The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030106	Acinetobacter baumannii strain DA33382 chromosome, complete genome	3947407	122295	136881	3947407		Acinetobacter_phage(50.0%)	25	NA	NA
AXB13988.1|122295_122640_-	hypothetical protein	NA	A0A0P0IYD2	Acinetobacter_phage	78.8	7.4e-38
AXB13989.1|122636_123146_-	hypothetical protein	NA	A0A0P0I8H3	Acinetobacter_phage	85.1	1.1e-32
AXB13990.1|123142_123679_-	hypothetical protein	NA	NA	NA	NA	NA
AXB13991.1|123671_123851_-	hypothetical protein	NA	NA	NA	NA	NA
AXB13992.1|123851_124142_-	hypothetical protein	NA	NA	NA	NA	NA
AXB13993.1|124282_125311_-	ead/Ea22-like family protein	NA	A0A2I7QY11	Vibrio_phage	29.0	3.8e-13
AXB13994.1|125323_126004_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AXB13995.1|126178_126550_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	40.0	6.4e-11
AXB17389.1|126546_126876_-	hypothetical protein	NA	NA	NA	NA	NA
AXB13996.1|126956_127295_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	39.3	1.6e-13
AXB13997.1|127489_127774_-	hypothetical protein	NA	NA	NA	NA	NA
AXB13998.1|127777_128542_-	S24 family peptidase	NA	A0A0P0I8E0	Acinetobacter_phage	63.0	1.6e-77
AXB13999.1|128677_128881_+	transcriptional regulator	NA	NA	NA	NA	NA
AXB14000.1|128916_129291_+	hypothetical protein	NA	NA	NA	NA	NA
AXB14001.1|129324_129525_+	hypothetical protein	NA	NA	NA	NA	NA
AXB14002.1|129521_129707_+	hypothetical protein	NA	NA	NA	NA	NA
AXB14003.1|129703_130159_+	hypothetical protein	NA	NA	NA	NA	NA
AXB14004.1|130155_130794_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	39.9	9.0e-29
AXB14005.1|130790_131765_+	phosphoadenosine phosphosulfate reductase	NA	A4JX51	Burkholderia_virus	47.7	2.7e-77
AXB14006.1|131770_132157_+	hypothetical protein	NA	NA	NA	NA	NA
AXB14007.1|132153_133632_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	53.3	9.7e-135
AXB14008.1|133635_134679_+	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
AXB14009.1|134675_135440_+	AAA family ATPase	NA	A0A0D4DBZ2	Acinetobacter_phage	48.8	1.0e-63
AXB14010.1|135436_135970_+	hypothetical protein	NA	NA	NA	NA	NA
AXB14011.1|136425_136881_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	68.9	2.2e-53
>prophage 2
CP030106	Acinetobacter baumannii strain DA33382 chromosome, complete genome	3947407	273863	285533	3947407	head	Acinetobacter_phage(30.0%)	14	NA	NA
AXB14144.1|273863_274322_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	46.6	2.0e-30
AXB14145.1|274630_274975_+	hypothetical protein	NA	NA	NA	NA	NA
AXB14146.1|275722_276205_+	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	85.8	2.2e-67
AXB14147.1|276182_277673_+	helicase	NA	I3PGT7	Xanthomonas_phage	41.2	1.4e-88
AXB14148.1|277681_279016_+	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	40.0	3.7e-85
AXB14149.1|278960_279773_+|head	phage head morphogenesis protein	head	M4T3R2	Psychrobacter_phage	42.1	2.7e-54
AXB14150.1|279852_280041_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AXB14151.1|280081_280714_+	hypothetical protein	NA	U5U717	Lactobacillus_phage	24.5	2.8e-06
AXB14152.1|280767_281967_+	DUF2213 domain-containing protein	NA	A0A2I7R2U8	Vibrio_phage	28.5	2.0e-21
AXB14153.1|281985_282456_+	hypothetical protein	NA	M4T3R5	Psychrobacter_phage	41.8	8.1e-19
AXB14154.1|282459_282951_+	hypothetical protein	NA	NA	NA	NA	NA
AXB14155.1|282947_283946_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
AXB14156.1|284006_284993_-	right-handed parallel beta-helix repeat-containing protein	NA	U5PSS0	Bacillus_phage	31.7	5.7e-14
AXB14157.1|285143_285533_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	96.9	1.1e-64
>prophage 3
CP030106	Acinetobacter baumannii strain DA33382 chromosome, complete genome	3947407	1441950	1462858	3947407	head,tail,integrase	Acinetobacter_phage(42.11%)	38	1446818:1446833	1468777:1468792
AXB15202.1|1441950_1444029_-	carbohydrate-binding protein	NA	A0A1B1IW99	uncultured_Mediterranean_phage	27.3	8.8e-33
AXB15203.1|1444028_1444589_-	hypothetical protein	NA	A0A1B1IRI7	uncultured_Mediterranean_phage	37.4	9.0e-25
AXB15204.1|1444900_1445800_-	hypothetical protein	NA	A0A1B1IRE8	uncultured_Mediterranean_phage	27.7	5.0e-17
AXB15205.1|1445811_1446435_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15206.1|1446427_1446913_-	hypothetical protein	NA	NA	NA	NA	NA
1446818:1446833	attL	TTCTTCCCAATCCTCA	NA	NA	NA	NA
AXB15207.1|1446909_1448553_-|head,tail	phage head-tail adapter protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	44.6	7.3e-123
AXB15208.1|1448554_1448785_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15209.1|1448784_1449108_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15210.1|1449381_1449585_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15211.1|1449574_1449811_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15212.1|1449807_1450131_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15213.1|1450134_1450467_-	hypothetical protein	NA	E2GLW0	Acinetobacter_phage	44.7	2.0e-11
