The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	38221	85968	4989783	transposase,holin,integrase	Staphylococcus_phage(22.22%)	39	53084:53098	89053:89067
AWZ82646.1|38221_38998_-|integrase	phage integrase family protein	integrase	T1S9J3	Salmonella_phage	26.4	1.2e-11
AWZ79156.1|39205_39337_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ83085.1|39974_40160_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ79100.1|40374_40989_+	inner membrane protein YagU	NA	NA	NA	NA	NA
AWZ80428.1|41873_42530_-	gram-negative pili assembly chaperone, N-terminal domain protein	NA	NA	NA	NA	NA
AWZ82351.1|42552_44124_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82943.1|44185_46711_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ79759.1|46736_47405_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ80536.1|47461_48049_-	fimbrillin MatB	NA	NA	NA	NA	NA
AWZ79768.1|48123_48666_-	HTH-type transcriptional regulator MatA	NA	NA	NA	NA	NA
AWZ78751.1|49749_49893_-	ribosomal protein L36	NA	NA	NA	NA	NA
AWZ81991.1|49889_50153_-	ribosomal protein L31	NA	NA	NA	NA	NA
AWZ80809.1|51091_52198_-	flavin oxidoreductase / NADH oxidase family protein	NA	NA	NA	NA	NA
AWZ82655.1|52406_53327_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
53084:53098	attL	GATCTTCCAGATAAC	NA	NA	NA	NA
AWZ83088.1|53483_54410_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWZ80034.1|54609_55503_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWZ81581.1|55533_56523_-	aldo/keto reductase family protein	NA	NA	NA	NA	NA
AWZ80680.1|56549_57401_-	aldo/keto reductase family protein	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
AWZ80421.1|57966_62214_+	bacterial Ig-like domain family protein	NA	NA	NA	NA	NA
AWZ79357.1|62338_63196_-	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWZ80879.1|63744_64248_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	94.0	1.6e-89
AWZ80471.1|64312_65089_+	aldo/keto reductase family protein	NA	A0A2H4PQR8	Staphylococcus_phage	43.5	5.2e-47
AWZ81518.1|65248_65842_-	inner membrane protein YkgB	NA	NA	NA	NA	NA
AWZ79784.1|65853_66090_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ81144.1|66198_67524_-	pyridine nucleotide-disulfide oxidoreductase family protein	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
AWZ82888.1|67750_68605_+	cupin family protein	NA	NA	NA	NA	NA
AWZ80552.1|69130_69850_+	cysteine-rich domain protein	NA	NA	NA	NA	NA
AWZ80630.1|69860_71288_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AWZ82578.1|71280_71976_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78862.1|72218_72887_-	G-rich domain on tyrosine kinase family protein	NA	NA	NA	NA	NA
AWZ82569.1|73070_75362_-	outer membrane autotransporter barrel domain protein	NA	NA	NA	NA	NA
AWZ81123.1|75403_75955_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ79739.1|76318_77113_-	bacterial regulatory, luxR family protein	NA	NA	NA	NA	NA
AWZ82850.1|77442_77913_-|integrase	phage integrase family protein	integrase	A0A2L1IV36	Escherichia_phage	56.9	3.2e-47
AWZ81551.1|79091_80762_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	8.9e-60
AWZ78485.1|80775_82239_-	betaine aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWZ82213.1|82261_82849_-	transcriptional repressor BetI	NA	NA	NA	NA	NA
AWZ78642.1|82977_85011_+|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
AWZ83168.1|85464_85968_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	96.4	4.5e-92
89053:89067	attR	GATCTTCCAGATAAC	NA	NA	NA	NA
>prophage 2
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	619066	690201	4989783	tRNA,plate,tail,protease,integrase,terminase,head	Burkholderia_virus(34.62%)	81	675799:675814	695120:695135
AWZ80229.1|619066_619387_+|protease	ATP-dependent Clp protease adaptor ClpS family protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AWZ79993.1|619417_621694_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AWZ80035.1|622378_622597_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWZ82969.1|622881_623586_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWZ78703.1|623627_625349_-	thiol reductant ABC exporter, CydC subunit	NA	W8CYL7	Bacillus_phage	25.0	1.4e-20
AWZ80665.1|625349_627116_-	thiol reductant ABC exporter, CydD subunit	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AWZ80064.1|627238_628204_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
AWZ82410.1|628747_629242_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AWZ81345.1|629376_633483_+	ftsK/SpoIIIE family protein	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AWZ78545.1|633641_634253_+	outer membrane lipocarrier protein LolA	NA	NA	NA	NA	NA
AWZ79450.1|634320_635607_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.4	2.5e-78
AWZ80077.1|635697_636990_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AWZ81401.1|637228_639673_+	dimethyl sulfoxide reductase DmsA	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AWZ82879.1|639683_640301_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AWZ79154.1|640302_641166_+	DMSO reductase anchor subunit family protein	NA	NA	NA	NA	NA
AWZ80920.1|641201_641828_-	isochorismatase family protein	NA	NA	NA	NA	NA
AWZ81487.1|641982_642111_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82447.1|642165_643290_+	sugar (and other) transporter family protein	NA	NA	NA	NA	NA
AWZ79330.1|643386_644127_-	pyruvate formate-lyase 1-activating enzyme	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
AWZ79831.1|644318_646601_-	formate acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AWZ78994.1|646655_647513_-	formate transporter FocA	NA	NA	NA	NA	NA
AWZ82565.1|647918_649679_-	ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
AWZ82710.1|649808_650501_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ82782.1|650699_651788_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
AWZ79889.1|651858_653142_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AWZ81753.1|653397_653763_-	resolvase, N terminal domain protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.1	1.1e-47
AWZ82717.1|654041_654503_+	phage Tail Collar domain protein	NA	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
AWZ78663.1|654509_655124_-|tail	caudovirales tail fiber assembly family protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
AWZ81103.1|655123_655606_-	phage Tail Collar domain protein	NA	K7P7Q7	Enterobacteria_phage	44.7	7.5e-28
AWZ78899.1|655646_656894_-|tail	phage tail fiber repeat family protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
AWZ78771.1|656896_657475_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
AWZ79481.1|657467_658571_-|plate	baseplate J-like family protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
AWZ81493.1|658561_658909_-	lysozyme family protein	NA	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
AWZ80512.1|658963_659560_-|plate	phage baseplate assembly V family protein	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
AWZ81764.1|659556_660711_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
AWZ79988.1|660698_660911_-	phage Tail Protein X family protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
AWZ79352.1|660910_661579_-	phage P2 GpU family protein	NA	A4JWL1	Burkholderia_virus	38.8	9.4e-21
AWZ82780.1|661621_661822_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ81903.1|661794_664746_-|tail	phage tail tape measure protein, TP901 family, core region	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
AWZ80302.1|664903_665209_-	mu-like prophage FluMu gp41 family protein	NA	NA	NA	NA	NA
AWZ83196.1|665336_665528_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ81351.1|665620_666142_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
AWZ81700.1|666141_667569_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
AWZ78533.1|667558_667810_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82863.1|667809_668274_-	putative cytoplasmic protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AWZ80545.1|668273_668720_-	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AWZ82995.1|668721_669060_-	putative dihydrolipoamide acyltransferase	NA	NA	NA	NA	NA
AWZ80337.1|669069_670023_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
AWZ82109.1|670037_671153_-|protease	putative protease	protease	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
AWZ80821.1|671367_671826_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
AWZ82201.1|671828_672650_-|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
AWZ80299.1|672630_674127_-	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
AWZ81972.1|674126_675659_-|terminase	terminase-like family protein	terminase	A4JWJ4	Burkholderia_virus	62.8	6.2e-185
AWZ80727.1|675718_676264_-	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
675799:675814	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
AWZ81842.1|676263_676575_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AWZ80319.1|676574_676901_-	putative phage membrane protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
AWZ82593.1|676897_677548_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
AWZ80913.1|677531_678272_-	transglycosylase SLT domain protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
AWZ79548.1|678274_678625_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
AWZ80002.1|678755_679484_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ80094.1|679459_679861_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ80675.1|679862_680078_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ81894.1|680268_681033_+	DNA adenine methylase family protein	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
AWZ81195.1|681149_681473_-	helix-turn-helix family protein	NA	NA	NA	NA	NA
AWZ81637.1|681599_681788_+	hypothetical protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
AWZ82875.1|681840_682149_+	winged helix-turn-helix DNA-binding family protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
AWZ80599.1|682159_683080_+	hypothetical protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
