The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029065	Mycobacterium tuberculosis strain TBMENG-03 chromosome, complete genome	4359659	2917497	2955050	4359659	protease,capsid,integrase,tRNA,terminase,head	Mycobacterium_phage(30.0%)	46	2945579:2945606	2955203:2955230
AXA88070.1|2917497_2919576_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
AXA88071.1|2919684_2919912_+	hypothetical protein	NA	NA	NA	NA	NA
AXA88072.1|2921437_2921878_-	DoxX family membrane protein	NA	NA	NA	NA	NA
AXA89515.1|2922024_2922702_+	transcriptional regulator	NA	NA	NA	NA	NA
AXA88073.1|2922686_2923040_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AXA88074.1|2923052_2923478_-	hypothetical protein	NA	NA	NA	NA	NA
AXA88075.1|2923474_2924149_-	transcriptional regulator	NA	NA	NA	NA	NA
AXA88076.1|2924226_2925048_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXA88077.1|2925183_2926077_+	universal stress protein	NA	NA	NA	NA	NA
AXA89516.1|2926079_2926898_-	universal stress protein	NA	NA	NA	NA	NA
AXA88078.1|2926912_2928094_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AXA88079.1|2928152_2928584_-	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
AXA88080.1|2929097_2930339_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXA89517.1|2930648_2931011_+	hypothetical protein	NA	NA	NA	NA	NA
AXA89518.1|2931357_2932482_+	hypothetical protein	NA	NA	NA	NA	NA
AXA88081.1|2932483_2933023_+	archease	NA	NA	NA	NA	NA
AXA89519.1|2933161_2934460_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
AXA88082.1|2934498_2934780_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
AXA88083.1|2934924_2935410_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
AXA88084.1|2935436_2935694_-	hypothetical protein	NA	NA	NA	NA	NA
AXA88085.1|2935694_2938031_-	PE family protein	NA	NA	NA	NA	NA
AXA88086.1|2938059_2938302_+	hypothetical protein	NA	NA	NA	NA	NA
AXA88087.1|2938302_2938980_+	hypothetical protein	NA	NA	NA	NA	NA
AXA88088.1|2939175_2939832_+	DedA family protein	NA	NA	NA	NA	NA
AXA88089.1|2939994_2940441_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AXA88090.1|2940615_2940948_-	YnfA family protein	NA	NA	NA	NA	NA
AXA88091.1|2941067_2941427_-	transcriptional regulator	NA	NA	NA	NA	NA
AXA88092.1|2941528_2941987_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
AXA88093.1|2942122_2942503_+	transcriptional regulator	NA	NA	NA	NA	NA
AXA88094.1|2942499_2943996_+	arsenical-resistance protein	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
AXA89520.1|2944185_2944422_+	DUF3018 domain-containing protein	NA	NA	NA	NA	NA
AXA88095.1|2944494_2944668_+	hypothetical protein	NA	NA	NA	NA	NA
2945579:2945606	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
AXA88096.1|2945712_2946144_+	hypothetical protein	NA	NA	NA	NA	NA
AXA88097.1|2946140_2947139_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	1.6e-61
AXA88098.1|2947152_2947617_+	hypothetical protein	NA	NA	NA	NA	NA
AXA88099.1|2947604_2947856_+	hypothetical protein	NA	NA	NA	NA	NA
AXA88100.1|2948026_2949466_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
AXA89521.1|2949473_2950007_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
AXA88101.1|2950159_2950786_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
AXA89522.1|2950817_2951141_-	toxin	NA	NA	NA	NA	NA
AXA88102.1|2951220_2951466_-	antitoxin	NA	NA	NA	NA	NA
AXA88103.1|2951462_2952890_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
AXA88104.1|2952891_2953284_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
AXA88105.1|2953280_2953541_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
AXA89523.1|2953557_2953920_-	hypothetical protein	NA	NA	NA	NA	NA
AXA88106.1|2953922_2955050_-|integrase	integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2955203:2955230	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
