	NA
AWZ58342.1|3139557_3142131_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
AWZ58343.1|3142260_3142992_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AWZ58344.1|3142988_3143969_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AWZ58345.1|3144103_3144841_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AWZ58346.1|3144870_3145077_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ58347.1|3145111_3145453_+	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AWZ60410.1|3145556_3145604_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ58348.1|3145702_3146863_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AWZ58349.1|3146905_3148027_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AWZ58350.1|3148037_3149108_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
AWZ58351.1|3149317_3149683_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ58352.1|3149832_3150351_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AWZ58353.1|3150340_3151567_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWZ58354.1|3151582_3152065_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ58355.1|3152141_3152489_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AWZ58356.1|3152530_3153298_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AWZ58357.1|3153328_3153877_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWZ58358.1|3153895_3154144_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWZ58359.1|3154392_3155754_-	signal recognition particle protein	NA	NA	NA	NA	NA
AWZ60411.1|3155920_3156712_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWZ60412.1|3156777_3158019_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AWZ58360.1|3158073_3158667_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWZ58361.1|3158663_3158858_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AWZ58362.1|3158789_3159668_+	NAD(+) kinase	NA	NA	NA	NA	NA
AWZ58363.1|3159753_3161415_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AWZ58364.1|3161563_3161905_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWZ58365.1|3161966_3162257_-	RnfH family protein	NA	NA	NA	NA	NA
AWZ58366.1|3162246_3162723_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AWZ58367.1|3162854_3163337_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AWZ58368.1|3164185_3164434_+	DNA damage-inducible protein DinI	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
AWZ58369.1|3164801_3165071_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
AWZ58370.1|3165072_3166395_-|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	99.1	3.7e-77
AWZ58371.1|3166459_3167059_-	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
AWZ58372.1|3167126_3170603_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
AWZ58373.1|3170849_3171530_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.2	8.7e-115
AWZ58374.1|3171427_3172171_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
AWZ58375.1|3172176_3172875_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
AWZ58376.1|3172874_3173204_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWZ58377.1|3175752_3176965_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ58378.1|3176968_3177115_-|tail	phage tail protein	tail	Q687G0	Enterobacteria_phage	100.0	3.5e-21
AWZ58379.1|3177127_3177751_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
AWZ58380.1|3177753_3178035_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
AWZ58381.1|3178027_3178354_-	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
AWZ60413.1|3178441_3180397_-	peptidase S14	NA	S5M7Q8	Escherichia_phage	99.8	0.0e+00
AWZ58382.1|3180410_3181913_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
AWZ58383.1|3181912_3182149_-	hypothetical protein	NA	Q687G1	Enterobacteria_phage	100.0	4.5e-34
AWZ58384.1|3182121_3184245_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
AWZ58385.1|3184241_3184718_-	DUF1441 domain-containing protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
AWZ58386.1|3185130_3185598_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	100.0	7.7e-78
AWZ58387.1|3186381_3186651_-	Shiga toxin Stx1 subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
AWZ58388.1|3186660_3187608_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	99.7	1.6e-170
AWZ58389.1|3187880_3188126_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
3187966:3187981	attL	TTTTTAAGATTTTGTT	NA	NA	NA	NA
AWZ58390.1|3188114_3188549_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
AWZ58391.1|3188541_3188736_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
AWZ58392.1|3188732_3189338_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
AWZ58393.1|3190135_3190840_-	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
