The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030788	Vibrio campbellii strain DS40M4 chromosome 1, complete sequence	3261651	589817	596883	3261651		Faustovirus(16.67%)	9	NA	NA
AXB30582.1|589817_591032_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	29.9	4.8e-31
AXB30583.1|591069_591453_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	5.4e-53
AXB30584.1|591525_591849_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	4.0e-25
AXB30585.1|591904_592420_+	co-chaperone protein HscB	NA	NA	NA	NA	NA
AXB30586.1|592441_594295_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.4	9.4e-111
AXB30587.1|594308_594647_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AXB30588.1|594691_594886_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AXB30589.1|595058_596357_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.7	9.1e-36
AXB30590.1|596457_596883_+	nucleoside-diphosphate kinase	NA	L7Y4C4	Megavirus	40.6	2.1e-21
>prophage 2
CP030788	Vibrio campbellii strain DS40M4 chromosome 1, complete sequence	3261651	667653	674344	3261651		Staphylococcus_phage(66.67%)	7	NA	NA
AXB30647.1|667653_668793_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.7	2.2e-62
AXB30648.1|668810_670061_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	1.5e-99
AXB30649.1|670188_670638_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AXB30650.1|670645_671770_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.1	6.0e-44
AXB30651.1|671781_672435_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.0	3.3e-34
AXB30652.1|672594_673704_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.6	8.8e-64
AXB30653.1|673873_674344_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.3	1.7e-32
>prophage 3
CP030788	Vibrio campbellii strain DS40M4 chromosome 1, complete sequence	3261651	1692681	1717736	3261651	portal,protease,lysis,transposase,tail	Vibrio_phage(42.86%)	32	NA	NA
AXB31512.1|1692681_1693551_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.4	4.0e-80
AXB32908.1|1693543_1695100_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	55.4	1.5e-157
AXB31513.1|1695111_1695309_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXB31514.1|1695305_1697213_-	DNA packaging protein	NA	A0A1I9KF19	Aeromonas_phage	39.7	8.4e-123
AXB31515.1|1697169_1697772_-	hypothetical protein	NA	D4HTU0	Vibrio_phage	36.5	4.7e-19
AXB31516.1|1697888_1698371_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	44.5	5.2e-21
AXB31517.1|1698819_1699011_-	hypothetical protein	NA	A0A1V1FD92	Vibrio_phage	54.1	1.7e-12
AXB31518.1|1699166_1699835_-	hypothetical protein	NA	R9TRM8	Vibrio_phage	65.6	1.3e-81
AXB31519.1|1700172_1700766_-	hypothetical protein	NA	NA	NA	NA	NA
AXB31520.1|1700969_1701254_+	hypothetical protein	NA	NA	NA	NA	NA
AXB31521.1|1701367_1702039_-	hypothetical protein	NA	NA	NA	NA	NA
AXB31522.1|1702825_1703137_+	hypothetical protein	NA	NA	NA	NA	NA
AXB31523.1|1703348_1704083_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXB31524.1|1704079_1704487_-	hypothetical protein	NA	NA	NA	NA	NA
AXB31525.1|1705728_1707027_-	hypothetical protein	NA	NA	NA	NA	NA
AXB31526.1|1708290_1708818_-	hypothetical protein	NA	NA	NA	NA	NA
AXB31527.1|1708861_1708984_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