AXB15214.1|1450459_1450645_-	hypothetical protein	NA	A0A0D4DCN1	Acinetobacter_phage	96.4	2.5e-24
AXB15215.1|1450710_1450890_-	hypothetical protein	NA	A0A0D4DCD9	Acinetobacter_phage	83.1	1.0e-22
AXB15216.1|1450882_1451263_-	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	33.8	8.0e-09
AXB15217.1|1451259_1451916_-	hypothetical protein	NA	A0A0N7IRF9	Acinetobacter_phage	93.1	1.2e-121
AXB15218.1|1451912_1452317_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15219.1|1452334_1452754_-	hypothetical protein	NA	H2DE79	Erwinia_phage	50.8	5.5e-27
AXB15220.1|1452740_1453106_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15221.1|1453954_1454827_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	39.3	6.7e-43
AXB15222.1|1454866_1455202_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AXB15223.1|1455210_1455393_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15224.1|1455504_1456188_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.2	6.9e-27
AXB15225.1|1456205_1456697_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15226.1|1456891_1457083_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15227.1|1457082_1457280_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15228.1|1457279_1457600_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15229.1|1457592_1458348_+	hypothetical protein	NA	I2GUJ1	Acinetobacter_phage	53.5	1.8e-60
AXB15230.1|1458344_1458731_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15231.1|1458730_1458958_+	hypothetical protein	NA	I2GUH8	Acinetobacter_phage	70.6	5.4e-21
AXB15232.1|1458967_1459741_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	63.7	4.0e-55
AXB15233.1|1459721_1460330_+	exonuclease	NA	A0A2H4J882	uncultured_Caudovirales_phage	75.8	4.6e-83
AXB15234.1|1460326_1460644_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15235.1|1460654_1461035_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15236.1|1461031_1461334_+	hypothetical protein	NA	A0A2I7QNA8	Vibrio_phage	35.7	7.8e-07
AXB15237.1|1461330_1461516_+	hypothetical protein	NA	A0A1X9SFM6	Acinetobacter_phage	100.0	5.2e-30
AXB15238.1|1461551_1461842_+	DNA-binding protein	NA	NA	NA	NA	NA
AXB15239.1|1461838_1462858_-|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	43.1	1.9e-68
1468777:1468792	attR	TGAGGATTGGGAAGAA	NA	NA	NA	NA
>prophage 4
CP030106	Acinetobacter baumannii strain DA33382 chromosome, complete genome	3947407	1496128	1551765	3947407	transposase,terminase,head,capsid,tRNA,tail	Acinetobacter_phage(86.84%)	62	NA	NA
AXB17442.1|1496128_1496857_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AXB15272.1|1496961_1497741_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
AXB15273.1|1497795_1498665_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
AXB15274.1|1498894_1500361_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AXB15275.1|1500417_1501788_+	U32 family peptidase	NA	Q6DW11	Phage_TP	63.1	9.0e-127
AXB15276.1|1501790_1502054_+	(4Fe-4S)-binding protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	50.6	7.7e-19
AXB15277.1|1502290_1502620_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AXB15278.1|1503477_1504191_-	histidine ABC transporter permease HisM	NA	NA	NA	NA	NA
AXB15279.1|1504187_1504877_-	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
AXB15280.1|1504968_1505754_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXB15281.1|1505928_1506960_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXB15282.1|1507157_1508378_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXB15283.1|1508384_1511564_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.5	3.3e-63
AXB15284.1|1511576_1513025_+	RND transporter	NA	NA	NA	NA	NA
AXB15285.1|1513065_1514319_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.3	2.3e-97
AXB15286.1|1514379_1514532_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15287.1|1514564_1515794_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AXB15288.1|1516043_1516730_+	3'-5' exonuclease	NA	A0A059VJT9	Pseudomonas_phage	41.6	1.8e-35
AXB15289.1|1516877_1517510_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15290.1|1517767_1517956_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	96.7	1.1e-27
AXB15291.1|1518252_1518774_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
AXB15292.1|1518940_1519495_-	lysozyme	NA	A0A068CDE9	Acinetobacter_phage	79.9	1.3e-79
AXB15293.1|1519484_1519703_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15294.1|1519699_1520056_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15295.1|1520122_1523569_-	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	98.2	0.0e+00
AXB15296.1|1523561_1523924_-	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	78.3	1.4e-50