AWZ82128.1|683079_683397_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ81657.1|683412_685182_+|integrase	integrase core domain protein	integrase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
AWZ82751.1|685192_686359_+	AAA domain protein	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
AWZ81501.1|686505_686631_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ80381.1|686658_687189_+	bacteriophage Mu Gam like family protein	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
AWZ81855.1|687199_687421_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82730.1|687594_687750_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ79280.1|687759_688056_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ79566.1|688070_688286_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ79892.1|688282_688966_+	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
AWZ80801.1|688962_689193_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ82404.1|689182_689389_+	putative membrane protein	NA	NA	NA	NA	NA
AWZ78467.1|689390_689840_+	hypothetical protein	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
AWZ81926.1|689811_690201_+	mor transcription activator family protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
695120:695135	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 3
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	960735	975260	4989783	transposase,integrase	Shigella_phage(50.0%)	18	969987:970000	975640:975653
AWZ81564.1|960735_961665_+|integrase	phage integrase family protein	integrase	A0A1B1P7C7	Bacillus_phage	28.5	4.4e-08
AWZ80234.1|961651_962266_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82318.1|962488_962686_+	prophage CP4-57 regulatory family protein	NA	A0A1V0E8E5	Vibrio_phage	43.9	7.3e-06
AWZ78855.1|962687_963155_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ82205.1|963242_964097_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ81457.1|964390_964663_+|transposase	transposase family protein	transposase	Q716C1	Shigella_phage	96.5	2.9e-37
AWZ79612.1|964718_965537_+|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	95.9	2.6e-158
AWZ82424.1|965949_967323_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ81306.1|967927_968182_+|integrase	putative phage integrase	integrase	NA	NA	NA	NA
AWZ83115.1|968218_968335_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ79428.1|968319_970977_+	hypothetical protein	NA	NA	NA	NA	NA
969987:970000	attL	GCGGATTGTCTCTG	NA	NA	NA	NA
AWZ81824.1|970973_971186_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ81364.1|971136_972369_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ80489.1|972555_972693_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ83038.1|973250_973502_+	istB-like ATP binding family protein	NA	A0A2L1IVB6	Escherichia_phage	92.8	7.8e-37
AWZ80772.1|973660_973807_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ80479.1|974124_974541_-|integrase	integrase core domain protein	integrase	U5P429	Shigella_phage	60.4	7.1e-43
AWZ81643.1|974975_975260_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
975640:975653	attR	GCGGATTGTCTCTG	NA	NA	NA	NA
>prophage 4
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	1019133	1109486	4989783	tRNA,capsid,tail,protease,integrase,portal,transposase,terminase,head,lysis	Escherichia_phage(22.41%)	98	1081225:1081240	1112472:1112487
AWZ82800.1|1019133_1020339_-|transposase	transposase DDE domain protein	transposase	NA	NA	NA	NA
AWZ78766.1|1020463_1023139_-	aldehyde-alcohol dehydrogenase	NA	NA	NA	NA	NA
AWZ79337.1|1023615_1024263_+	marC integral membrane family protein	NA	NA	NA	NA	NA
AWZ79536.1|1024420_1024582_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78803.1|1025000_1026632_+	periplasmic oligopeptide-binding protein	NA	NA	NA	NA	NA
AWZ78458.1|1026717_1027638_+	oligopeptide transport system permease protein OppB	NA	NA	NA	NA	NA
AWZ82273.1|1027652_1028561_+	oligopeptide transport system permease protein OppC	NA	NA	NA	NA	NA
AWZ81778.1|1028572_1029586_+	oligopeptide/dipeptide ABC transporter, ATP-binding, C-terminal domain protein	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
AWZ79057.1|1029582_1030587_+	oligopeptide/dipeptide ABC transporter, ATP-binding, C-terminal domain protein	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
AWZ79604.1|1030639_1030969_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ79133.1|1031003_1032464_-	cardiolipin synthase	NA	NA	NA	NA	NA
AWZ82127.1|1032834_1034043_-	voltage-gated potassium channel Kch	NA	NA	NA	NA	NA
AWZ79813.1|1034387_1034684_-	protein YciI	NA	NA	NA	NA	NA
AWZ80460.1|1034907_1035624_+	protein TonB	NA	NA	NA	NA	NA
AWZ80398.1|1035663_1036008_-	thioesterase superfamily protein	NA	NA	NA	NA	NA
AWZ81052.1|1036166_1036706_-	intracellular septation protein A	NA	NA	NA	NA	NA
AWZ79297.1|1036735_1037479_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82675.1|1037834_1038473_+	outer membrane protein W	NA	NA	NA	NA	NA
AWZ78912.1|1038518_1039649_-|integrase	bacteriophage lambda integrase, N-terminal domain protein	integrase	O21940	Phage_21	51.4	3.4e-103
AWZ81554.1|1039939_1042411_-	putative exonuclease VIII	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
AWZ80534.1|1042503_1042695_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ79517.1|1042908_1043079_+	putative ybl82 protein	NA	NA	NA	NA	NA
AWZ80358.1|1043445_1043664_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82044.1|1043693_1043864_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ81229.1|1043823_1043979_-	hypothetical protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AWZ82791.1|1044251_1044968_-	helix-turn-helix family protein	NA	H9C160	Pectobacterium_phage	42.4	7.7e-53
AWZ83117.1|1045017_1045233_+	regulatory protein cro	NA	NA	NA	NA	NA
AWZ80712.1|1045229_1045655_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ79111.1|1045752_1046640_+	helix-turn-helix domain protein	NA	S5FM81	Shigella_phage	55.7	7.3e-61
AWZ81246.1|1046646_1047393_+	bacterial dnaA family protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
AWZ79695.1|1047414_1048185_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
AWZ82168.1|1048200_1048626_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
AWZ79341.1|1048899_1049466_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78632.1|1049900_1050080_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ80983.1|1050300_1051356_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
AWZ80654.1|1051356_1051737_+	endodeoxyribonuclease RusA family protein	NA	V5URS4	Shigella_phage	64.5	2.9e-35
AWZ82927.1|1051733_1052555_+	antitermination family protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
AWZ78748.1|1052781_1052979_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
AWZ80703.1|1053130_1054180_+	DNA methylase family protein	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
AWZ80359.1|1054981_1055113_+	hypothetical protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
AWZ80581.1|1055989_1057843_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
AWZ80203.1|1057993_1058209_+|lysis	lysis S family protein	lysis	G9L6J5	Escherichia_phage	100.0	9.0e-34
AWZ78412.1|1058213_1058558_+	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
AWZ83110.1|1058523_1058796_-	putative ybl58	NA	NA	NA	NA	NA
AWZ82616.1|1058897_1059200_+|transposase	transposase family protein	transposase	Q716C1	Shigella_phage	98.0	1.2e-44
AWZ80313.1|1059226_1060045_+|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	95.9	2.6e-158
AWZ80167.1|1060154_1060688_+	phage lysozyme family protein	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
AWZ80503.1|1061114_1061231_+	putative membrane protein	NA	NA	NA	NA	NA
AWZ78496.1|1061330_1061825_+|lysis	bacteriophage lysis family protein	lysis	Q9ZXB6	Enterobacteria_phage	87.7	1.7e-72
AWZ81193.1|1062235_1062436_-	hypothetical protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
AWZ80609.1|1063133_1063697_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
AWZ78875.1|1063693_1065355_+	phage Terminase family protein	NA	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
AWZ79204.1|1065418_1067356_+|capsid	phage major capsid protein, HK97 family	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
AWZ79514.1|1067400_1067622_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AWZ81597.1|1067654_1070153_+|portal	phage portal protein, HK97 family	portal	A0A0P0ZDD0	Stx2-converting_phage	99.9	0.0e+00
AWZ80072.1|1070149_1070476_+|head,tail	phage gp6-like head-tail connector family protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
AWZ80621.1|1070632_1070836_+|head,tail	putative head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.8e-31
AWZ81942.1|1070832_1071279_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWZ79647.1|1071275_1071620_+	hypothetical protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWZ80791.1|1071686_1072403_+	immunoglobulin I-set domain protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
AWZ82237.1|1072417_1072792_+|tail	phage tail assembly chaperone family protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
AWZ81846.1|1072893_1073097_+	hypothetical protein	NA	H6WZM0	Escherichia_phage	100.0	1.4e-31
AWZ82822.1|1073144_1076387_+|tail	phage tail tape measure protein, lambda family	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
AWZ82190.1|1076379_1076721_+|tail	phage minor tail family protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
AWZ80089.1|1076720_1077419_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
AWZ78433.1|1077429_1078173_+	hypothetical protein	NA	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
AWZ78744.1|1078169_1078751_+|tail	bacteriophage lambda tail assembly I family protein	tail	H6WZM5	Escherichia_phage	97.4	1.3e-90
AWZ82891.1|1079093_1082567_+	fibronectin type III family protein	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
1081225:1081240	attL	CACCGGCAGCACCGTC	NA	NA	NA	NA