AWZ58394.1|3191114_3191297_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
AWZ58395.1|3191293_3191821_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
AWZ58396.1|3191817_3192264_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
AWZ58397.1|3192220_3192646_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	1.4e-78
AWZ58398.1|3192815_3193094_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
AWZ58399.1|3193163_3193433_-	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
AWZ58400.1|3193432_3194884_-	helicase DnaB	NA	Q08J37	Stx2-converting_phage	100.0	7.7e-278
AWZ58401.1|3194858_3195758_-	DNA replication protein	NA	Q8VNP8	Enterobacteria_phage	100.0	1.6e-164
AWZ58402.1|3195750_3195897_-	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
AWZ58403.1|3195931_3196210_-	hypothetical protein	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
AWZ58404.1|3196302_3197515_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ58405.1|3197746_3198259_+	single-stranded DNA-binding protein	NA	Q8VNQ1	Enterobacteria_phage	100.0	1.8e-75
AWZ58406.1|3198272_3198566_+	RecBCD nuclease inhibitor	NA	Q687G7	Enterobacteria_phage	100.0	8.5e-51
AWZ58407.1|3198576_3198744_+	DUF2737 domain-containing protein	NA	Q687G8	Enterobacteria_phage	100.0	3.0e-24
AWZ58408.1|3198740_3199340_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	100.0	1.8e-111
AWZ58409.1|3199341_3200613_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	7.0e-182
AWZ58410.1|3200651_3201068_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
AWZ58411.1|3201140_3202889_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
AWZ60414.1|3202890_3204609_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	5.5e-307
3211413:3211428	attR	TTTTTAAGATTTTGTT	NA	NA	NA	NA
>prophage 13
CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	3276137	3283277	5233637		Escherichia_phage(83.33%)	6	NA	NA
AWZ58479.1|3276137_3278699_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
AWZ58480.1|3278804_3279461_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
AWZ58481.1|3279511_3280279_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AWZ58482.1|3280474_3281383_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AWZ58483.1|3281379_3282642_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
AWZ58484.1|3282638_3283277_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 14
CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	4825635	4876006	5233637	terminase,integrase,tail,capsid,lysis,holin,tRNA,head	Enterobacteria_phage(38.89%)	55	4867204:4867218	4879948:4879962
AWZ59887.1|4825635_4825758_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AWZ59888.1|4825886_4826420_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
AWZ59889.1|4826837_4827098_-	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	98.8	4.2e-41
AWZ59890.1|4828555_4829308_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
AWZ59891.1|4829393_4829603_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.4	2.6e-25
AWZ59892.1|4829617_4829770_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
AWZ59893.1|4830587_4832438_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.9	0.0e+00
AWZ59894.1|4832732_4832879_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ59895.1|4832877_4833093_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWZ59896.1|4833092_4833590_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
AWZ59897.1|4833586_4834054_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	80.1	4.0e-58
AWZ59898.1|4834136_4834277_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ59899.1|4834519_4834834_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWZ59900.1|4835734_4836298_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
AWZ59901.1|4836294_4837956_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
AWZ59902.1|4838019_4839957_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.4	0.0e+00
AWZ60473.1|4840001_4840223_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
AWZ59903.1|4842586_4842913_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AWZ59904.1|4842922_4843273_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWZ59905.1|4843269_4843716_+	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
AWZ59906.1|4843712_4844057_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWZ59907.1|4844123_4844840_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
AWZ59908.1|4844845_4845220_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
AWZ59909.1|4845243_4845525_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AWZ59910.1|4845576_4848819_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
AWZ59911.1|4848811_4849153_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