AXB31528.1|1709174_1710131_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXB31529.1|1710153_1710903_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXB32909.1|1710948_1711080_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
AXB31530.1|1711067_1711436_-	hypothetical protein	NA	NA	NA	NA	NA
AXB31531.1|1711579_1712158_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXB31532.1|1712309_1712711_-	hypothetical protein	NA	NA	NA	NA	NA
AXB31533.1|1712749_1712881_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
AXB31534.1|1712856_1713390_-	hypothetical protein	NA	NA	NA	NA	NA
AXB31535.1|1713532_1714111_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXB31536.1|1714305_1714539_-	hypothetical protein	NA	NA	NA	NA	NA
AXB32910.1|1714568_1714688_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
AXB31537.1|1714684_1715128_-	hypothetical protein	NA	NA	NA	NA	NA
AXB31538.1|1715670_1716210_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXB31539.1|1716466_1716589_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
AXB31540.1|1716779_1717736_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP030788	Vibrio campbellii strain DS40M4 chromosome 1, complete sequence	3261651	1724141	1731858	3261651		Vibrio_phage(90.91%)	13	NA	NA
AXB31553.1|1724141_1725056_-	DUF968 domain-containing protein	NA	A0A1V0E819	Vibrio_phage	41.3	4.1e-51
AXB31554.1|1725048_1725360_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	89.1	2.7e-47
AXB31555.1|1725356_1726052_-	DNA-binding protein	NA	R9TMN1	Vibrio_phage	67.1	9.7e-77
AXB31556.1|1726045_1726258_-	hypothetical protein	NA	A0A1V0E856	Vibrio_phage	51.8	3.6e-11
AXB31557.1|1726268_1727225_-	helix-turn-helix domain-containing protein	NA	R9TPU9	Vibrio_phage	72.8	7.7e-125
AXB31558.1|1727224_1727746_-	DNA methyltransferase	NA	R9TNL7	Vibrio_phage	89.6	6.1e-92
AXB31559.1|1727902_1728172_-	hypothetical protein	NA	NA	NA	NA	NA
AXB31560.1|1728168_1728621_-	hypothetical protein	NA	R9TRN6	Vibrio_phage	65.7	1.0e-42
AXB31561.1|1728610_1728877_-	XRE family transcriptional regulator	NA	A0A1V0E8C7	Vibrio_phage	47.8	1.0e-10
AXB31562.1|1728974_1729697_+	XRE family transcriptional regulator	NA	R9TNM0	Vibrio_phage	67.1	4.3e-88
AXB31563.1|1729992_1730205_+	hypothetical protein	NA	A0A1V0E8D5	Vibrio_phage	43.3	2.4e-10
AXB31564.1|1730392_1730623_+	hypothetical protein	NA	NA	NA	NA	NA
AXB31565.1|1730622_1731858_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	41.7	8.5e-76
>prophage 5
CP030788	Vibrio campbellii strain DS40M4 chromosome 1, complete sequence	3261651	2672226	2687794	3261651	tRNA	uncultured_Mediterranean_phage(22.22%)	14	NA	NA
AXB32376.1|2672226_2674809_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.5	1.5e-77
AXB32377.1|2674951_2675419_-	recombination regulator RecX	NA	NA	NA	NA	NA
AXB32378.1|2675625_2676669_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.7	2.4e-111
AXB32379.1|2676869_2677352_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.1	1.4e-26
AXB32380.1|2677437_2679999_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	22.8	4.4e-34
AXB32381.1|2680087_2681074_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	6.9e-36
AXB32382.1|2681154_2682078_-	LysM peptidoglycan-binding domain-containing protein	NA	D7RWE0	Brochothrix_phage	36.4	1.8e-06
AXB32383.1|2682092_2682719_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.9	3.0e-37