AWZ82400.1|1082634_1083093_+	enterobacterial Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	89.0	9.5e-65
AWZ81295.1|1083432_1084749_+|integrase	integrase core domain protein	integrase	K4I413	Acidithiobacillus_phage	47.6	2.6e-115
AWZ79254.1|1084760_1085510_+	istB-like ATP binding family protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AWZ80277.1|1085649_1085820_+	enterobacterial Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	89.3	5.1e-24
AWZ80317.1|1086468_1087218_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82288.1|1087257_1087554_-	putative membrane protein	NA	Q8W769	Escherichia_phage	79.2	5.8e-07
AWZ81755.1|1088011_1088797_+|tail	putative tail fiber protein	tail	Q858V4	Yersinia_virus	77.8	1.3e-109
AWZ82093.1|1088798_1089332_+|tail	caudovirales tail fiber assembly family protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
AWZ82334.1|1089362_1089890_-|tail	caudovirales tail fiber assembly family protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
AWZ81585.1|1089905_1090874_-|tail	putative phage tail fiber protein	tail	A0A0F7LDR4	Escherichia_phage	38.8	2.9e-47
AWZ79376.1|1091380_1091812_-	putative methyltransferase domain protein	NA	NA	NA	NA	NA
AWZ81553.1|1092105_1092375_+|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
AWZ81709.1|1092489_1092660_+|tail	putative tail component	tail	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
AWZ80935.1|1092786_1093344_-	phage regulatory, Rha family protein	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
AWZ82329.1|1093580_1093721_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78540.1|1093818_1093941_+	ompW family protein	NA	NA	NA	NA	NA
AWZ82160.1|1093991_1094798_-	tryptophan synthase, alpha subunit	NA	NA	NA	NA	NA
AWZ80719.1|1094797_1095991_-	tryptophan synthase, beta subunit	NA	NA	NA	NA	NA
AWZ78970.1|1096002_1097361_-	tryptophan biosynthesis protein TrpCF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
AWZ82302.1|1097364_1098960_-	anthranilate synthase component II	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AWZ79434.1|1098959_1100522_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AWZ81696.1|1100795_1101677_+	PHP domain protein	NA	NA	NA	NA	NA
AWZ81790.1|1101673_1102294_+|tRNA	tRNA threonylcarbamoyl adenosine modification protein, Sua5/YciO/YrdC/YwlC family	tRNA	NA	NA	NA	NA
AWZ80085.1|1102321_1104217_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ81430.1|1104429_1105305_+	pseudouridine synthase family protein	NA	NA	NA	NA	NA
AWZ79807.1|1105510_1106497_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ83162.1|1106623_1106815_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ79626.1|1106871_1107462_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AWZ82482.1|1107458_1108217_-	hypothetical protein	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
AWZ78743.1|1108436_1109486_+|protease	putative protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
1112472:1112487	attR	GACGGTGCTGCCGGTG	NA	NA	NA	NA
>prophage 5
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	1323689	1332516	4989783		Escherichia_phage(66.67%)	10	NA	NA
AWZ81766.1|1323689_1324904_-	mandelate racemase / muconate lactonizing enzyme, N-terminal domain protein	NA	Q6A202	Oenococcus_phage	29.2	8.2e-47
AWZ78394.1|1325109_1325436_-	hypothetical protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AWZ81691.1|1325570_1325912_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ79506.1|1325946_1326507_+	spermidine N(1)-acetyltransferase	NA	NA	NA	NA	NA
AWZ79177.1|1326509_1327133_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ81157.1|1327327_1327633_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ83032.1|1327831_1330258_+	anaerobic dimethyl sulfoxide reductase, A subunit, DmsA/YnfE family protein	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
AWZ82008.1|1330345_1331080_+	tat (twin-arginine translocation) pathway signal sequence domain protein	NA	A0A077SK27	Escherichia_phage	48.3	1.4e-46
AWZ82797.1|1331076_1331814_+	molybdopterin oxidoreductase family protein	NA	A0A077SK27	Escherichia_phage	41.1	4.6e-45
AWZ83011.1|1331898_1332516_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
>prophage 6
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	1601433	1690456	4989783	tRNA,capsid,plate,tail,integrase,portal,transposase,terminase,head	Escherichia_phage(20.0%)	102	1647130:1647189	1690518:1690642
AWZ79355.1|1601433_1602036_-|integrase	integrase core domain protein	integrase	A0A1B1P773	Bacillus_phage	56.8	8.4e-61
AWZ80386.1|1602260_1602782_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ82944.1|1602891_1603902_-	holliday junction DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AWZ82595.1|1603910_1604522_-	holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
AWZ80620.1|1604796_1605399_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ79640.1|1605400_1605922_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AWZ78525.1|1605956_1606697_-	DNA-binding regulatory, YebC/PmpR family protein	NA	NA	NA	NA	NA
AWZ78796.1|1606725_1607103_-	dihydroneopterin triphosphate pyrophosphatase	NA	NA	NA	NA	NA
AWZ81273.1|1607170_1608904_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AWZ82270.1|1609252_1609819_+	isochorismatase family protein	NA	NA	NA	NA	NA
AWZ83093.1|1609815_1610634_+	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
AWZ82118.1|1610836_1611082_+	inner membrane protein YecN	NA	NA	NA	NA	NA
AWZ81638.1|1611122_1611866_+|tRNA	tRNA (cmo5U34)-methyltransferase	tRNA	F5B419	Synechococcus_phage	30.0	4.6e-24
AWZ82399.1|1611862_1612834_+|tRNA	tRNA (mo5U34)-methyltransferase	tRNA	NA	NA	NA	NA
AWZ78741.1|1612869_1615299_-	trimethylamine-N-oxide reductase 2	NA	NA	NA	NA	NA
AWZ79847.1|1615323_1616424_-	cytochrome c-type protein TorY	NA	NA	NA	NA	NA
AWZ80364.1|1616811_1617558_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AWZ82117.1|1617571_1618138_-	protein YecM	NA	NA	NA	NA	NA
AWZ81966.1|1618353_1620087_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
AWZ79414.1|1620139_1620532_-	flagellar protein FlhE	NA	NA	NA	NA	NA
AWZ81516.1|1620531_1622610_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AWZ80535.1|1622602_1623751_-	flagellar biosynthetic protein FlhB	NA	NA	NA	NA	NA
AWZ82164.1|1623939_1624584_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
AWZ78405.1|1624594_1624984_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AWZ79365.1|1624998_1626048_-	cheB methylesterase family protein	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AWZ82265.1|1626050_1626911_-	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
AWZ82837.1|1626929_1627049_-	methyl-accepting chemotaxis protein IV	NA	NA	NA	NA	NA
AWZ79223.1|1627036_1627156_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78645.1|1627201_1628863_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AWZ80259.1|1629007_1629511_-	cheW-like domain protein	NA	NA	NA	NA	NA
AWZ83014.1|1629531_1631490_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AWZ81414.1|1631500_1632427_-	motility protein B	NA	NA	NA	NA	NA
AWZ81940.1|1632423_1633311_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AWZ82346.1|1633437_1634016_-	flagellar transcriptional activator family protein	NA	NA	NA	NA	NA
AWZ82481.1|1634018_1634369_-	flagellar transcriptional activator family protein	NA	NA	NA	NA	NA
AWZ79715.1|1635148_1635577_+	universal stress family protein	NA	NA	NA	NA	NA
AWZ79333.1|1635583_1637008_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
AWZ78841.1|1636982_1637783_-	trehalose-phosphatase	NA	NA	NA	NA	NA
AWZ79803.1|1637949_1638936_-	branched-chain amino acid transport system / permease component family protein	NA	NA	NA	NA	NA
AWZ82264.1|1638950_1640465_-	arabinose import ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
AWZ80059.1|1640534_1641524_-	periplasmic binding and sugar binding domain of LacI family protein	NA	NA	NA	NA	NA
AWZ82134.1|1642357_1642822_+	ferritin-like domain protein	NA	NA	NA	NA	NA
AWZ79821.1|1642899_1643151_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ80189.1|1643445_1643559_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ83173.1|1643684_1643939_+	yecR-like lipofamily protein	NA	NA	NA	NA	NA
AWZ79968.1|1643948_1644062_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ81677.1|1644110_1644608_+	ferritin-1	NA	NA	NA	NA	NA
AWZ82916.1|1644645_1644885_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ80348.1|1645023_1645137_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ81782.1|1645135_1646287_+	tyrosine-specific transport protein	NA	NA	NA	NA	NA
AWZ78445.1|1646337_1647003_-	yecA family protein	NA	NA	NA	NA	NA
1647130:1647189	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
AWZ79858.1|1647474_1647894_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
AWZ78587.1|1648331_1649105_-	phage late control D family protein	NA	R9TNM7	Vibrio_phage	30.7	9.2e-28
AWZ83025.1|1649919_1651560_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
AWZ82020.1|1651668_1651950_-	mu-like prophage FluMu gp41 family protein	NA	NA	NA	NA	NA
AWZ79746.1|1651962_1652388_-|tail	phage tail tube FII family protein	tail	NA	NA	NA	NA
AWZ80593.1|1652492_1653995_-|tail	phage tail sheath family protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
AWZ79947.1|1654380_1655565_-|tail	phage tail-collar fiber family protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
AWZ78979.1|1655557_1656184_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
AWZ80648.1|1656186_1657062_-|plate	baseplate J-like family protein	plate	D5LGZ3	Escherichia_phage	48.1	1.3e-67
AWZ79427.1|1657103_1657436_-	lysozyme family protein	NA	Q8H9N4	Vibrio_phage	51.1	1.2e-19
AWZ78482.1|1657447_1658350_-|plate	phage baseplate assembly V family protein	plate	NA	NA	NA	NA
AWZ79864.1|1658330_1658867_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82855.1|1658863_1659544_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78886.1|1659575_1659917_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82836.1|1659952_1660372_-	DNA packaging FI family protein	NA	NA	NA	NA	NA