AWZ59912.1|4849152_4849851_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	3.1e-131
AWZ59913.1|4849861_4850605_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
AWZ59914.1|4850502_4851183_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	91.2	2.0e-106
AWZ59915.1|4851136_4851349_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ59916.1|4851418_4854895_+|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	96.0	0.0e+00
AWZ60474.1|4854963_4855587_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
AWZ59917.1|4855651_4856965_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
AWZ59918.1|4856966_4857236_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
AWZ59919.1|4857396_4857819_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
AWZ59920.1|4857949_4859008_-	type III effector	NA	NA	NA	NA	NA
AWZ59921.1|4859086_4859737_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
AWZ59922.1|4859919_4860510_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
AWZ60475.1|4860496_4860616_-	ferredoxin	NA	NA	NA	NA	NA
AWZ59923.1|4861011_4861260_-	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
AWZ59924.1|4862508_4863546_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AWZ59925.1|4863679_4863922_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
AWZ59926.1|4864087_4865071_-	quinone oxidoreductase	NA	NA	NA	NA	NA
AWZ59927.1|4865153_4866569_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
AWZ59928.1|4866621_4867701_+	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
4867204:4867218	attL	GGTGGCATTCTGCTG	NA	NA	NA	NA
AWZ59929.1|4867953_4869147_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
AWZ59930.1|4869368_4869911_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ59931.1|4870273_4870987_+	acid phosphatase AphA	NA	NA	NA	NA	NA
AWZ59932.1|4871097_4871514_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AWZ59933.1|4871517_4871874_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AWZ59934.1|4871908_4874731_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
AWZ59935.1|4874681_4874864_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ59936.1|4874984_4875521_+	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AWZ59937.1|4875619_4875901_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ59938.1|4875859_4876006_+|integrase	integrase	integrase	NA	NA	NA	NA
4879948:4879962	attR	GGTGGCATTCTGCTG	NA	NA	NA	NA
>prophage 1
CP028433	Escherichia coli strain RM9975 plasmid pRM9975-1, complete sequence	120253	0	119510	120253	integrase,transposase,tail,terminase,tRNA,protease,capsid	Salmonella_phage(82.88%)	130	1102:1161	52781:54092
AWZ60490.1|0_1056_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	91.0	5.4e-172
1102:1161	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
AWZ60491.1|1155_2368_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ60492.1|2715_3928_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ60493.1|4171_4384_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
AWZ60494.1|4383_4719_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
AWZ60495.1|4715_4895_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	67.8	4.0e-11
AWZ60496.1|4934_5210_-	hypothetical protein	NA	J9Q738	Salmonella_phage	74.7	2.0e-33
AWZ60613.1|5265_5682_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	76.9	7.6e-61
AWZ60497.1|5782_6613_-|protease	serine protease	protease	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
AWZ60498.1|6616_6817_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	59.1	7.2e-09
AWZ60499.1|7674_8887_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ60500.1|8871_12441_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.0	0.0e+00
AWZ60501.1|12744_12960_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	77.1	2.9e-24
AWZ60502.1|13289_13853_-	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	67.7	1.3e-66
AWZ60503.1|13913_14138_-	hypothetical protein	NA	J9Q735	Salmonella_phage	56.9	2.2e-14
AWZ60504.1|14392_14824_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	83.9	9.9e-64
AWZ60505.1|14941_15982_+	regulator	NA	J9Q7Z3	Salmonella_phage	89.9	4.9e-117
AWZ60506.1|16042_16987_+	exonuclease	NA	J9Q7S6	Salmonella_phage	88.9	1.0e-161
AWZ60507.1|16986_17253_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
AWZ60508.1|17664_18878_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ60509.1|19122_20358_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	80.8	2.0e-197
AWZ60510.1|20453_22562_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	67.2	2.5e-229
AWZ60511.1|22660_22873_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ60512.1|23124_23511_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ60513.1|23505_24609_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
