The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030845	Streptococcus agalactiae strain S73 chromosome, complete genome	2059915	14480	26545	2059915		Microbacterium_phage(14.29%)	8	NA	NA
AXC18413.1|14480_18206_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.0	1.6e-40
AXC16467.1|18439_19894_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	4.9e-54
AXC16468.1|19921_20944_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	44.6	9.6e-65
AXC16469.1|21111_21663_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	1.8e-25
AXC16470.1|21682_22435_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXC16471.1|22454_24002_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.9	2.5e-77
AXC16472.1|24194_25094_+	zoocin A	NA	A0A221J6U0	Arthrobacter_phage	45.9	4.1e-19
AXC16473.1|25240_26545_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2D1GNZ3	Streptomyces_phage	40.5	1.7e-05
>prophage 2
CP030845	Streptococcus agalactiae strain S73 chromosome, complete genome	2059915	79072	144375	2059915	capsid,portal,terminase,head,tail,holin,integrase,transposase,tRNA	Streptococcus_phage(64.91%)	78	74948:74968	136943:136963
74948:74968	attL	TGGCGGAATTGGCAGACGCGC	NA	NA	NA	NA
AXC16530.1|79072_80170_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	97.8	2.1e-203
AXC16531.1|80346_80556_-	NINE protein	NA	A0A060AN66	Enterococcus_phage	50.0	5.0e-05
AXC16532.1|80608_80989_-	ImmA/IrrE family metallo-endopeptidase	NA	J7KBR5	Streptococcus_phage	84.9	6.5e-59
AXC16533.1|80978_81338_-	helix-turn-helix domain-containing protein	NA	M1PRN5	Streptococcus_phage	66.7	3.3e-36
AXC16534.1|81526_81727_+	XRE family transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	67.7	3.8e-18
AXC16535.1|81774_82503_+	oxidoreductase	NA	Q938N5	Temperate_phage	79.8	1.5e-109
AXC16536.1|83112_83370_+	hypothetical protein	NA	NA	NA	NA	NA
AXC16537.1|83571_84330_+	DnaD domain protein	NA	A0A097PBE7	Streptococcus_pyogenes_phage	64.4	1.7e-71
AXC16538.1|84316_85099_+	DNA replication protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	88.8	3.1e-132
AXC16539.1|85225_85501_+	hypothetical protein	NA	J7KJY6	Streptococcus_phage	56.0	1.3e-21
AXC16540.1|85487_85742_+	hypothetical protein	NA	J7KK18	Streptococcus_phage	83.3	9.7e-35
AXC16541.1|85744_85906_+	hypothetical protein	NA	J7KDI4	Streptococcus_phage	98.1	1.1e-20
AXC16542.1|85906_86860_+	recombinase RecT	NA	J7KDK3	Streptococcus_phage	71.0	5.1e-121
AXC16543.1|86856_87654_+	hypothetical protein	NA	J7KGZ1	Streptococcus_phage	81.9	4.4e-126
AXC16544.1|87816_88014_+	hypothetical protein	NA	J7KIX6	Streptococcus_phage	96.9	2.6e-27
AXC16545.1|88003_88480_+	RusA family crossover junction endodeoxyribonuclease	NA	J7KBT1	Streptococcus_phage	100.0	5.1e-61
AXC16546.1|88469_88817_+	hypothetical protein	NA	J7KK12	Streptococcus_phage	99.1	5.3e-60
AXC16547.1|88828_89125_+	DUF1599 domain-containing protein	NA	J7KDH9	Streptococcus_phage	100.0	1.1e-48
AXC16548.1|89263_89647_+	hypothetical protein	NA	J7KIZ4	Streptococcus_phage	66.7	2.9e-38
AXC16549.1|89643_89808_+	hypothetical protein	NA	NA	NA	NA	NA
AXC16550.1|89804_90074_+	hypothetical protein	NA	A7J287	Streptococcus_phage	70.8	3.7e-24
AXC16551.1|90076_90562_+	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	88.1	6.7e-85
AXC16552.1|90566_91058_+	hypothetical protein	NA	U4KJB3	Streptococcus_phage	44.5	5.7e-31
AXC16553.1|91061_91631_+	DUF1642 domain-containing protein	NA	A0A097PAV5	Streptococcus_pyogenes_phage	39.2	3.9e-23
AXC16554.1|91651_91951_+	hypothetical protein	NA	M1PFH6	Streptococcus_phage	45.4	1.3e-17
AXC16555.1|91968_92235_+	hypothetical protein	NA	NA	NA	NA	NA