AWZ81584.1|1660406_1661441_-|capsid	phage major capsid E family protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
AWZ78578.1|1661499_1661829_-|head	bacteriophage lambda head decoration D family protein	head	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
AWZ79088.1|1661828_1663136_-	peptidase S49 family protein	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
AWZ79999.1|1663135_1664710_-|portal	phage portal protein, lambda family	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
AWZ81510.1|1664939_1666706_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	51.8	2.6e-174
AWZ78882.1|1666788_1667094_-	putative phage DNA packaging protein	NA	A0A1I9KFT4	Aeromonas_phage	46.9	9.6e-13
AWZ80029.1|1667723_1667969_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ82203.1|1668230_1668656_-	hypothetical protein	NA	A0A222YWL8	Escherichia_phage	69.5	1.4e-54
AWZ79343.1|1668981_1669365_-	putative membrane protein	NA	NA	NA	NA	NA
AWZ80106.1|1669477_1670149_-	phage antitermination Q family protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
AWZ79900.1|1670148_1670442_-	hypothetical protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
AWZ80438.1|1670438_1671035_-	hypothetical protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
AWZ79516.1|1671112_1671292_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ81028.1|1671443_1672085_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82469.1|1672328_1672562_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ79374.1|1672993_1673449_+	hypothetical protein	NA	A0A142KB62	Gordonia_phage	44.0	3.9e-26
AWZ81470.1|1673788_1673974_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ81106.1|1674218_1674722_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	94.0	1.6e-89
AWZ82731.1|1675302_1675542_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	86.1	1.6e-34
AWZ79800.1|1677294_1678113_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ82617.1|1678287_1679076_-	hypothetical protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
AWZ79091.1|1679348_1679570_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82580.1|1679757_1679982_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ81954.1|1679978_1680290_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
AWZ83105.1|1680286_1680523_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ81786.1|1680524_1680728_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ81747.1|1680973_1682389_-	dnaB-like helicase N terminal domain protein	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
AWZ80964.1|1682378_1683134_-	phage O protein family	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
AWZ81647.1|1683130_1683355_-	putative adenylosuccinate synthase	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
AWZ79271.1|1683394_1683871_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
AWZ78827.1|1684462_1684672_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ81634.1|1685682_1686003_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ81908.1|1686033_1688250_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
AWZ78659.1|1688246_1688816_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
AWZ83170.1|1688815_1688998_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78695.1|1689439_1690456_+|integrase	phage integrase family protein	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
1690518:1690642	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 7
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	1740008	1786694	4989783	tRNA,capsid,tail,protease,integrase,portal,terminase,head,lysis	Escherichia_phage(40.0%)	59	1765778:1765792	1787383:1787397
AWZ82159.1|1740008_1740611_-|integrase	integrase core domain protein	integrase	A0A1B1P773	Bacillus_phage	56.8	1.7e-61
AWZ78472.1|1740835_1741357_-	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWZ79614.1|1741617_1742268_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AWZ80759.1|1743348_1743636_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ81767.1|1743645_1743909_-	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	46.5	4.1e-20
AWZ81756.1|1743920_1745348_-|tail	putative prophage tail fiber	tail	A0A1X7QGG5	Escherichia_phage	62.7	2.5e-148
AWZ80797.1|1745370_1745640_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ81409.1|1746135_1746735_-	enterobacterial Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.0	7.5e-102
AWZ80430.1|1746802_1750501_-|tail	phage tail family protein	tail	A5LH43	Enterobacteria_phage	74.7	0.0e+00
AWZ81877.1|1750561_1751080_-|tail	bacteriophage lambda tail assembly I family protein	tail	A5LH42	Enterobacteria_phage	97.1	1.5e-87
AWZ81205.1|1751106_1751742_-	nlpC/P60 family protein	NA	A5LH41	Enterobacteria_phage	99.1	1.5e-129
AWZ78577.1|1751854_1752553_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	8.1e-132
AWZ78522.1|1752552_1752852_-|tail	phage minor tail family protein	tail	A0A0P0ZDL9	Stx2-converting_phage	69.7	5.5e-37
AWZ81498.1|1752886_1756114_-|tail	phage tail tape measure protein, lambda family	tail	A0A1B5FPE2	Escherichia_phage	95.6	0.0e+00
AWZ78944.1|1756160_1756439_-	hypothetical protein	NA	A0A1B5FP87	Escherichia_phage	96.7	4.0e-42
AWZ78687.1|1756462_1756834_-|tail	phage tail assembly chaperone family protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
AWZ81556.1|1756848_1757553_-	immunoglobulin domain protein	NA	A0A1B5FP82	Escherichia_phage	93.6	1.7e-113
AWZ81843.1|1757612_1757894_-	hypothetical protein	NA	A0A1B5FP84	Escherichia_phage	96.8	1.6e-43
AWZ78489.1|1757953_1758400_-	hypothetical protein	NA	S4TR46	Salmonella_phage	81.1	2.3e-63
AWZ79912.1|1758399_1758534_-|head,tail	putative head-tail adaptor	head,tail	A0A1B5FP90	Escherichia_phage	86.4	8.4e-14
AWZ79421.1|1758746_1759064_-|head,tail	phage gp6-like head-tail connector family protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	1.8e-22
AWZ81936.1|1759140_1760358_-|capsid	phage major capsid protein, HK97 family	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
AWZ81481.1|1760372_1760972_-|head,protease	phage prohead protease, HK97 family	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
AWZ83193.1|1760964_1762191_-|portal	phage portal protein, HK97 family	portal	Q8SBI0	Shigella_phage	83.1	1.1e-203
AWZ81858.1|1762180_1762342_-	putative membrane protein	NA	NA	NA	NA	NA
AWZ83119.1|1762338_1764096_-	phage Terminase family protein	NA	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
AWZ81982.1|1764095_1764416_-|terminase	phage terminase, small subunit, P27 family	terminase	A0A1B5FPA0	Escherichia_phage	99.1	1.3e-52
AWZ82452.1|1765214_1765754_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ83131.1|1765759_1765981_-	hypothetical protein	NA	NA	NA	NA	NA
1765778:1765792	attL	CGCCTTATTATGCTC	NA	NA	NA	NA
AWZ78739.1|1766181_1766649_-|lysis	bacteriophage lysis family protein	lysis	A5LH84	Enterobacteria_phage	90.3	2.1e-67
AWZ78795.1|1766645_1767179_-	phage lysozyme family protein	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
AWZ78928.1|1767242_1767593_-	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
AWZ82235.1|1767597_1767804_-|lysis	lysis S family protein	lysis	M1FN85	Enterobacteria_phage	98.5	2.1e-32
AWZ79493.1|1768608_1769298_-	phage antitermination Q family protein	NA	I6PDF8	Cronobacter_phage	51.1	9.6e-61
AWZ82912.1|1769294_1769660_-	endodeoxyribonuclease RusA family protein	NA	V5URS4	Shigella_phage	67.5	3.2e-39
AWZ78985.1|1769660_1770614_-	hypothetical protein	NA	U5P0K4	Shigella_phage	48.2	4.4e-80
AWZ80997.1|1772274_1772508_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
AWZ78930.1|1772615_1772783_-	putative phage protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
AWZ81076.1|1772793_1773057_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
AWZ81343.1|1773058_1773442_-|tRNA	putative valyl-tRNA synthetase domain protein	tRNA	A5LH60	Enterobacteria_phage	39.5	6.2e-09
AWZ81985.1|1773500_1773860_-	putative prophage protein	NA	A0A076GCN9	Escherichia_phage	74.5	1.6e-38
AWZ81027.1|1773856_1774033_-	putative yheA protein	NA	A0A2R2X2A8	Escherichia_phage	91.4	2.8e-25
AWZ79182.1|1774025_1774208_-	putative phage protein	NA	A0A2R2Z308	Escherichia_phage	98.3	6.9e-27
AWZ78792.1|1774301_1774658_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
AWZ80674.1|1774659_1775142_-	hypothetical protein	NA	A0A222YWN7	Escherichia_phage	76.2	1.7e-43
AWZ80666.1|1775188_1775458_-	hypothetical protein	NA	A0A0U2SAZ1	Escherichia_phage	97.8	5.4e-44
AWZ79788.1|1775484_1775907_-	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	4.7e-66
AWZ79873.1|1775947_1776409_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	70.6	6.7e-58
AWZ80796.1|1777089_1777515_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ79394.1|1778348_1778483_+	peptidase S24-like family protein	NA	NA	NA	NA	NA
AWZ79282.1|1778760_1778916_+	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
AWZ80696.1|1778875_1779046_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ83049.1|1779075_1779294_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ81845.1|1779723_1780269_-	putative ybl82 protein	NA	NA	NA	NA	NA
AWZ79501.1|1780332_1782774_+	enterobacterial exodeoxyribonuclease VIII family protein	NA	V5UQJ3	Shigella_phage	46.8	9.2e-114
AWZ82774.1|1782832_1783036_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ80011.1|1783215_1784061_+|integrase	phage integrase family protein	integrase	A0A192Y7M7	Salmonella_phage	64.2	2.5e-95
AWZ82376.1|1784410_1785094_+	protein MtfA	NA	NA	NA	NA	NA
AWZ82940.1|1785431_1786694_+|integrase	phage integrase family protein	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
1787383:1787397	attR	CGCCTTATTATGCTC	NA	NA	NA	NA
>prophage 8
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	1843800	1882224	4989783	transposase,integrase	Stx2-converting_phage(28.57%)	40	1837518:1837534	1882518:1882534
1837518:1837534	attL	TGCAAAAGGGCTGACCT	NA	NA	NA	NA