AXB15297.1|1523920_1524427_-	DUF1833 domain-containing protein	NA	J7HXQ5	Acinetobacter_phage	98.2	3.8e-91
AXB15298.1|1524426_1524825_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	3.1e-72
AXB15299.1|1524961_1525669_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15300.1|1525695_1526340_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15301.1|1526329_1527061_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15302.1|1527529_1531837_-|tail	phage tail tape measure protein	tail	A0A0D4DC37	Acinetobacter_phage	97.1	0.0e+00
AXB15303.1|1531914_1532190_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15304.1|1532208_1532730_-	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	67.8	7.8e-63
AXB15305.1|1532816_1533053_-	transcriptional regulator	NA	NA	NA	NA	NA
AXB15306.1|1533261_1534191_+	ORF6N domain-containing protein	NA	A0A0P0J0J7	Acinetobacter_phage	86.5	4.7e-87
AXB15307.1|1534305_1535016_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
AXB15308.1|1535309_1535639_-	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	62.4	3.5e-29
AXB15309.1|1535566_1536082_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	98.5	1.1e-72
AXB15310.1|1536151_1537069_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	94.4	1.5e-162
AXB15311.1|1537164_1538262_-|tail	phage tail protein	tail	A0A0N7IRE5	Acinetobacter_phage	41.0	7.1e-74
AXB15312.1|1538261_1538612_-	hypothetical protein	NA	J7I469	Acinetobacter_phage	88.9	1.4e-52
AXB15313.1|1538707_1538926_-	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	95.8	1.5e-31
AXB15314.1|1538927_1539371_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	86.4	4.4e-67
AXB15315.1|1539327_1539696_-	HK97 gp10 family phage protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	2.6e-52
AXB17443.1|1539667_1540072_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	91.7	2.2e-65
AXB15316.1|1540080_1540449_-	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	95.1	1.2e-62
AXB15317.1|1540450_1540840_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	7.3e-66
AXB15318.1|1540844_1541510_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	96.8	2.6e-111
AXB15319.1|1541575_1542532_-|capsid	phage capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	97.5	4.8e-175
AXB15320.1|1542559_1543327_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
AXB15321.1|1543440_1543632_-	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
AXB15322.1|1543849_1544092_-	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	100.0	3.6e-39
AXB17444.1|1544190_1544469_-	hypothetical protein	NA	A0A0P0I8B5	Acinetobacter_phage	100.0	1.5e-44
AXB15323.1|1544618_1545581_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AXB15324.1|1545704_1546808_-|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	100.0	2.7e-206
AXB15325.1|1546809_1548261_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	99.6	3.2e-284
AXB15326.1|1548257_1549685_-|terminase	terminase	terminase	J7I460	Acinetobacter_phage	100.0	7.6e-270
AXB15327.1|1549674_1550145_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
AXB15328.1|1550203_1550845_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	98.1	6.7e-125
AXB15329.1|1550813_1551248_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	100.0	3.4e-80
AXB15330.1|1551309_1551765_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	98.0	1.0e-82
>prophage 5
CP030106	Acinetobacter baumannii strain DA33382 chromosome, complete genome	3947407	1555071	1680527	3947407	integrase,terminase,head,capsid,tRNA,tail	Acinetobacter_phage(80.43%)	146	1563495:1563550	1660410:1660465
AXB15336.1|1555071_1555548_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
AXB15337.1|1555544_1555937_-	DUF559 domain-containing protein	NA	A0A1B1P9J0	Acinetobacter_phage	80.8	2.1e-52
AXB15338.1|1555933_1556245_-	hypothetical protein	NA	A0A0D4DCM1	Acinetobacter_phage	95.1	1.1e-59
AXB15339.1|1556235_1556685_-	hypothetical protein	NA	A0A0D4DBZ8	Acinetobacter_phage	64.1	3.4e-14
AXB15340.1|1556688_1557021_-	hypothetical protein	NA	E2GLW0	Acinetobacter_phage	44.7	2.0e-11
AXB15341.1|1557013_1557199_-	hypothetical protein	NA	A0A0D4DCN1	Acinetobacter_phage	96.4	2.5e-24
AXB15342.1|1557264_1557444_-	hypothetical protein	NA	A0A0D4DCD9	Acinetobacter_phage	83.1	1.0e-22
AXB15343.1|1557436_1557748_-	hypothetical protein	NA	A0A0P0I8J0	Acinetobacter_phage	73.1	1.8e-35
AXB15344.1|1557917_1558169_-	hypothetical protein	NA	A0A0P0IE39	Acinetobacter_phage	88.0	5.6e-35
AXB15345.1|1558165_1559491_-	DNA helicase	NA	A0A0P0IVX0	Acinetobacter_phage	98.2	1.3e-247
AXB15346.1|1559490_1560234_-	replication protein	NA	A0A0P0HSN8	Acinetobacter_phage	91.6	1.1e-46
AXB15347.1|1560366_1560549_-	hypothetical protein	NA	A0A1B1P9H5	Acinetobacter_phage	77.3	2.0e-10
AXB15348.1|1560600_1560867_-	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	79.5	1.2e-32