AXC16556.1|92624_93059_+	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	95.1	6.5e-71
AXC16557.1|94271_94649_-	HicB family protein	NA	I3NLB2	Bifidobacterium_phage	40.5	2.0e-15
AXC16558.1|94700_94886_-	addiction module toxin, HicA family	NA	F0PIL1	Enterococcus_phage	61.3	3.5e-10
AXC16559.1|94993_95491_+|terminase	terminase small subunit	terminase	U6E976	Streptococcus_phage	63.6	3.0e-48
AXC16560.1|95477_96719_+|terminase	PBSX family phage terminase large subunit	terminase	O34057	Streptococcus_phage	76.9	1.1e-192
AXC16561.1|96731_98225_+|portal	phage portal protein	portal	C9W9H5	Streptococcus_virus	50.7	4.1e-133
AXC16562.1|98208_99180_+|head	phage head morphogenesis protein	head	U6E9F1	Streptococcus_phage	37.1	3.2e-54
AXC16563.1|99396_99975_+	DUF4355 domain-containing protein	NA	C9E2J3	Enterococcus_phage	35.6	5.5e-09
AXC16564.1|99984_100368_+|head	head decoration protein	head	NA	NA	NA	NA
AXC16565.1|100367_101420_+|capsid	minor capsid protein E	capsid	A0A286QR01	Streptococcus_phage	58.4	1.1e-108
AXC16566.1|101432_101687_+	hypothetical protein	NA	NA	NA	NA	NA
AXC16567.1|101702_102056_+	hypothetical protein	NA	A0A2H4J002	uncultured_Caudovirales_phage	53.0	4.6e-27
AXC16568.1|102052_102352_+	hypothetical protein	NA	A0A286QP96	Streptococcus_phage	37.1	3.5e-07
AXC16569.1|102344_102728_+	hypothetical protein	NA	W6LM73	Streptococcus_phage	43.7	2.8e-17
AXC16570.1|102724_103111_+	DUF3168 domain-containing protein	NA	W6LLG8	Streptococcus_phage	47.7	2.4e-29
AXC16571.1|103119_103605_+|tail	phage major tail protein, TP901-1 family	tail	L0P2Q8	Streptococcus_phage	58.1	1.4e-45
AXC16572.1|103720_104080_+	hypothetical protein	NA	O34069	Streptococcus_phage	47.9	9.2e-23
AXC18416.1|104181_104460_+	hypothetical protein	NA	A0A0S2MYH1	Enterococcus_phage	41.0	7.7e-09
AXC16573.1|104452_107101_+|tail	phage tail tape measure protein	tail	Q9G097	Lactococcus_phage	55.2	1.4e-107
AXC16574.1|107101_108664_+|tail	phage tail protein	tail	J7KH53	Streptococcus_phage	79.1	5.8e-239
AXC16575.1|108654_113622_+	CHAP domain-containing protein	NA	J7KBT9	Streptococcus_phage	64.0	0.0e+00
AXC16576.1|113622_115626_+	hypothetical protein	NA	J7KC14	Streptococcus_phage	76.8	1.3e-294
AXC16577.1|115637_116030_+	DUF1366 domain-containing protein	NA	J7KKA3	Streptococcus_phage	39.6	8.0e-12
AXC16578.1|116189_116492_+	hypothetical protein	NA	J7KH30	Streptococcus_phage	68.8	9.5e-29
AXC16579.1|116484_116712_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	97.3	1.7e-30
AXC16580.1|116837_118172_+	lysin	NA	Q8HA43	Streptococcus_phage	93.5	4.1e-249
AXC16581.1|118315_118567_-	hypothetical protein	NA	A3F666	Streptococcus_phage	96.3	2.4e-41
AXC16582.1|119003_119213_+	XRE family transcriptional regulator	NA	A3F668	Streptococcus_phage	84.1	8.8e-26
AXC16583.1|119335_119518_+	Paratox	NA	A3F673	Streptococcus_phage	71.7	1.9e-16
AXC16584.1|119730_120423_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AXC16585.1|120419_121172_+	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
AXC16586.1|121168_121744_+	N-acetylmuramoyl-L-alanine amidase	NA	H7BV84	unidentified_phage	31.4	4.2e-09
AXC18417.1|121886_122921_+	HrcA family transcriptional regulator	NA	NA	NA	NA	NA
AXC16587.1|122923_123496_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AXC16588.1|123676_125506_+	molecular chaperone DnaK	NA	A0A167RF67	Powai_lake_megavirus	46.7	1.5e-132
AXC16589.1|125794_126934_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	29.4	1.2e-23
AXC16590.1|127047_128295_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	49.7	2.4e-102