AWZ79054.1|1843800_1843917_+|transposase	putative transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	71.4	1.2e-08
AWZ80435.1|1844112_1845327_+	pfkB carbohydrate kinase family protein	NA	NA	NA	NA	NA
AWZ83000.1|1845340_1846099_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ81450.1|1846185_1847118_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78582.1|1847120_1848155_+	putative phosphotriesterase	NA	NA	NA	NA	NA
AWZ80963.1|1848194_1848350_-	gamma-glutamyltranspeptidase domain protein	NA	NA	NA	NA	NA
AWZ80794.1|1848369_1848966_-|transposase	transposase IS66 family protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	66.8	1.3e-69
AWZ82687.1|1848932_1849982_-|transposase	transposase IS66 family protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.9	1.4e-98
AWZ78480.1|1850012_1850309_-|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	63.3	2.2e-30
AWZ81959.1|1850359_1850722_-|transposase	transposase family protein	transposase	Q6H9S5	Enterobacteria_phage	100.0	5.6e-36
AWZ78910.1|1850927_1851047_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ80889.1|1851345_1852203_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ82798.1|1853008_1853398_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ80528.1|1853973_1854543_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ79442.1|1854799_1854943_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ79582.1|1856122_1857319_+|transposase	transposase IS116/IS110/IS902 family protein	transposase	NA	NA	NA	NA
AWZ83189.1|1857514_1857721_+	prophage CP4-57 regulatory family protein	NA	NA	NA	NA	NA
AWZ78411.1|1857814_1858417_+	putative aec62	NA	NA	NA	NA	NA
AWZ78828.1|1859442_1860018_-	istB-like ATP binding family protein	NA	A0A2L1IVB6	Escherichia_phage	86.8	3.7e-98
AWZ79206.1|1860134_1861106_-|integrase	integrase core domain protein	integrase	A0A2L1IVA1	Escherichia_phage	99.1	4.1e-190
AWZ80755.1|1862681_1863827_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ82747.1|1864668_1865436_-	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
AWZ78874.1|1865432_1866491_-	fecCD transport family protein	NA	NA	NA	NA	NA
AWZ80802.1|1866509_1867499_-	periplasmic binding family protein	NA	NA	NA	NA	NA
AWZ80655.1|1867509_1869582_-	tonB-dependent siderophore receptor family protein	NA	NA	NA	NA	NA
AWZ80985.1|1870103_1870538_+	putative yeeP protein	NA	NA	NA	NA	NA
AWZ79137.1|1870755_1873140_+	50S ribosome-binding GTPase family protein	NA	NA	NA	NA	NA
AWZ80252.1|1873136_1874042_+	yjcZ-like family protein	NA	NA	NA	NA	NA
AWZ82285.1|1874038_1875109_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
AWZ82043.1|1875244_1875658_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ82947.1|1875997_1877314_+|integrase	integrase core domain protein	integrase	K4I413	Acidithiobacillus_phage	47.6	2.6e-115
AWZ80177.1|1877325_1878075_+	bacterial dnaA family protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AWZ78709.1|1878238_1878508_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ79081.1|1878523_1878934_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ83020.1|1879154_1879973_+	hypothetical protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
AWZ81209.1|1879972_1880218_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ79497.1|1880311_1880785_+	intergenic-region protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
AWZ79092.1|1880800_1881277_+	DNA repair RadC family protein	NA	NA	NA	NA	NA
AWZ81948.1|1881339_1881561_+	hypothetical protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AWZ81047.1|1881579_1882224_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
1882518:1882534	attR	TGCAAAAGGGCTGACCT	NA	NA	NA	NA
>prophage 9
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	1913550	1919935	4989783	transposase	Enterobacteria_phage(50.0%)	6	NA	NA
AWZ83042.1|1913550_1914054_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	94.0	1.6e-89
AWZ81575.1|1914179_1915058_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
AWZ81681.1|1915115_1916015_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
AWZ79344.1|1916014_1917100_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
AWZ82533.1|1917472_1918366_-	regulatory protein GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
AWZ81083.1|1918540_1919935_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 10
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	2014111	2023556	4989783		Enterobacteria_phage(85.71%)	9	NA	NA
AWZ78818.1|2014111_2015248_+	VWA domain containing CoxE-like family protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
AWZ81235.1|2015244_2017248_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AWZ80854.1|2017372_2017834_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AWZ82342.1|2017874_2018345_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AWZ81882.1|2018391_2019111_-	response regulator	NA	NA	NA	NA	NA
AWZ81010.1|2019107_2020793_-	putative sensor-like histidine kinase YehU	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWZ82723.1|2021014_2021746_+	merR regulatory family protein	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
AWZ81127.1|2021893_2022616_-	putative osmoprotectant uptake system permease protein YehW	NA	NA	NA	NA	NA
AWZ81276.1|2022629_2023556_-	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 11
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	2141855	2152037	4989783		Pseudomonas_phage(33.33%)	7	NA	NA
AWZ80105.1|2141855_2145566_-	outer membrane autotransporter barrel domain protein	NA	A0A2L1IV18	Escherichia_phage	26.6	7.3e-22
AWZ83041.1|2146037_2146250_-	hypothetical protein	NA	Q1MVF2	Enterobacteria_phage	80.0	2.1e-11
AWZ81839.1|2146295_2148581_+	ribonucleoside-diphosphate reductase, alpha subunit	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
AWZ80206.1|2148669_2149800_+	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
AWZ81703.1|2149799_2150054_+	2Fe-2S iron-sulfur cluster binding domain protein	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
AWZ78481.1|2150107_2150758_-	lipopolysaccharide kinase family protein	NA	NA	NA	NA	NA
AWZ82816.1|2150960_2152037_-	glycerophosphoryl diester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 12
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	2538033	2544856	4989783	capsid	Enterobacteria_phage(100.0%)	9	NA	NA
AWZ80211.1|2538033_2538606_-	polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	1.4e-94
AWZ79398.1|2538679_2539126_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
AWZ79558.1|2539176_2539911_-|capsid	putative glyco3, capsid size determination protein Sid	capsid	Q7M2A2	Enterobacteria_phage	98.0	6.7e-129
AWZ79294.1|2540509_2540728_+	prophage CP4-57 regulatory family protein	NA	Q7M299	Enterobacteria_phage	100.0	2.6e-36
AWZ81818.1|2540724_2541324_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.5e-49
AWZ80754.1|2541316_2541604_+	putative derepression protein	NA	Q7M2A0	Enterobacteria_phage	95.8	4.3e-47
AWZ80555.1|2541596_2542052_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
AWZ80480.1|2542187_2542508_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78826.1|2542522_2544856_+	putative P4-specific DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
>prophage 13
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	2614016	2621120	4989783		Escherichia_phage(83.33%)	6	NA	NA
AWZ81368.1|2614016_2616542_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	3.4e-31
AWZ82523.1|2616647_2617304_+	serine/threonine-protein phosphatase 2	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
AWZ83058.1|2617354_2618086_-	deoR C terminal sensor domain protein	NA	A0A077SK06	Escherichia_phage	56.9	8.1e-66
AWZ80389.1|2618317_2619226_+	NAD binding domain of 6-phosphogluconate dehydrogenase family protein	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
AWZ80725.1|2619222_2620485_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
AWZ80901.1|2620523_2621120_+	class II Aldolase and Adducin N-terminal domain protein	NA	A0A077SK32	Escherichia_phage	74.1	1.8e-79
>prophage 14
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	2821244	2829086	4989783	transposase,tRNA,integrase	Shigella_phage(33.33%)	10	2819762:2819777	2833559:2833574
2819762:2819777	attL	GCCAGCCCATCGCCAG	NA	NA	NA	NA
AWZ83158.1|2821244_2822447_+	putative purine permease YgfU	NA	Q9KX94	Enterobacteria_phage	27.6	1.8e-22
AWZ81440.1|2822415_2822718_+|transposase	transposase family protein	transposase	Q716C1	Shigella_phage	98.0	1.2e-44
AWZ81176.1|2822744_2823563_+|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	95.9	2.6e-158
AWZ79606.1|2823613_2823796_+	putative purine permease YgfU domain protein	NA	NA	NA	NA	NA
AWZ81795.1|2823797_2823923_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ83075.1|2824045_2824594_+	isopentenyl-diphosphate delta-isomerase	NA	NA	NA	NA	NA
AWZ82931.1|2824636_2826154_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
AWZ79453.1|2826163_2827045_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.5e-05
AWZ82847.1|2827045_2827201_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ80219.1|2827352_2829086_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	4.1e-60
2833559:2833574	attR	GCCAGCCCATCGCCAG	NA	NA	NA	NA
>prophage 15
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	2895955	2956498	4989783	tRNA,protease,integrase,transposase	Stx2-converting_phage(33.33%)	61	2933070:2933101	2952971:2953002
AWZ83116.1|2895955_2896675_-|tRNA	tRNA (guanine-N(7)-)-methyltransferase	tRNA	NA	NA	NA	NA
AWZ80135.1|2896835_2897888_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AWZ79041.1|2897915_2898191_+	putative Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
AWZ81720.1|2898255_2899335_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ81347.1|2899536_2900793_+	nucleoside transporter family protein	NA	NA	NA	NA	NA
AWZ82559.1|2900841_2902977_-	ornithine decarboxylase, constitutive	NA	NA	NA	NA	NA
AWZ81376.1|2903369_2904077_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ79443.1|2904455_2905721_+|integrase	phage integrase family protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