AXB15349.1|1560877_1561108_-	hypothetical protein	NA	A0A1B1P9I7	Acinetobacter_phage	100.0	1.6e-36
AXB15350.1|1561232_1561979_+	helix-turn-helix domain-containing protein	NA	A0A1B1P9J5	Acinetobacter_phage	100.0	1.3e-140
AXB15351.1|1561988_1562198_+	hypothetical protein	NA	A0A1B1P9G7	Acinetobacter_phage	98.5	2.5e-28
AXB15352.1|1562692_1563007_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15353.1|1563067_1563298_+	hypothetical protein	NA	NA	NA	NA	NA
AXB17445.1|1563281_1563497_-	hypothetical protein	NA	NA	NA	NA	NA
1563495:1563550	attL	CATAACAAACTCCATCCAACCCACCCCGTGTGGGTTTTCTTTTGTCTATTAAAGCA	NA	NA	NA	NA
AXB17446.1|1563699_1564077_+	hypothetical protein	NA	A0A068CDD9	Acinetobacter_phage	38.3	7.7e-12
AXB17447.1|1564096_1564363_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15354.1|1564362_1564653_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15355.1|1564662_1565514_+	nuclease	NA	G8CLD3	Synechococcus_phage	31.6	9.5e-34
AXB15356.1|1565516_1566413_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15357.1|1566417_1566675_+	hypothetical protein	NA	K4HYN5	Acinetobacter_phage	77.5	3.6e-29
AXB15358.1|1566671_1566935_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15359.1|1567283_1567493_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	3.7e-32
AXB15360.1|1567489_1567705_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15361.1|1567716_1567986_+	hypothetical protein	NA	A0A1B1P9G0	Acinetobacter_phage	100.0	4.7e-48
AXB15362.1|1567982_1568969_-|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	97.9	2.9e-183
AXB15363.1|1569266_1570202_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	8.3e-23
AXB15364.1|1570198_1570972_+	ABC transporter permease	NA	NA	NA	NA	NA
AXB15365.1|1570968_1571781_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	37.2	5.0e-40
AXB15366.1|1571804_1572455_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15367.1|1572583_1573726_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
AXB15368.1|1573745_1574747_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AXB15369.1|1575037_1575655_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	45.5	2.1e-22
AXB15370.1|1576210_1576663_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
AXB15371.1|1576703_1577021_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
AXB15372.1|1577022_1577739_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXB15373.1|1577833_1578658_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXB15374.1|1578755_1579241_-	DUF3465 domain-containing protein	NA	NA	NA	NA	NA
AXB15375.1|1579306_1580182_-	elongation factor Ts	NA	NA	NA	NA	NA
AXB15376.1|1580319_1581072_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AXB15377.1|1581281_1582109_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AXB15378.1|1582313_1583432_+	OmpW family protein	NA	NA	NA	NA	NA
AXB15379.1|1583841_1585188_+	MFS transporter	NA	NA	NA	NA	NA
AXB15380.1|1585362_1586577_+	MFS transporter	NA	NA	NA	NA	NA
AXB15381.1|1586820_1588233_-	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AXB15382.1|1588429_1589443_+	lipoyl synthase	NA	NA	NA	NA	NA
AXB15383.1|1589726_1592192_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXB15384.1|1592295_1592679_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AXB15385.1|1592717_1593254_-	peptidase C39	NA	NA	NA	NA	NA
AXB15386.1|1593475_1594858_+	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	30.6	2.0e-41
AXB17448.1|1594929_1595766_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
AXB15387.1|1595784_1596507_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AXB15388.1|1596641_1599491_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXB15389.1|1599727_1601998_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
AXB15390.1|1602089_1603328_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	47.3	1.6e-90
AXB17449.1|1603377_1604553_-	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	29.6	8.0e-07
AXB15391.1|1604746_1605505_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AXB15392.1|1605650_1606277_+	superoxide dismutase	NA	NA	NA	NA	NA
AXB15393.1|1606897_1607341_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AXB15394.1|1607350_1607551_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15395.1|1607661_1609119_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXB15396.1|1609229_1610108_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AXB15397.1|1610104_1610614_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AXB17450.1|1610739_1612149_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AXB15398.1|1612889_1614431_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	99.4	5.7e-287
AXB15399.1|1614427_1616230_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	97.5	0.0e+00