AXC16591.1|128365_129142_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AXC16592.1|129104_129863_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AXC16593.1|129872_130337_+	ECF transporter S component	NA	NA	NA	NA	NA
AXC16594.1|130333_130903_+	TIGR01440 family protein	NA	NA	NA	NA	NA
AXC16595.1|130939_131782_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AXC16596.1|131938_133222_+	trigger factor	NA	NA	NA	NA	NA
AXC16597.1|133410_133977_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
AXC16598.1|134249_135854_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	45.1	3.6e-135
AXC16599.1|135962_136889_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXC16600.1|137083_137530_+	dUTP diphosphatase	NA	A0A1P8BMQ4	Lactococcus_phage	46.5	5.7e-30
136943:136963	attR	TGGCGGAATTGGCAGACGCGC	NA	NA	NA	NA
AXC16601.1|137691_139056_+	DNA repair protein RadA	NA	NA	NA	NA	NA
AXC16602.1|139191_139689_+	carbonic anhydrase	NA	NA	NA	NA	NA
AXC16603.1|139842_141162_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	44.0	2.2e-101
AXC16604.1|141468_142635_-|transposase	IS30-like element ISSag9 family transposase	transposase	NA	NA	NA	NA
AXC16605.1|142920_144375_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 3
CP030845	Streptococcus agalactiae strain S73 chromosome, complete genome	2059915	603116	610670	2059915	integrase,transposase	Streptococcus_phage(50.0%)	11	596461:596476	613950:613965
596461:596476	attL	GAAAATAAATAAAATT	NA	NA	NA	NA
AXC17040.1|603116_604313_+	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	54.5	4.6e-103
AXC17041.1|604892_605240_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AXC18429.1|605384_605999_-|integrase	site-specific integrase	integrase	F8HGP4	Streptococcus_phage	60.7	9.2e-55
AXC17042.1|606001_606268_-|integrase	integrase	integrase	Q77YW7	Streptococcus_phage	65.2	9.2e-20
AXC17043.1|606267_606672_+	hypothetical protein	NA	NA	NA	NA	NA
AXC17044.1|606833_607034_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AXC17045.1|607058_607316_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	43.5	5.8e-11
AXC17046.1|607441_607651_+	hypothetical protein	NA	A0A0C5AEA5	Paenibacillus_phage	55.4	1.4e-15
AXC17047.1|607823_607985_-	NINE protein	NA	NA	NA	NA	NA
AXC17048.1|608726_610004_+	ABC transporter permease	NA	NA	NA	NA	NA
AXC17049.1|610013_610670_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	2.2e-22
613950:613965	attR	GAAAATAAATAAAATT	NA	NA	NA	NA
>prophage 4
CP030845	Streptococcus agalactiae strain S73 chromosome, complete genome	2059915	1488898	1499631	2059915		Streptococcus_phage(84.62%)	16	NA	NA
AXC17847.1|1488898_1489726_+	exodeoxyribonuclease	NA	M1PSC0	Streptococcus_phage	78.0	1.1e-124
AXC17848.1|1489766_1490123_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	72.6	5.2e-42
AXC17849.1|1490124_1490601_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.9	1.6e-38
AXC17850.1|1490656_1491838_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	75.3	9.1e-168
AXC17851.1|1491899_1492448_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	57.9	1.4e-54
AXC17852.1|1492516_1493608_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	78.0	3.9e-165
AXC17853.1|1493740_1494376_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AXC17854.1|1494419_1494524_-	hypothetical protein	NA	NA	NA	NA	NA
AXC17855.1|1494508_1494670_+	hypothetical protein	NA	NA	NA	NA	NA
AXC18461.1|1494645_1495509_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	70.4	3.1e-109
AXC17856.1|1495514_1495841_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	61.1	3.2e-30