AWZ81035.1|2905976_2907020_+	anaphase-promoting complex, cyclosome, subunit 3 family protein	NA	NA	NA	NA	NA
AWZ82261.1|2907174_2907393_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ82131.1|2907743_2908247_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	98.8	2.4e-93
AWZ79246.1|2908272_2908494_+	P fimbrial regulatory protein KS71A	NA	NA	NA	NA	NA
AWZ78499.1|2909144_2909945_-|integrase	integrase core domain protein	integrase	A0A0N7C1X7	Escherichia_phage	97.0	2.3e-146
AWZ81814.1|2909944_2910220_-|transposase	putative transposase	transposase	Q6H9S4	Enterobacteria_phage	100.0	2.0e-46
AWZ79513.1|2910543_2910672_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82657.1|2911010_2911757_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ79164.1|2912308_2912569_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ81167.1|2912889_2913171_+	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
AWZ79934.1|2913210_2913639_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ80891.1|2914356_2915550_-	major Facilitator Superfamily protein	NA	NA	NA	NA	NA
AWZ82972.1|2915685_2917410_+	N(2)-citryl-N(6)-acetyl-N(6)-hydroxylysine synthase	NA	NA	NA	NA	NA
AWZ80308.1|2917410_2918358_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
AWZ82948.1|2918357_2920100_+	aerobactin synthase	NA	NA	NA	NA	NA
AWZ81561.1|2920096_2921374_+	L-lysine N6-monooxygenase	NA	NA	NA	NA	NA
AWZ82271.1|2921557_2923657_+	ferric aerobactin receptor	NA	NA	NA	NA	NA
AWZ82711.1|2924207_2924351_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82889.1|2924600_2928488_+|protease	serine protease sat autotransporter	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
AWZ80207.1|2928534_2928708_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ80667.1|2928759_2929128_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ81920.1|2929084_2930236_+	helix-turn-helix domain protein	NA	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AWZ82358.1|2930320_2931139_+|integrase	integrase core domain protein	integrase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
AWZ82744.1|2931447_2931606_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ81751.1|2932021_2932483_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ82673.1|2932519_2933059_+	HTH-like domain protein	NA	NA	NA	NA	NA
2933070:2933101	attL	GTAAGCGTAAACTGACCGCCGTATGTAGCCAT	NA	NA	NA	NA
AWZ82185.1|2933217_2933580_+|transposase	transposase family protein	transposase	Q6H9S5	Enterobacteria_phage	100.0	5.6e-36
AWZ81256.1|2933630_2933927_+|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	63.3	2.2e-30
AWZ82216.1|2933957_2935007_+|transposase	transposase IS66 family protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.2	6.3e-80
AWZ79996.1|2934973_2935570_+|transposase	transposase IS66 family protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	66.8	1.3e-69
AWZ82965.1|2935745_2936093_+|integrase	integrase core domain protein	integrase	A0A0C5AEA5	Paenibacillus_phage	42.7	2.4e-12
AWZ81728.1|2936102_2936270_-	L-lactate permease family protein	NA	NA	NA	NA	NA
AWZ79148.1|2936780_2937053_+|transposase	transposase IS116/IS110/IS902 family protein	transposase	NA	NA	NA	NA
AWZ79553.1|2937555_2937771_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ80257.1|2937774_2938134_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82214.1|2938424_2938667_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ80004.1|2939070_2939250_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ79346.1|2939528_2941619_-	outer membrane insertion C-terminal signal domain protein	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
AWZ79258.1|2942118_2943024_-|integrase	integrase core domain protein	integrase	Q9ZXG3	Shigella_phage	94.7	1.8e-168
AWZ78548.1|2942981_2943347_-|transposase	transposase family protein	transposase	Q76S41	Shigella_phage	99.2	9.6e-60
AWZ82706.1|2943498_2944485_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
AWZ79703.1|2944584_2945319_+	FCD domain protein	NA	NA	NA	NA	NA
AWZ82457.1|2945354_2946290_-	prolyl oligopeptidase family protein	NA	NA	NA	NA	NA
AWZ82316.1|2946339_2947449_-	mutarotase, YjhT family protein	NA	NA	NA	NA	NA
AWZ81492.1|2947461_2948172_-	putative N-acetylneuraminic acid outer membrane channel protein NanC	NA	NA	NA	NA	NA
AWZ79082.1|2948217_2949048_-	alpha/beta hydrolase fold family protein	NA	NA	NA	NA	NA
AWZ82371.1|2949051_2950524_-	sugar (and other) transporter family protein	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
AWZ82196.1|2950572_2951448_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
AWZ80657.1|2951481_2952399_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AWZ79361.1|2953122_2953485_+|transposase	transposase family protein	transposase	Q6H9S5	Enterobacteria_phage	80.3	3.3e-28
2952971:2953002	attR	GTAAGCGTAAACTGACCGCCGTATGTAGCCAT	NA	NA	NA	NA
AWZ82291.1|2953535_2953832_+|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	60.2	5.4e-29
AWZ82570.1|2953862_2954963_+|transposase	transposase IS66 family protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	65.9	3.2e-98
AWZ83132.1|2954959_2956498_+|transposase	transposase IS66 family protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
>prophage 16
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	4004572	4082204	4989783	tRNA,capsid,plate,tail,protease,integrase,portal,transposase,terminase,head,holin,lysis	Escherichia_phage(45.24%)	94	4034421:4034467	4066261:4066307
AWZ80685.1|4004572_4005010_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AWZ80399.1|4005054_4005996_+	putative thioesterase domain protein	NA	NA	NA	NA	NA
AWZ81881.1|4006059_4006968_-	alpha/beta hydrolase fold family protein	NA	NA	NA	NA	NA
AWZ82479.1|4007508_4007799_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWZ82491.1|4008832_4009051_+	ribbon-helix-helix, copG family protein	NA	NA	NA	NA	NA
AWZ79201.1|4009235_4009976_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ80420.1|4010000_4010816_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ80885.1|4010859_4011363_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	94.0	1.6e-89
AWZ79690.1|4011914_4012157_+	copG-family DNA-binding protein	NA	NA	NA	NA	NA
AWZ82281.1|4012116_4012245_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78853.1|4012338_4013268_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
AWZ81852.1|4013264_4013900_-	formate dehydrogenase, gamma subunit	NA	NA	NA	NA	NA
AWZ81085.1|4013896_4014799_-	formate dehydrogenase, beta subunit	NA	NA	NA	NA	NA
AWZ82525.1|4014811_4017226_-	formate dehydrogenase, alpha subunit	NA	NA	NA	NA	NA
AWZ82391.1|4017274_4017862_-	molybdopterin oxidoreductase Fe4S4 domain protein	NA	NA	NA	NA	NA
AWZ79972.1|4017865_4018120_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ81810.1|4018088_4018889_+	formate dehydrogenase family accessory protein FdhD	NA	NA	NA	NA	NA
AWZ81074.1|4018976_4019531_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78670.1|4019884_4021279_+	maltoporin periplasmic N-terminal extension family protein	NA	NA	NA	NA	NA
AWZ79069.1|4021319_4021634_-	L-rhamnose 1-epimerase	NA	NA	NA	NA	NA
AWZ82456.1|4021643_4022468_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
AWZ78715.1|4022734_4023994_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
AWZ80930.1|4023990_4025406_-	rhamnulokinase	NA	NA	NA	NA	NA
AWZ78953.1|4025538_4025688_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78427.1|4025747_4026584_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
AWZ79098.1|4026657_4027506_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
AWZ80867.1|4027502_4028537_-	L-rhamnose-proton symporter	NA	NA	NA	NA	NA
AWZ79449.1|4028821_4029442_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	5.4e-63
AWZ81947.1|4029470_4029599_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82272.1|4029701_4030685_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AWZ81333.1|4030833_4031508_+	protein YiiM	NA	NA	NA	NA	NA
AWZ78562.1|4031678_4033052_-	sensor protein CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
AWZ79163.1|4033048_4033681_-	transcriptional regulatory, C terminal family protein	NA	NA	NA	NA	NA
AWZ81721.1|4033896_4034397_+	periplasmic protein CpxP	NA	NA	NA	NA	NA
4034421:4034467	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
AWZ81674.1|4034582_4035563_-|integrase	phage integrase family protein	integrase	S4TP66	Salmonella_phage	98.2	1.7e-183
AWZ79992.1|4036061_4036334_+	regulatory phage cox family protein	NA	Q1JS20	Enterobacteria_phage	100.0	5.3e-47
AWZ81889.1|4036336_4036507_+	putative orf78	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
AWZ80440.1|4036503_4037004_+	putative replication gene B protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AWZ78643.1|4037067_4037292_+	hypothetical protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AWZ79913.1|4037291_4037594_+	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	98.0	3.8e-46
AWZ79958.1|4037593_4037818_+	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AWZ81955.1|4037814_4038090_+	phage/conjugal plasmid C-4 type zinc finger protein, TraR family	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
AWZ78761.1|4038079_4040347_+	bacteriophage replication protein A	NA	A0A0F7LBQ2	Escherichia_phage	97.4	0.0e+00
AWZ82979.1|4040430_4041753_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ80063.1|4041882_4042044_+	hypothetical protein	NA	M1TAP7	Escherichia_phage	90.6	7.5e-17
AWZ81239.1|4042082_4043117_-|portal	phage portal protein, PBSX family	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
AWZ81307.1|4043116_4044889_-|terminase	ATPase subunit of terminase family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
AWZ79231.1|4045062_4045917_+|capsid	phage capsid scaffolding (GPO) serine peptidase family protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
AWZ83046.1|4045975_4047049_+|capsid	phage major capsid protein, P2 family	capsid	Q778Z0	Enterobacteria_phage	99.7	1.9e-201