AXB15400.1|1616717_1617914_+	DUF4102 domain-containing protein	NA	A0A0D4DBR3	Acinetobacter_phage	99.7	9.7e-226
AXB15401.1|1617910_1618105_-	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	100.0	3.8e-31
AXB15402.1|1618496_1618814_-	anaerobic dehydrogenase	NA	E5KY21	Escherichia_phage	58.5	6.7e-25
AXB15403.1|1618814_1619360_-	hypothetical protein	NA	A0A0D4DCJ5	Acinetobacter_phage	92.7	1.5e-93
AXB15404.1|1619398_1619788_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	84.5	4.3e-58
AXB15405.1|1619874_1628430_-|tail	phage tail protein	tail	A0A0R6PIC9	Moraxella_phage	39.8	2.3e-10
AXB15406.1|1628496_1629168_-|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	47.3	4.1e-40
AXB15407.1|1629151_1629907_-|tail	phage tail protein	tail	A0A0R6PIM4	Moraxella_phage	57.4	4.5e-88
AXB15408.1|1629913_1630612_-|tail	phage minor tail protein L	tail	A0A0R6PIG8	Moraxella_phage	68.1	4.8e-92
AXB15409.1|1630621_1630972_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15410.1|1631026_1631368_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXB15411.1|1631485_1635451_-	replication protein	NA	A0A0D4DC37	Acinetobacter_phage	44.7	2.9e-165
AXB15412.1|1635511_1635913_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15413.1|1635993_1636398_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	89.6	2.7e-63
AXB15414.1|1636462_1636645_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
AXB15415.1|1636976_1637510_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	59.9	6.3e-44
AXB15416.1|1637553_1638483_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	40.6	4.0e-54
AXB15417.1|1638590_1638803_-	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	75.4	1.3e-21
AXB15418.1|1638804_1639203_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	71.2	4.0e-51
AXB15419.1|1639204_1639573_-	HK97 gp10 family phage protein	NA	A0A0P0IDX0	Acinetobacter_phage	95.4	4.6e-54
AXB17451.1|1639544_1639949_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	93.3	9.0e-67
AXB15420.1|1639957_1640371_-	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	76.6	5.6e-56
AXB15421.1|1640327_1640717_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	9.5e-66
AXB15422.1|1640721_1641387_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	67.4	5.2e-72
AXB15423.1|1641451_1642408_-|capsid	phage capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	93.7	5.6e-168
AXB15424.1|1642435_1643203_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	97.3	7.3e-118
AXB15425.1|1643316_1643631_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	48.5	3.4e-13
AXB15426.1|1643699_1644212_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15427.1|1644403_1645507_-|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	93.5	9.6e-196
AXB15428.1|1645513_1646959_-	hypothetical protein	NA	A0A0D4DCP1	Acinetobacter_phage	98.8	1.1e-281
AXB15429.1|1646955_1648383_-|terminase	terminase	terminase	A0A0D4DCE6	Acinetobacter_phage	89.3	1.2e-254
AXB15430.1|1648372_1648843_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	89.7	2.6e-73
AXB15431.1|1648900_1649542_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	97.2	4.4e-124
AXB15432.1|1649510_1649978_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	76.1	6.3e-64
AXB15433.1|1650150_1650354_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15434.1|1651411_1651642_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15435.1|1651822_1652386_-	hypothetical protein	NA	A0A1B1P9I8	Acinetobacter_phage	52.5	3.2e-46
AXB15436.1|1652407_1652692_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15437.1|1652701_1653109_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	51.8	4.0e-22
AXB15438.1|1653105_1653507_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15439.1|1653493_1653676_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15440.1|1653672_1654071_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.5	8.9e-27
AXB15441.1|1654067_1654475_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15442.1|1654471_1655221_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	96.0	1.6e-133
AXB15443.1|1655213_1656143_-	DUF1376 domain-containing protein	NA	A0A0P0I481	Acinetobacter_phage	99.7	3.7e-172
AXB15444.1|1656135_1656498_-	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	99.1	2.4e-55
AXB15445.1|1656494_1656791_-	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	98.0	8.9e-48
AXB17452.1|1656787_1657063_-	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	97.8	1.3e-40
AXB15446.1|1657118_1657475_-	transcriptional regulator	NA	J7I452	Acinetobacter_phage	98.3	8.8e-58
AXB15447.1|1657484_1657736_-	hypothetical protein	NA	A0A0N7IRE1	Acinetobacter_phage	95.2	2.4e-38
AXB15448.1|1657844_1658609_+	helix-turn-helix domain-containing protein	NA	A0A0P0J076	Acinetobacter_phage	95.3	1.5e-139
AXB15449.1|1658623_1658839_+	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	95.7	3.9e-29