AXB32384.1|2682718_2683495_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.7	1.6e-67
AXB32385.1|2683494_2684538_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AXB32386.1|2684583_2685060_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AXB32387.1|2685074_2685785_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AXB32388.1|2685786_2686068_-	cell division protein FtsB	NA	NA	NA	NA	NA
AXB32389.1|2686492_2687794_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.1	1.0e-135
>prophage 1
CP030789	Vibrio campbellii strain DS40M4 chromosome 2, complete sequence	1878023	1041532	1097928	1878023	capsid,portal,protease,tail,head,integrase,terminase	Vibrio_phage(79.49%)	70	1058074:1058093	1097711:1097730
AXB33842.1|1041532_1042534_-|protease	serine protease	protease	G9E3T9	Emiliania_huxleyi_virus	29.7	7.3e-17
AXB33843.1|1042696_1043599_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXB33844.1|1043741_1044665_+	DMT family transporter	NA	NA	NA	NA	NA
AXB33845.1|1044773_1045214_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
AXB33846.1|1045298_1046054_+	phosphatase	NA	NA	NA	NA	NA
AXB33847.1|1046154_1046550_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
AXB33848.1|1046727_1047087_+	hypothetical protein	NA	NA	NA	NA	NA
AXB33849.1|1047242_1048682_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AXB33850.1|1048734_1049118_-	VOC family protein	NA	NA	NA	NA	NA
AXB33851.1|1049144_1050074_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXB33852.1|1050151_1050625_-	hypothetical protein	NA	NA	NA	NA	NA
AXB33853.1|1050912_1051596_+	hypothetical protein	NA	NA	NA	NA	NA
AXB33854.1|1051605_1052301_+	hypothetical protein	NA	NA	NA	NA	NA
AXB33855.1|1055558_1056752_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.9	8.6e-41
AXB33856.1|1056951_1057983_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	88.5	6.5e-21
1058074:1058093	attL	GCTGTCGCCACTTTGTCGCC	NA	NA	NA	NA
AXB33857.1|1058094_1059132_-|integrase	integrase	integrase	R9TMQ4	Vibrio_phage	63.3	4.3e-129
AXB33858.1|1059259_1060189_+	HNH endonuclease	NA	NA	NA	NA	NA
AXB33859.1|1060579_1061143_+	hypothetical protein	NA	NA	NA	NA	NA
AXB33860.1|1061139_1061250_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
AXB33861.1|1061301_1061685_+	hypothetical protein	NA	NA	NA	NA	NA
AXB33862.1|1061822_1062287_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXB33863.1|1062421_1062982_+	suppressor of fused domain protein	NA	NA	NA	NA	NA
AXB33864.1|1062986_1063097_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
AXB33865.1|1063133_1063808_+	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	34.7	1.4e-27
AXB33866.1|1063955_1064363_+	hypothetical protein	NA	NA	NA	NA	NA
AXB33867.1|1064419_1064605_+	hypothetical protein	NA	NA	NA	NA	NA
AXB33868.1|1064666_1066997_+	hypothetical protein	NA	NA	NA	NA	NA
AXB33869.1|1067232_1067511_+	hypothetical protein	NA	NA	NA	NA	NA
AXB33870.1|1067734_1068361_-	transcriptional regulator	NA	A0A2I7RNF9	Vibrio_phage	40.9	4.7e-38
AXB33871.1|1068452_1068665_+	hypothetical protein	NA	U3PFJ1	Vibrio_phage	54.3	1.3e-13
AXB33872.1|1068778_1069318_+	transcriptional regulator	NA	A0A2I7RNI1	Vibrio_phage	54.7	6.0e-50
AXB33873.1|1069346_1069547_+	hypothetical protein	NA	A0A2I7RNH0	Vibrio_phage	41.3	2.6e-06
AXB33874.1|1069546_1069774_+	hypothetical protein	NA	NA	NA	NA	NA