AWZ60514.1|24782_25193_-	toxin YafO	NA	NA	NA	NA	NA
AWZ60614.1|25202_25655_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ60515.1|25906_26152_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	3.5e-13
AWZ60516.1|26325_27234_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ60517.1|28746_29037_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
AWZ60518.1|29182_29398_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	9.7e-20
AWZ60519.1|29394_30717_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	91.1	3.4e-240
AWZ60520.1|30713_30971_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	56.6	5.6e-14
AWZ60521.1|31251_32034_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	43.4	3.0e-58
AWZ60522.1|32159_32573_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	48.1	3.9e-25
AWZ60523.1|32803_33949_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AWZ60524.1|33940_35122_-	DNA primase	NA	J9Q720	Salmonella_phage	91.4	3.5e-204
AWZ60525.1|35203_36544_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	93.3	9.8e-235
AWZ60526.1|36587_37328_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.6	2.2e-127
AWZ60527.1|37610_38378_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ60528.1|38430_38790_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
AWZ60529.1|38789_39458_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
AWZ60530.1|39633_40846_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ60615.1|41089_41359_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AWZ60531.1|41366_41888_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWZ60532.1|41920_42106_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	75.0	4.9e-20
AWZ60533.1|42056_42308_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	75.6	2.0e-24
AWZ60534.1|42309_43002_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.8e-123
AWZ60535.1|43015_43339_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	88.8	2.9e-44
AWZ60536.1|43541_46205_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	39.2	2.2e-68
AWZ60616.1|46844_46916_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ60537.1|51572_52786_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ60538.1|53718_54312_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	3.4e-99
52781:54092	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCATACCCCAGCGTAAGTGTTACTGGACTCGTTATAGTTTGAAGGTACTCGAATTTTTAGGCCACGCACCAGATAAGAGCGAGATGGCATGGTGCTACCGAATTGCTCAGAGTTTACCTTCAATCCAACCAAAACAGAGTTTGGATAGTTCATCGGTGTATCGACAATTTCCCCGATTGAATCCACCCATGTATCGTTATAGAGATACTGGCTACTGTTATCATCGGTAATACGGACTACACGAACCTTGTATGCGCGTCCAGGCTTAGGCAGCTTCAGCTCGTAGCTACGGTAATAAACGCCGGTCTTCTTTGCTGTTAGCTTAATGCCAACGCTTTTTTCACCTTCCGCGACCACATCTACAAATGTTGAGTCGCCATTTGCTATCTGGAACTTGTACTCAACAGTCGTACCGTTCGTGTCACCAGTTTTTTTATCTATGCTTCGCAAAGAAGGAAACTTCATGATGACACGAACCCGATCAGCTTCATCGTTATCGATTGAAACCGTTACATAATGTGTTTTTTTTAACTGGATATTGACGGATTTAGGCGTTTCAACGAAATCAAAGCCAGACATTGGAGTCTGGTCTTGTGAACCGTCGCGAAAATCCCATGTGATTCCGCTGAAGTTGGAGGAACCGTCTTCATTTACAATCGGCAGATCGTCGATAAAAATAGATCTTGCGCCATTTACTAAGCCGCCAATTACCCCTTCCCCAAGAAGATCGAGGATAGCGGCCATTGCACGAGAATTTACGGTATCGTCGGCTTCAACCGGTGTACGGCTGGAGCTTTTGCTGCTTTTTTTACCACCCGCACCGGCAATAAACAGCGGTAGCTTTTTCTTCTTGAACTGTTCCATGTTCAAAAAATCCTTGTTTACATTAGCTGGTCAATCGTGATTGAAGAACTCACAACCTGTGAGCCAACCAGAATTTCCTCGCCATAGATAAGTTGTACTGGGTTGCCCTGGTTTTCTGTATTTTGAGGGCCGTCGAAATAATAAGAGTTCGAGTTATCTGCCTGTCTCACACTTTCGTTAGTGGCTTGCGGCGATATGATTTGTGATATGCCGCCCATCATCAGTGACAAACCGAGAGGTGCTAAAGCAGGCATCACTACCGCCGATACAACCAACAAAGCGGCCCCTACTACCGTCTGAAACCACCCAAAAGCAGATCCACCGCTTCCTCGCGGAACAGGTGTAATGCGGATTTTGGCAATGTTGTCAGACTGCCCCATCATCTGATATT	NA	NA	NA	NA
AWZ60539.1|54299_55097_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	93.2	1.9e-153
AWZ60540.1|55869_56205_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	1.8e-52
AWZ60541.1|56247_60807_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	80.0	0.0e+00
AWZ60542.1|60814_61084_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.8	1.7e-34
AWZ60543.1|61164_61482_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
AWZ60544.1|61537_62284_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	92.7	2.4e-121
AWZ60545.1|62358_62742_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.2e-57
AWZ60546.1|62743_63217_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
AWZ60547.1|63207_63552_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
AWZ60548.1|63631_64465_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.4	2.7e-142
AWZ60549.1|64464_64899_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.2	9.7e-59
AWZ60550.1|64943_65864_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	83.9	1.3e-132
AWZ60551.1|65937_66813_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	93.8	1.5e-154