AWZ80379.1|4047097_4047796_+|terminase	phage small terminase subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.3	3.3e-117
AWZ82290.1|4047895_4048405_+|head	phage head completion family protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AWZ80736.1|4048404_4048608_+	phage Tail Protein X family protein	NA	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AWZ82938.1|4048611_4048893_+|holin	phage holin 2 family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
AWZ79683.1|4048892_4049390_+	phage lysozyme family protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
AWZ78768.1|4049404_4049830_+	putative protein lysA	NA	A0A0F7LBP4	Escherichia_phage	92.9	7.5e-56
AWZ79701.1|4049817_4050243_+|lysis	phage lysis regulatory, LysB family protein	lysis	U5N3W5	Enterobacteria_phage	94.3	4.0e-65
AWZ79118.1|4050229_4050388_+	putative protein lysB	NA	A0A0F7LCN5	Escherichia_phage	100.0	2.6e-22
AWZ82542.1|4050350_4050818_+|tail	P2 phage tail completion R family protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
AWZ82514.1|4050810_4051263_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
AWZ80238.1|4051329_4051965_+|plate	baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.7e-112
AWZ78431.1|4051961_4052309_+	lysozyme family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
AWZ81255.1|4052313_4053222_+|plate	baseplate J-like family protein	plate	U5N3T9	Enterobacteria_phage	99.3	4.4e-162
AWZ81485.1|4053214_4053745_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
AWZ81403.1|4053755_4056374_+|tail	phage tail-collar fiber family protein	tail	Q858V4	Yersinia_virus	73.0	3.4e-284
AWZ80933.1|4056385_4056952_+|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	64.7	1.1e-65
AWZ81340.1|4057115_4057229_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ81323.1|4057280_4058360_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ82217.1|4058548_4058716_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ80822.1|4058794_4059985_+|tail	major tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
AWZ80196.1|4059997_4060516_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AWZ81319.1|4060572_4060848_+	mu-like prophage FluMu gp41 family protein	NA	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AWZ82626.1|4060992_4063440_+|tail	phage tail tape measure protein, TP901 family, core region	tail	M1T2S3	Escherichia_phage	99.3	0.0e+00
AWZ80137.1|4063454_4063934_+	phage P2 GpU family protein	NA	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
AWZ81668.1|4063933_4065097_+	phage late control D family protein	NA	Q858U5	Yersinia_virus	99.5	1.4e-205
AWZ79073.1|4065177_4065396_+	ogr/Delta-like zinc finger family protein	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
AWZ79610.1|4065692_4066178_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ80159.1|4066385_4067288_+	cation diffusion facilitator transporter family protein	NA	NA	NA	NA	NA
4066261:4066307	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
AWZ83135.1|4067468_4068431_+	6-phosphofructokinase	NA	NA	NA	NA	NA
AWZ80213.1|4068750_4069740_+	sulfate-binding protein	NA	NA	NA	NA	NA
AWZ79155.1|4069846_4070602_+	CDP-diacylglycerol pyrophosphatase	NA	NA	NA	NA	NA
AWZ81685.1|4070656_4071406_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
AWZ80395.1|4071531_4072131_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ79643.1|4072231_4072672_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ82689.1|4072883_4073183_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ80487.1|4073209_4073638_+	universal stress family protein	NA	NA	NA	NA	NA
AWZ83142.1|4073642_4074389_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
AWZ80897.1|4074485_4075496_-	fructose-1,6-bisphosphatase, class II	NA	NA	NA	NA	NA
AWZ82013.1|4075666_4077175_-	glycerol kinase	NA	NA	NA	NA	NA
AWZ78694.1|4077197_4078043_-	MIP channel family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
AWZ79745.1|4078473_4078713_+	cell division protein ZapB	NA	NA	NA	NA	NA
AWZ80400.1|4078797_4079283_-	regulator of ribonuclease activity A	NA	NA	NA	NA	NA
AWZ80005.1|4079375_4080302_-	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
AWZ82497.1|4080368_4081700_-|protease	ATP-dependent protease HslVU, ATPase subunit	protease	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
AWZ80210.1|4081709_4082204_-|protease	ATP-dependent protease HslVU, peptidase subunit	protease	NA	NA	NA	NA
>prophage 17
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	4502957	4560673	4989783	tRNA,holin,integrase,transposase	Stx2-converting_phage(25.0%)	62	4538783:4538797	4553552:4553566
AWZ80783.1|4502957_4505813_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
AWZ81056.1|4505812_4506256_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AWZ80254.1|4506611_4508123_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AWZ82181.1|4508347_4508476_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82853.1|4508482_4509490_+	lipopolysaccharide export system permease protein LptF	NA	NA	NA	NA	NA
AWZ78955.1|4509489_4510572_+	lipopolysaccharide export system permease protein LptG	NA	NA	NA	NA	NA
AWZ78534.1|4510732_4512235_-	hypothetical protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	4.6e-84
AWZ80758.1|4512364_4513384_-	alcohol dehydrogenase GroES-like domain protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
AWZ81718.1|4513850_4514441_+	hypothetical protein	NA	B7SYF8	Stenotrophomonas_phage	43.9	3.7e-29
AWZ78894.1|4515608_4515884_+|transposase	putative transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	4.7e-35
AWZ78814.1|4515997_4516213_-|transposase	putative transposase for transposon Tn5 domain protein	transposase	NA	NA	NA	NA
AWZ80608.1|4516677_4517442_-	bacterial transcriptional regulator family protein	NA	NA	NA	NA	NA
AWZ83033.1|4517768_4518581_+	putative 2-keto-3-deoxy-galactonate aldolase YagE	NA	NA	NA	NA	NA
AWZ80820.1|4518597_4520115_+	D-galactarate dehydratase / Altronate hydrolase, C terminus family protein	NA	NA	NA	NA	NA
AWZ78424.1|4520192_4521206_+	pyridoxal phosphate biosynthetic PdxA family protein	NA	NA	NA	NA	NA
AWZ82169.1|4521466_4522711_+	major Facilitator Superfamily protein	NA	NA	NA	NA	NA
AWZ82387.1|4522798_4522975_+|transposase	transposase family protein	transposase	Q716C1	Shigella_phage	85.7	1.1e-18
AWZ82415.1|4523315_4524203_+	PTS system sugar-specific permease component family protein	NA	NA	NA	NA	NA
AWZ81259.1|4524402_4524639_-|transposase	transposase family protein	transposase	Q6H9S5	Enterobacteria_phage	66.7	9.0e-19
AWZ78772.1|4525039_4525402_+|transposase	transposase family protein	transposase	Q6H9S5	Enterobacteria_phage	100.0	5.6e-36
AWZ78691.1|4525452_4525749_+|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	63.3	2.2e-30
AWZ79435.1|4525779_4526361_+|transposase	transposase C of IS166 homeodomain protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.9	3.0e-31
AWZ80510.1|4526396_4527392_+|transposase	transposase IS66 family protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	63.7	1.9e-126
AWZ82585.1|4527662_4528676_-	putative monosaccharide-transporting ATPase	NA	NA	NA	NA	NA
AWZ82827.1|4528687_4530004_-	H+ symporter permease	NA	NA	NA	NA	NA
AWZ78649.1|4530031_4530952_-	ribokinase	NA	NA	NA	NA	NA
AWZ80087.1|4531290_4532040_+	deoR C terminal sensor domain protein	NA	NA	NA	NA	NA
AWZ82257.1|4532140_4532257_-	acetolactate synthase isozyme 1 small subunit	NA	NA	NA	NA	NA
AWZ81569.1|4533244_4533373_+	acrylyl-CoA reductase AcuI domain protein	NA	NA	NA	NA	NA
AWZ80401.1|4533553_4534210_-	bacterial regulatory, tetR family protein	NA	NA	NA	NA	NA
AWZ80917.1|4534275_4534401_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ79581.1|4534457_4535735_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ79622.1|4535797_4537801_-|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
AWZ80695.1|4537949_4538768_-|integrase	integrase core domain protein	integrase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
4538783:4538797	attL	ATTGTTGTCGCCATT	NA	NA	NA	NA
AWZ82355.1|4538803_4539106_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ78723.1|4539121_4539718_+|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	96.8	8.8e-87
AWZ80287.1|4539714_4539957_+|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	92.4	4.7e-39
AWZ79600.1|4540039_4540297_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ79634.1|4540853_4541621_-	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AWZ82042.1|4541621_4542578_-	fe(3+) dicitrate transport system permease protein FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AWZ82753.1|4542574_4543573_-	fecCD transport family protein	NA	NA	NA	NA	NA
AWZ82720.1|4543569_4544472_-	periplasmic binding family protein	NA	NA	NA	NA	NA
AWZ83002.1|4544516_4546841_-	fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
AWZ78834.1|4546927_4547881_-	fecR family protein	NA	NA	NA	NA	NA
AWZ82014.1|4547877_4548399_-	putative RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AWZ81760.1|4548738_4548966_+	insA C-terminal domain protein	NA	Q71TE9	Escherichia_phage	94.7	2.1e-36
AWZ82951.1|4548992_4549178_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	85.2	7.3e-24
AWZ79211.1|4549178_4549388_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	97.1	4.1e-31
AWZ82868.1|4549960_4551319_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
AWZ81963.1|4551557_4552943_-|transposase	transposase IS66 family protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
AWZ78647.1|4552992_4553340_-|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AWZ81837.1|4554071_4554485_-	hypothetical protein	NA	NA	NA	NA	NA
4553552:4553566	attR	ATTGTTGTCGCCATT	NA	NA	NA	NA
AWZ79268.1|4554493_4554895_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ81422.1|4555154_4555724_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82961.1|4555926_4556121_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ82633.1|4556453_4556594_-	hemolysin expression-modulating protein Hha	NA	NA	NA	NA	NA