AXB33875.1|1069770_1070007_+	hypothetical protein	NA	NA	NA	NA	NA
AXB33876.1|1070012_1071899_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	38.4	8.8e-64
AXB33877.1|1071949_1072213_+	hypothetical protein	NA	Q8HA64	Vibrio_phage	56.9	2.2e-13
AXB33878.1|1072207_1072459_-	transcriptional regulator	NA	R9TNQ2	Vibrio_phage	75.9	1.2e-29
AXB33879.1|1072742_1073615_+	hypothetical protein	NA	NA	NA	NA	NA
AXB33880.1|1074082_1074739_+	hypothetical protein	NA	NA	NA	NA	NA
AXB33881.1|1075116_1075473_-	hypothetical protein	NA	NA	NA	NA	NA
AXB33882.1|1075524_1075860_-	hypothetical protein	NA	NA	NA	NA	NA
AXB33883.1|1075967_1076291_-	hypothetical protein	NA	NA	NA	NA	NA
AXB33884.1|1076946_1077966_-|portal	phage portal protein	portal	A0A1D9C9P9	Salinivibrio_phage	58.9	7.7e-115
AXB33885.1|1077970_1079752_-|terminase	terminase	terminase	A0A1D9C9R1	Salinivibrio_phage	77.2	2.6e-259
AXB33886.1|1079926_1080817_+|capsid	phage capsid protein	capsid	A0A2I7RNH1	Vibrio_phage	57.8	8.6e-78
AXB33887.1|1080816_1081821_+|capsid	phage major capsid protein, P2 family	capsid	R9TPZ5	Vibrio_phage	61.6	7.6e-99
AXB33888.1|1081824_1082541_+|terminase	terminase	terminase	A0A2I7RNJ0	Vibrio_phage	54.5	6.5e-68
AXB33889.1|1082657_1083119_+|head	head protein	head	U3PFL1	Vibrio_phage	71.9	2.6e-54
AXB33890.1|1083115_1083604_+	hypothetical protein	NA	U3PIL4	Vibrio_phage	72.8	1.5e-63
AXB33891.1|1083590_1084250_+	phage virion morphogenesis protein	NA	U3PDG7	Vibrio_phage	81.7	1.3e-94
AXB33892.1|1084251_1085361_+	DUF2586 family protein	NA	U3PB71	Vibrio_phage	82.6	1.7e-171
AXB34643.1|1085354_1085813_+	DUF2597 family protein	NA	U3PCG7	Vibrio_phage	84.2	4.0e-71
AXB33893.1|1085821_1086028_+	TraR/DksA family transcriptional regulator	NA	U3PFL5	Vibrio_phage	71.6	2.4e-20
AXB33894.1|1086027_1086240_+	hypothetical protein	NA	U3PIL8	Vibrio_phage	81.2	9.6e-28
AXB33895.1|1086226_1086817_+	lysozyme	NA	U3PDH1	Vibrio_phage	75.5	7.7e-83
AXB33896.1|1086791_1087133_+	hypothetical protein	NA	U3PB75	Vibrio_phage	60.2	1.4e-28
AXB33897.1|1087089_1087344_+	hypothetical protein	NA	U3PCH1	Vibrio_phage	69.1	2.2e-26
AXB33898.1|1087336_1087621_+	hypothetical protein	NA	A0A160DHS7	Vibrio_phage	70.2	5.8e-28
AXB33899.1|1087821_1090023_+|tail	phage tail tape measure protein	tail	U3PFL8	Vibrio_phage	63.6	1.2e-242
AXB33900.1|1090012_1090345_+	DUF2590 family protein	NA	R9TMS7	Vibrio_phage	70.6	5.0e-39
AXB33901.1|1090341_1091547_+	hypothetical protein	NA	R9TRT3	Vibrio_phage	65.8	1.2e-151
AXB33902.1|1091539_1092214_+|tail	phage tail protein	tail	U3PB79	Vibrio_phage	56.5	1.6e-52
AXB33903.1|1092214_1092976_+	hypothetical protein	NA	A0A0U4K5K2	Pseudomonas_phage	43.6	2.8e-29
AXB33904.1|1092972_1093974_+	hypothetical protein	NA	NA	NA	NA	NA
AXB33905.1|1093980_1094370_+	hypothetical protein	NA	A0A088C3N9	Shewanella_sp._phage	59.8	4.6e-28
AXB33906.1|1094372_1095266_+	hypothetical protein	NA	U3PIM3	Vibrio_phage	53.9	2.5e-85
AXB33907.1|1095253_1095727_+	DNA-binding protein	NA	R9TPX7	Vibrio_phage	70.1	5.1e-53
AXB33908.1|1095723_1097358_+	hypothetical protein	NA	R9TNN7	Vibrio_phage	66.2	5.8e-213
AXB33909.1|1097359_1097557_+	hypothetical protein	NA	D4HTV1	Vibrio_phage	43.8	5.6e-06
AXB33910.1|1097793_1097928_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	86.4	5.3e-16
1097711:1097730	attR	GCTGTCGCCACTTTGTCGCC	NA	NA	NA	NA