AXB15450.1|1658940_1659804_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	51.1	7.1e-69
AXB15451.1|1659862_1660075_+	transcriptional regulator	NA	NA	NA	NA	NA
AXB15452.1|1660061_1660337_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15453.1|1660607_1661048_+	hypothetical protein	NA	A0A0D4DBH9	Acinetobacter_phage	98.6	1.3e-74
1660410:1660465	attR	CATAACAAACTCCATCCAACCCACCCCGTGTGGGTTTTCTTTTGTCTATTAAAGCA	NA	NA	NA	NA
AXB15454.1|1661047_1661338_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	99.0	1.6e-49
AXB15455.1|1661330_1661654_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	97.2	1.7e-55
AXB15456.1|1661665_1662787_+	AAA family ATPase	NA	A0A0N7IRE0	Acinetobacter_phage	99.7	2.0e-212
AXB15457.1|1662783_1662990_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15458.1|1662994_1663954_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	82.1	5.7e-144
AXB15459.1|1663992_1664202_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	3.3e-33
AXB15460.1|1664205_1664613_+	hypothetical protein	NA	A0A0P0I8H3	Acinetobacter_phage	97.0	1.3e-12
AXB15461.1|1664609_1665005_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15462.1|1665001_1665337_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	62.4	3.7e-34
AXB15463.1|1665337_1665607_+	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	100.0	8.7e-42
AXB15464.1|1665721_1666306_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	99.5	1.7e-111
AXB15465.1|1666401_1669101_-	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	97.8	0.0e+00
AXB15466.1|1669179_1671912_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	97.7	0.0e+00
AXB17453.1|1672268_1673318_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
AXB15467.1|1673327_1674134_+	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	99.6	1.8e-146
AXB15468.1|1674143_1674839_+	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
AXB15469.1|1674849_1675833_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	99.4	1.0e-188
AXB15470.1|1675839_1678215_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	98.9	0.0e+00
AXB15471.1|1678216_1679716_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	96.6	2.3e-277
AXB15472.1|1679972_1680527_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	2.7e-98
>prophage 6
CP030106	Acinetobacter baumannii strain DA33382 chromosome, complete genome	3947407	2269892	2333499	3947407	integrase,plate,terminase,portal,holin,capsid,tRNA,tail	uncultured_Caudovirales_phage(28.57%)	73	2275423:2275438	2322040:2322055
AXB15935.1|2269892_2271671_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	21.9	6.2e-19
AXB15936.1|2271810_2272026_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15937.1|2272086_2272860_+	glycosyl transferase	NA	NA	NA	NA	NA
AXB15938.1|2272861_2273989_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.0	3.2e-29
AXB15939.1|2274168_2274984_+	glycosyltransferase	NA	NA	NA	NA	NA
AXB15940.1|2275002_2275896_+	hypothetical protein	NA	NA	NA	NA	NA
2275423:2275438	attL	GAATTTCCATTGAAAT	NA	NA	NA	NA
AXB15941.1|2275892_2276927_-	glycosyltransferase	NA	NA	NA	NA	NA
AXB15942.1|2276938_2277703_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AXB17480.1|2277699_2278431_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AXB15943.1|2278451_2279480_-	glycosyltransferase	NA	NA	NA	NA	NA
AXB15944.1|2279502_2280393_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
AXB15945.1|2280460_2281387_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
AXB15946.1|2281411_2284162_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
AXB15947.1|2284230_2285499_-	sensor histidine kinase	NA	B5LWN0	Feldmannia_species_virus	24.8	1.3e-07
AXB15948.1|2286831_2287830_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	53.2	6.4e-98
AXB17481.1|2287829_2289617_-|terminase	terminase	terminase	Q9ZXM5	Pseudomonas_virus	58.5	2.5e-201
AXB15949.1|2289775_2290603_+|capsid	capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	45.8	6.3e-59
AXB15950.1|2290655_2291645_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	54.5	1.5e-94
AXB15951.1|2291655_2292402_+|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	42.9	1.2e-37
AXB15952.1|2292505_2292958_+|capsid	capsid protein	capsid	Q9ZXM1	Pseudomonas_virus	46.5	1.2e-24
AXB15953.1|2292958_2293168_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	59.7	5.2e-18
AXB15954.1|2293176_2293527_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15955.1|2293523_2293793_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	38.5	7.7e-06
AXB15956.1|2293789_2294620_+	DUF3380 domain-containing protein	NA	A4JWU0	Burkholderia_virus	42.6	2.8e-46
AXB15957.1|2294616_2295144_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	50.0	2.8e-36
AXB15958.1|2295140_2295590_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	48.2	4.8e-29