AWZ82072.1|4557397_4557583_+	prophage CP4-57 regulatory family protein	NA	NA	NA	NA	NA
AWZ80713.1|4557678_4558281_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ80661.1|4558452_4558650_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78880.1|4558796_4558925_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ81413.1|4559685_4560159_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ79532.1|4560169_4560673_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	94.0	1.6e-89
>prophage 18
CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	4577535	4612191	4989783	transposase,integrase	Shigella_phage(63.64%)	38	4595288:4595301	4618793:4618806
AWZ81131.1|4577535_4578354_-|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	95.9	2.6e-158
AWZ79112.1|4578380_4578683_-|transposase	transposase family protein	transposase	Q716C1	Shigella_phage	98.0	1.2e-44
AWZ82048.1|4578752_4579763_-	AAA domain family protein	NA	K4I1H4	Acidithiobacillus_phage	35.6	1.4e-36
AWZ80845.1|4579876_4580179_+|transposase	transposase family protein	transposase	Q716C1	Shigella_phage	98.0	1.2e-44
AWZ79770.1|4580205_4581024_+|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	95.9	2.6e-158
AWZ82701.1|4581766_4583026_+	5-methylthioribose kinase	NA	NA	NA	NA	NA
AWZ79853.1|4583035_4584151_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
AWZ78563.1|4584181_4584823_+	L-fuculose phosphate aldolase	NA	NA	NA	NA	NA
AWZ82598.1|4584962_4585931_+	ureide permease family protein	NA	NA	NA	NA	NA
AWZ81841.1|4585971_4586958_-	putative sugar-binding domain protein	NA	NA	NA	NA	NA
AWZ81116.1|4586995_4587118_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ81953.1|4587304_4588654_-	H+ symporter family protein	NA	NA	NA	NA	NA
AWZ80937.1|4588760_4590728_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ82509.1|4590738_4591644_-	putative 2-keto-3-deoxy-galactonate aldolase YagE	NA	NA	NA	NA	NA
AWZ80033.1|4591648_4592437_-	bacterial transcriptional regulator family protein	NA	NA	NA	NA	NA
AWZ79010.1|4592739_4593522_-	deoR-like helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWZ82296.1|4593538_4594171_-	ribulose-phosphate 3 epimerase family protein	NA	NA	NA	NA	NA
AWZ79936.1|4594182_4594614_-	phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 2 family protein	NA	NA	NA	NA	NA
AWZ81411.1|4594744_4595551_-	putative sgc region protein SgcQ	NA	NA	NA	NA	NA
4595288:4595301	attL	GCTCATTAATTGCC	NA	NA	NA	NA
AWZ78881.1|4595563_4596877_-	PTS system, galactitol-specific IIC component family protein	NA	NA	NA	NA	NA
AWZ81550.1|4596888_4597167_-	PTS system, Lactose/Cellobiose specific IIB subunit	NA	NA	NA	NA	NA
AWZ81194.1|4597163_4598285_-	M42 glutamyl aminopeptidase family protein	NA	NA	NA	NA	NA
AWZ81815.1|4598683_4598944_-	putative zinc ribbon domain protein	NA	NA	NA	NA	NA
AWZ82752.1|4599071_4599818_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ79074.1|4599869_4600421_-	acetyltransferase family protein	NA	NA	NA	NA	NA
AWZ79408.1|4600432_4600690_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ80564.1|4601079_4601232_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ80346.1|4601263_4602082_-|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	95.9	2.6e-158
AWZ82615.1|4602108_4602411_-|transposase	transposase family protein	transposase	Q716C1	Shigella_phage	98.0	1.2e-44
AWZ83118.1|4602563_4603580_+	phospholipase D family protein	NA	NA	NA	NA	NA
AWZ81777.1|4604162_4605080_-	hypothetical protein	NA	H6WZJ9	Escherichia_phage	56.8	2.3e-94
AWZ80055.1|4605206_4606313_-	mutarotase, YjhT family protein	NA	NA	NA	NA	NA
AWZ82397.1|4606332_4606530_-	oligogalacturonate-specific porin family protein	NA	NA	NA	NA	NA
AWZ81548.1|4606765_4607269_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	94.0	1.6e-89
AWZ80691.1|4608852_4610073_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ78395.1|4610091_4610610_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ79285.1|4610757_4611117_+|integrase	phage integrase family protein	integrase	A0A2L1IV36	Escherichia_phage	57.3	1.8e-34
AWZ82684.1|4611594_4612191_+|integrase	phage integrase family protein	integrase	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
4618793:4618806	attR	GCTCATTAATTGCC	NA	NA	NA	NA
>prophage 1
CP030335	Escherichia coli strain AR_451 plasmid unnamed1, complete sequence	75281	20508	64553	75281	integrase,transposase	Burkholderia_phage(15.0%)	51	13701:13714	67595:67608
13701:13714	attL	TCCAGCTGCTGCGC	NA	NA	NA	NA
AWZ78297.1|20508_20775_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	92.0	3.6e-40
AWZ78284.1|20879_22313_+	DNA (cytosine-5-)-methyltransferase family protein	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AWZ78352.1|22346_23555_-	type-2 restriction enzyme EcoRII	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AWZ78353.1|23567_23690_-	putative resolvease/recombinase	NA	NA	NA	NA	NA
AWZ78309.1|23839_24661_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AWZ78358.1|25112_25250_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78346.1|25215_25674_-	dihydrofolate reductase type 1	NA	G3MBI7	Bacillus_virus	28.8	5.3e-15
AWZ78360.1|25844_26858_+|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWZ78319.1|27250_27820_+	resolvase, N terminal domain protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
AWZ78326.1|27975_28203_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78354.1|28171_29503_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78329.1|29467_29734_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78364.1|29690_29966_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78307.1|31055_31397_+	putative ardK protein	NA	NA	NA	NA	NA
AWZ78288.1|31411_32203_-	sprT-like family protein	NA	NA	NA	NA	NA
AWZ78316.1|32353_33619_-	impB/mucB/samB family protein	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
AWZ78348.1|33606_34047_-	peptidase S24-like family protein	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
AWZ78311.1|34461_34887_+	antirestriction family protein	NA	NA	NA	NA	NA
AWZ78287.1|35013_35349_+	putative antirestriction protein	NA	NA	NA	NA	NA
AWZ78312.1|35670_35826_+	putative membrane protein	NA	NA	NA	NA	NA
AWZ78303.1|36483_36780_+	putative ccgD protein	NA	NA	NA	NA	NA
AWZ78338.1|36794_37136_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78366.1|37204_37489_+	putative membrane protein	NA	NA	NA	NA	NA
AWZ78296.1|37697_38030_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78328.1|39382_39892_+	antirestriction family protein	NA	NA	NA	NA	NA
AWZ78330.1|39936_40050_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78349.1|40617_40797_+	putative ccgAI protein	NA	NA	NA	NA	NA
AWZ78308.1|40851_41172_+	putative ccgAII	NA	NA	NA	NA	NA
AWZ78286.1|41282_41627_-	putative orfD	NA	Q6UAT7	Klebsiella_phage	41.5	1.3e-05
AWZ78345.1|41808_42177_-	putative stbC protein	NA	NA	NA	NA	NA
AWZ78365.1|42178_42895_-	putative stbB	NA	NA	NA	NA	NA
AWZ78292.1|42903_43116_-	putative stbA	NA	NA	NA	NA	NA
AWZ78313.1|43939_44230_+	putative conjugal transfer protein	NA	NA	NA	NA	NA
AWZ78359.1|44288_45761_+	trwB	NA	NA	NA	NA	NA
AWZ78298.1|45760_48997_+	mobilization protein TraI	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
AWZ78344.1|48996_49407_+	putative fipA	NA	NA	NA	NA	NA
AWZ78367.1|49370_50426_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78322.1|50798_51371_-	resolvase, N terminal domain protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
AWZ78285.1|51507_51732_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78339.1|52113_52371_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78305.1|52553_53147_+	resolvase, N terminal domain protein	NA	A0A0A7NPV4	Enterobacteria_phage	47.2	1.4e-31
AWZ78283.1|53465_54011_-	pentapeptide repeats family protein	NA	NA	NA	NA	NA
AWZ78325.1|54626_55331_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWZ78304.1|55307_55529_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AWZ78350.1|55618_55915_-	resolvase, N terminal domain protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	42.9	1.3e-06
AWZ78294.1|56318_59216_+|transposase	tn3 transposase DDE domain protein	transposase	A0A1B0V7H9	Salmonella_phage	37.8	2.5e-182
AWZ78343.1|59212_59464_-|transposase	putative transposase	transposase	Q1MVP5	Enterobacteria_phage	92.5	1.8e-33
AWZ78336.1|59914_61234_+|transposase	transposase DDE domain protein	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AWZ78332.1|61483_62365_-	carbapenem-hydrolyzing beta-lactamase Sme-1	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
AWZ78324.1|62751_63531_-	istB-like ATP binding family protein	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AWZ78290.1|63527_64553_-|integrase	integrase core domain protein	integrase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
67595:67608	attR	TCCAGCTGCTGCGC	NA	NA	NA	NA
>prophage 1
CP030336	Escherichia coli strain AR_451 plasmid unnamed4	16907	6198	14291	16907	integrase	Macacine_betaherpesvirus(14.29%)	11	4226:4239	10563:10576
4226:4239	attL	GCTGAAGTTTTTCC	NA	NA	NA	NA
AWZ78378.1|6198_6924_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	8.3e-55
AWZ78376.1|7103_7748_+	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	NA	NA	NA	NA
AWZ78380.1|7834_8143_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78370.1|8556_9537_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
AWZ78381.1|9947_10820_-	hypothetical protein	NA	F1C5A5	Cronobacter_phage	61.0	2.9e-94
10563:10576	attR	GCTGAAGTTTTTCC	NA	NA	NA	NA
AWZ78383.1|11057_11222_-	impB/mucB/samB family protein	NA	I6RSM4	Salmonella_phage	81.5	3.7e-19
AWZ78371.1|11221_11659_-	peptidase S24-like family protein	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
AWZ78377.1|11655_11904_-	dinI-like family protein	NA	Q2A098	Sodalis_phage	49.3	1.1e-14
AWZ78389.1|12321_13224_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78372.1|13375_13501_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78384.1|13643_14291_+	DNA methylase family protein	NA	A0A2I7RE86	Vibrio_phage	38.6	5.9e-28