AWZ60552.1|66838_67726_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	87.9	1.1e-130
AWZ60553.1|67747_69322_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	92.9	2.4e-285
AWZ60554.1|69348_70605_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
AWZ60555.1|70604_71237_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	83.3	1.2e-89
AWZ60556.1|71435_71702_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
AWZ60557.1|71711_72602_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
AWZ60558.1|72598_73264_-	adenylyl-sulfate kinase	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
AWZ60559.1|73260_73929_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
AWZ60560.1|73928_74627_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	87.1	5.1e-110
AWZ60561.1|74691_76251_+	ATP-dependent helicase	NA	J9Q7I4	Salmonella_phage	92.9	1.3e-278
AWZ60562.1|76253_76532_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
AWZ60563.1|76564_77164_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ60564.1|77549_78350_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	31.3	6.0e-06
AWZ60565.1|78452_78974_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	79.7	1.2e-66
AWZ60566.1|79269_79920_+	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	1.1e-98
AWZ60567.1|79969_80173_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	91.0	5.9e-27
AWZ60568.1|80193_80421_+	hypothetical protein	NA	A0A1S6KV93	Providencia_phage	41.3	2.5e-05
AWZ60569.1|81030_81513_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
AWZ60570.1|81717_82005_-	ABC transporter	NA	J9Q753	Salmonella_phage	77.4	1.5e-36
AWZ60571.1|82843_83239_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	53.8	1.2e-31
AWZ60572.1|83365_83677_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
AWZ60573.1|83830_84160_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ60574.1|84413_84758_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ60575.1|86413_86599_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ60617.1|86635_86857_-	hypothetical protein	NA	J9Q750	Salmonella_phage	58.2	1.9e-18
AWZ60576.1|87096_89130_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
AWZ60577.1|89287_90388_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AWZ60578.1|90425_90815_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	8.6e-67
AWZ60579.1|90905_91148_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ60580.1|91616_92243_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	71.1	3.3e-07
AWZ60581.1|92619_93537_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	44.2	2.3e-46
AWZ60582.1|93536_93722_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ60583.1|93696_94263_-	hypothetical protein	NA	A0A222YWM9	Escherichia_phage	59.5	1.7e-42
AWZ60584.1|94259_94715_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	60.2	1.2e-19
AWZ60585.1|94853_95234_-	hypothetical protein	NA	J9Q801	Salmonella_phage	69.8	5.9e-28
AWZ60586.1|95233_95938_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	76.9	7.2e-88
AWZ60587.1|95999_97685_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.3	0.0e+00
AWZ60588.1|97788_98403_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	82.8	1.2e-99
AWZ60589.1|98405_98687_-	hypothetical protein	NA	A0A0E3JPT1	Enterobacteria_phage	76.3	3.2e-39
AWZ60590.1|98742_99312_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	61.4	1.4e-52
AWZ60591.1|99451_99610_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AWZ60592.1|99609_100035_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	83.0	2.8e-58
AWZ60593.1|100128_100326_-	hypothetical protein	NA	J9Q800	Salmonella_phage	56.9	2.6e-11
AWZ60594.1|100322_100574_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ60595.1|100975_101569_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.8	1.7e-93
AWZ60596.1|102153_102384_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	85.5	2.0e-31
AWZ60597.1|102569_103163_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	2.0e-99
AWZ60598.1|103346_104156_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.2	1.3e-64
AWZ60599.1|104314_104830_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	82.2	3.1e-80
AWZ60600.1|104878_106092_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ60601.1|106194_106614_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	3.2e-51
AWZ60602.1|106675_107320_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	81.3	7.8e-97
AWZ60603.1|107319_107796_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.5	2.0e-81
AWZ60604.1|107792_108206_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	84.7	2.3e-62
AWZ60618.1|108207_109335_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	86.6	1.9e-191
AWZ60605.1|109482_110352_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	80.6	5.3e-133