AXB15959.1|2295662_2296295_+|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	35.1	7.3e-23
AXB15960.1|2296291_2296639_+|plate	baseplate assembly protein	plate	A0A2H4JE52	uncultured_Caudovirales_phage	51.8	8.1e-24
AXB15961.1|2296635_2297538_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	48.5	6.0e-71
AXB15962.1|2297537_2298143_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	38.2	1.1e-28
AXB15963.1|2298154_2300107_+	alkaline phosphatase	NA	F1BUP1	Erwinia_phage	42.9	2.9e-30
AXB15964.1|2300256_2301432_+|tail	phage tail protein	tail	Q9ZXK4	Pseudomonas_virus	68.3	1.4e-149
AXB15965.1|2301444_2301963_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	58.5	6.1e-52
AXB15966.1|2302029_2302371_+|tail	phage tail assembly protein	tail	E5E3U8	Burkholderia_phage	52.2	5.0e-18
AXB17482.1|2302373_2302511_+|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	57.9	1.7e-06
AXB15967.1|2302524_2304975_+|tail	phage tail tape measure protein	tail	A0A193GYN8	Enterobacter_phage	44.4	3.0e-104
AXB15968.1|2304980_2305421_+	oxidoreductase	NA	A0A2H4JG54	uncultured_Caudovirales_phage	54.8	1.7e-39
AXB15969.1|2305421_2306735_+	DNA primase	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	42.9	9.3e-97
AXB15970.1|2306864_2307104_+	transcriptional regulator	NA	NA	NA	NA	NA
AXB15971.1|2307100_2307301_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AXB15972.1|2307301_2307580_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15973.1|2307616_2307898_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15974.1|2307897_2308776_-	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
AXB15975.1|2308824_2309085_-	hypothetical protein	NA	NA	NA	NA	NA
AXB15976.1|2309085_2309280_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15977.1|2309387_2310203_+	Rha family transcriptional regulator	NA	A0A0K2CXT4	Paenibacillus_phage	52.1	5.9e-25
AXB15978.1|2310327_2310543_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15979.1|2310587_2310929_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXB15980.1|2311021_2311213_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15981.1|2311306_2314045_+	toprim	NA	A0A2H4JDT6	uncultured_Caudovirales_phage	62.2	0.0e+00
AXB15982.1|2314041_2314374_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15983.1|2314439_2314991_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15984.1|2315143_2315461_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15985.1|2315448_2315802_+	single-stranded DNA-binding protein	NA	M4SRQ0	Psychrobacter_phage	60.9	3.7e-32
AXB15986.1|2315811_2316549_+	3'-5' exonuclease	NA	A0A0S0NDC6	Pseudomonas_phage	30.4	2.7e-21
AXB15987.1|2316558_2316780_+	hypothetical protein	NA	A0A2H4J8L3	uncultured_Caudovirales_phage	38.2	2.0e-07
AXB15988.1|2316776_2317073_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15989.1|2317100_2318168_-|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	37.9	1.5e-44
AXB15990.1|2318613_2319651_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AXB15991.1|2319804_2320833_+	hypothetical protein	NA	NA	NA	NA	NA
AXB15992.1|2320919_2321489_+	LemA family protein	NA	NA	NA	NA	NA
AXB15993.1|2321664_2322798_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.5	1.3e-94
2322040:2322055	attR	ATTTCAATGGAAATTC	NA	NA	NA	NA
AXB15994.1|2322896_2323226_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AXB15995.1|2323277_2325179_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AXB15996.1|2325187_2326153_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.1	1.7e-31
AXB15997.1|2326218_2327472_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	3.8e-39
AXB15998.1|2327572_2328292_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AXB15999.1|2328353_2329265_+	bestrophin	NA	NA	NA	NA	NA
AXB16000.1|2329272_2330124_-	PHP domain-containing protein	NA	NA	NA	NA	NA
AXB16001.1|2330168_2330783_+	septation protein A	NA	NA	NA	NA	NA
AXB16002.1|2330817_2331120_+	hypothetical protein	NA	NA	NA	NA	NA
AXB16003.1|2331124_2331604_+	hypothetical protein	NA	NA	NA	NA	NA
AXB16004.1|2331627_2333499_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 7
CP030106	Acinetobacter baumannii strain DA33382 chromosome, complete genome	3947407	3100146	3153103	3947407	integrase,transposase,tRNA	Escherichia_phage(13.33%)	55	3103053:3103112	3155356:3156175
AXB16667.1|3100146_3100857_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	9.1e-06
AXB16668.1|3100858_3102769_+|transposase	transposase	transposase	NA	NA	NA	NA
3103053:3103112	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AXB16669.1|3103115_3103820_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXB16670.1|3104370_3105183_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