AXC17857.1|1495871_1496735_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	50.0	2.5e-74
AXC17858.1|1496754_1497390_-	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	61.1	2.8e-67
AXC17859.1|1497478_1498138_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	56.5	8.0e-65
AXC17860.1|1498156_1498867_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	4.7e-18
AXC17861.1|1498866_1499631_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.8	3.4e-14
>prophage 5
CP030845	Streptococcus agalactiae strain S73 chromosome, complete genome	2059915	1989842	2004406	2059915	integrase	Streptococcus_phage(66.67%)	22	1987877:1987896	2001809:2001828
1987877:1987896	attL	AATTAAAGCATTTTGTTGTA	NA	NA	NA	NA
AXC18344.1|1989842_1990331_-	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	56.2	1.2e-46
AXC18345.1|1990415_1991021_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	46.8	7.0e-39
AXC18346.1|1991204_1991378_-	DUF2758 domain-containing protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	1.9e-10
AXC18347.1|1991637_1993140_-	DNA primase	NA	Q9AZI5	Lactococcus_phage	36.9	3.8e-62
AXC18348.1|1993159_1994017_-	hypothetical protein	NA	A0A1X9I6L2	Streptococcus_phage	71.7	3.7e-118
AXC18349.1|1994017_1994290_-	XRE family transcriptional regulator	NA	A0A1X9I5U9	Streptococcus_phage	69.8	2.5e-28
AXC18350.1|1994282_1994624_-	hypothetical protein	NA	NA	NA	NA	NA
AXC18351.1|1994620_1994983_-	hypothetical protein	NA	NA	NA	NA	NA
AXC18476.1|1994994_1995186_-	hypothetical protein	NA	NA	NA	NA	NA
AXC18352.1|1995309_1995642_-	hypothetical protein	NA	NA	NA	NA	NA
AXC18353.1|1995896_1996166_-	phage antirepressor protein	NA	NA	NA	NA	NA
AXC18354.1|1996165_1996786_-	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	41.8	2.7e-38
AXC18355.1|1996839_1997001_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXC18356.1|1997166_1997859_+	XRE family transcriptional regulator	NA	A0A0P0IV68	Lactobacillus_phage	49.2	4.3e-08
AXC18357.1|1997963_1998173_+	NINE protein	NA	NA	NA	NA	NA
AXC18358.1|1998668_1998854_+	hypothetical protein	NA	NA	NA	NA	NA
AXC18359.1|1998865_1999207_+	hypothetical protein	NA	A0A1S5SDB5	Streptococcus_phage	59.7	2.2e-13
AXC18360.1|1999233_2000199_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	51.1	7.1e-86
AXC18361.1|2000531_2001704_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	70.4	4.3e-154
AXC18362.1|2001810_2002422_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
2001809:2001828	attR	AATTAAAGCATTTTGTTGTA	NA	NA	NA	NA
AXC18363.1|2002751_2003039_-	hypothetical protein	NA	NA	NA	NA	NA
AXC18364.1|2003050_2004406_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	62.6	1.2e-152
>prophage 6
CP030845	Streptococcus agalactiae strain S73 chromosome, complete genome	2059915	2012726	2019930	2059915		Staphylococcus_phage(33.33%)	8	NA	NA
AXC18372.1|2012726_2013431_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J6C5	uncultured_Caudovirales_phage	56.6	3.2e-27
AXC18373.1|2013536_2014076_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	46.4	3.0e-17
AXC18374.1|2014291_2015086_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AXC18375.1|2015078_2015921_-	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	2.0e-15
AXC18376.1|2015896_2016736_-	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	1.0e-16
AXC18377.1|2016735_2017278_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AXC18378.1|2017400_2018684_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	23.6	1.6e-05
AXC18379.1|2018685_2019930_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	41.5	1.7e-87