AWZ60606.1|110429_111572_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
AWZ60607.1|111678_113994_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.3	0.0e+00
AWZ60608.1|114067_114637_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
AWZ60609.1|114646_115390_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.2	1.5e-51
AWZ60610.1|115379_117296_-	exonuclease	NA	J9Q741	Salmonella_phage	73.0	4.9e-248
AWZ60619.1|117292_117484_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	76.2	3.7e-23
AWZ60611.1|117525_118611_-	exonuclease	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
AWZ60612.1|118865_119510_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
>prophage 1
CP028434	Escherichia coli strain RM9975 plasmid pRM9975-2, complete sequence	78526	2288	39890	78526	transposase	Escherichia_phage(36.36%)	51	NA	NA
AWZ60625.1|2288_3476_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWZ60626.1|3475_3841_-|transposase	transposase	transposase	NA	NA	NA	NA
AWZ60627.1|3979_4234_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ60628.1|4244_4436_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	41.3	3.5e-05
AWZ60629.1|4740_8706_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	39.9	1.1e-230
AWZ60630.1|8850_9060_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	7.8e-06
AWZ60631.1|9025_10239_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
AWZ60632.1|10878_11274_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AWZ60633.1|11273_12233_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.6	6.0e-61
AWZ60695.1|12505_13408_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AWZ60634.1|13411_13717_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ60635.1|13792_14164_+	DNA modification methylase	NA	A0A2I7RE86	Vibrio_phage	33.9	1.4e-10
AWZ60636.1|14270_15458_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWZ60637.1|15457_15823_-|transposase	transposase	transposase	NA	NA	NA	NA
AWZ60638.1|16098_17286_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWZ60639.1|17285_17651_-|transposase	transposase	transposase	NA	NA	NA	NA
AWZ60640.1|17578_17764_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ60641.1|17900_18326_+	antirestriction protein	NA	NA	NA	NA	NA
AWZ60642.1|18372_18795_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWZ60643.1|18791_18983_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ60644.1|19347_19596_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ60645.1|19526_19763_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ60646.1|20020_20251_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ60647.1|20302_21664_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AWZ60648.1|22272_22515_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ60697.1|22424_22685_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ60649.1|22588_22813_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ60696.1|22735_22930_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ60650.1|22856_23093_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ60651.1|23157_23685_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	54.1	4.6e-47
AWZ60652.1|23740_23974_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	3.9e-06
AWZ60653.1|24032_25991_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.9	6.6e-22
AWZ60654.1|26045_26480_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AWZ60655.1|26476_27196_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AWZ60656.1|27475_27634_+	protein hok	NA	NA	NA	NA	NA
AWZ60657.1|27853_28084_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ60698.1|28134_28323_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ60658.1|28324_28531_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWZ60659.1|28555_28843_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ60660.1|28852_29785_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.8e-44
AWZ60661.1|31004_31388_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AWZ60662.1|31574_32264_+	conjugal transfer protein TraJ	NA	NA	NA	NA	NA
AWZ60699.1|32362_32758_+	relaxosome protein TraY	NA	NA	NA	NA	NA
AWZ60663.1|32790_33150_+	pilin	NA	NA	NA	NA	NA
AWZ60664.1|33164_33476_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AWZ60665.1|33497_34064_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
AWZ60700.1|34107_34779_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
AWZ60666.1|34778_36206_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AWZ60667.1|36195_36786_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
AWZ60668.1|36772_36895_+	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
AWZ60669.1|38676_39890_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