AXB16671.1|3105393_3105930_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AXB16672.1|3105932_3106865_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AXB16673.1|3106915_3108112_-	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
AXB16674.1|3108136_3109483_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AXB16675.1|3109643_3109895_-	hypothetical protein	NA	NA	NA	NA	NA
AXB16676.1|3109915_3111769_-	ferrous iron transporter B	NA	NA	NA	NA	NA
AXB17517.1|3111765_3112029_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
AXB16677.1|3112172_3113093_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	2.3e-33
AXB16678.1|3113239_3114055_+	DsbC family protein	NA	NA	NA	NA	NA
AXB16679.1|3114299_3115601_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AXB16680.1|3115656_3116796_+	threonine synthase	NA	NA	NA	NA	NA
AXB16681.1|3116904_3117912_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AXB16682.1|3118163_3118799_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXB17518.1|3118854_3120378_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.5	4.7e-07
AXB16683.1|3120402_3121824_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXB16684.1|3121827_3123012_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	23.0	8.3e-12
AXB16685.1|3123027_3124575_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AXB16686.1|3124700_3125771_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AXB16687.1|3125770_3126871_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AXB16688.1|3127014_3128463_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	5.5e-50
AXB16689.1|3128455_3128863_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AXB16690.1|3128901_3129540_+	hypothetical protein	NA	NA	NA	NA	NA
AXB16691.1|3129670_3129889_+	hypothetical protein	NA	NA	NA	NA	NA
AXB16692.1|3129947_3130607_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.6	1.5e-34
AXB16693.1|3130649_3131942_-	DNA modification methylase	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.6	2.5e-38
AXB16694.1|3131938_3133024_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.3	3.3e-47
AXB16695.1|3133039_3133498_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
AXB16696.1|3133656_3135054_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	7.0e-34
AXB16697.1|3135111_3135450_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
AXB16698.1|3135729_3135957_+	membrane fusogenic activity	NA	NA	NA	NA	NA
AXB16699.1|3136022_3136880_+	ATP-binding protein	NA	NA	NA	NA	NA
AXB16700.1|3136962_3138759_+	hypothetical protein	NA	NA	NA	NA	NA
AXB16701.1|3139053_3140541_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	78.6	1.2e-217
AXB16702.1|3140941_3142231_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
AXB16703.1|3142252_3142765_-	signal peptidase II	NA	NA	NA	NA	NA
AXB16704.1|3142768_3143665_-	sodium:proton antiporter	NA	NA	NA	NA	NA
AXB16705.1|3143760_3144168_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AXB16706.1|3144289_3144553_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
AXB16707.1|3144609_3144993_-	hypothetical protein	NA	NA	NA	NA	NA
AXB16708.1|3145698_3146043_-	hypothetical protein	NA	A0A2I7S8K9	Vibrio_phage	41.4	2.0e-11
AXB16709.1|3146350_3146851_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXB16710.1|3146869_3147049_+	hypothetical protein	NA	NA	NA	NA	NA
AXB16711.1|3146978_3147818_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AXB16712.1|3147811_3148159_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXB16713.1|3148322_3149114_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AXB16714.1|3149205_3149511_-	hypothetical protein	NA	NA	NA	NA	NA
AXB16715.1|3149526_3150039_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXB16716.1|3150157_3150622_-	AAC(3)-I family aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
AXB16717.1|3150792_3151827_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	44.5	5.0e-69
AXB16718.1|3151900_3152251_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AXB16719.1|3152398_3153103_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
3155356:3156175	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCTACAGGAGTATATTCAGATTGATTAAATAGACGATGTCGAAGGCTGACTTTTTCAACTTGAATAAAACCACTGAACAGAGGTTCACGTGATGTTACTTCGACATCTTTAGATGTATAACTTGGACGCTCGACAATACTCATGATTCGATCAGGACGAAATCTATTTATTTCATCCTAACCGAGAATCATGGCTAGGCAAGTGTTTTTTTTGAATATTTACACTTTATGATACAGTTTCTGTCCTTGCTCTTGATAAACCTCTTTCATCGCTTTGAGGCCTTCTTCAACCTCTGAATCGCTATTGGTGAGATTGTTGGCATAGTCACGAACATTCTGGGTGATTTTCATCGAACAGAATTTTGGACCACACATTGAGCAAAAGTGAGCAGATTTATGCGCTTCTTTTGGTAAAGTCTCGTCATGCATGCTGCGTGCTGTATCTGGGTCTAGGCTTAGGTTGAACTGATCGTCCCAACGGAATTCGAAACGTGCTTTAGACAAGGCATTATCACGAACCTGTGCACCCGGATGACCTTTGGCAAGATCGGCTGCGTGTGCTGCAATCTTGTAGGTAATAATTCCGTCTTTTACATCTTTCTTGTTTGGCAAACCTAAATGTTCTTTAGGTGTCACATAGCAAAGCATTGCTGTGCCATACCAGCCGATCATGGCTGCACCAATAGCAGAAGTAATGTGGTCATAACCCGGAGCGATATCTGTGGTTAAAGGCCCAAGTGTATAGAATGGAGCTTCTTTACAC	NA	NA	NA	NA
