The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030209	Salmonella enterica strain SA20044414 chromosome, complete genome	4805225	672624	712391	4805225	integrase,capsid,portal,head,holin,plate,lysis,tRNA,terminase,tail	Salmonella_phage(58.14%)	51	670992:671051	702482:702582
670992:671051	attL	AACAAAAAAGCCACTCTTTAGAGTGGCTTAATTATATGATTTTAAAGCTAAAATTTGGTG	NA	NA	NA	NA
AXD51261.1|672624_673638_-|integrase	site-specific integrase	integrase	A0A218M4I3	Erwinia_phage	97.6	6.5e-191
AXD51262.1|673637_674213_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	57.6	3.4e-59
AXD51263.1|674342_674606_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	98.9	2.0e-43
AXD51264.1|674636_675146_+	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	98.2	1.1e-88
AXD51265.1|675153_675381_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	2.1e-36
AXD51266.1|675367_675568_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	98.5	2.3e-31
AXD51267.1|675637_675865_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	100.0	6.8e-32
AXD51268.1|675864_676089_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	100.0	6.5e-35
AXD51269.1|676085_676607_+	hypothetical protein	NA	Q6K1F4	Salmonella_virus	100.0	1.2e-92
AXD51270.1|676729_678949_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	94.4	0.0e+00
AXD51271.1|679066_679507_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	94.2	2.6e-67
AXD51272.1|679589_680321_+	hypothetical protein	NA	Q37850	Escherichia_phage	91.4	9.1e-126
AXD51273.1|680454_681252_+	hypothetical protein	NA	NA	NA	NA	NA
AXD51274.1|681306_681489_+	hypothetical protein	NA	NA	NA	NA	NA
AXD51275.1|681622_682669_-|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	98.3	1.4e-188
AXD51276.1|682668_684438_-	oxidoreductase	NA	S4TT96	Salmonella_phage	100.0	0.0e+00
AXD51277.1|684603_685458_+|capsid	capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	98.6	8.9e-157
AXD51278.1|685533_686601_+|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	89.5	2.3e-178
AXD51279.1|686604_687354_+|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	88.0	1.8e-113
AXD51280.1|687447_687954_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
AXD51281.1|687953_688157_+|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	97.0	8.8e-31
AXD51282.1|688160_688457_+|holin	holin	holin	S4TP56	Salmonella_phage	99.0	1.3e-46
AXD51283.1|688443_688941_+	lysozyme	NA	S4TUB1	Salmonella_phage	98.8	5.8e-92
AXD51284.1|688937_689351_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0M4R2N5	Salmonella_phage	97.1	9.9e-45
AXD51285.1|689322_689496_+|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	98.2	2.8e-25
AXD51286.1|689458_689926_+|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	99.4	7.2e-84
AXD51287.1|689918_690368_+	phage virion morphogenesis protein	NA	S4TP59	Salmonella_phage	99.3	4.2e-73
AXD51288.1|690436_691078_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	99.1	9.1e-114
AXD51289.1|691074_691422_+|plate	baseplate assembly protein	plate	S4TRW8	Salmonella_phage	100.0	2.5e-57
AXD51290.1|691428_692337_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	100.0	2.6e-162
AXD51291.1|692329_692860_+|tail	phage tail protein I	tail	S4TTA8	Salmonella_phage	100.0	9.2e-104
AXD51292.1|692870_694964_+|tail	phage tail protein	tail	A0A1B0VFW4	Salmonella_phage	95.8	1.3e-222
AXD51293.1|694933_695554_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	87.2	3.0e-98
AXD51294.1|695722_696910_+|tail	phage tail protein	tail	Q6K1H0	Salmonella_virus	99.2	3.8e-222
AXD51295.1|696925_697444_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
AXD51296.1|697506_697842_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
AXD51297.1|697838_697994_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
AXD51298.1|697986_700428_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	95.4	0.0e+00
AXD51299.1|700442_700928_+|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	100.0	1.0e-85
AXD51300.1|700924_702094_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	97.7	1.1e-210
AXD51301.1|702160_702379_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	98.6	9.5e-39
AXD51302.1|702737_703244_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
702482:702582	attR	AACAAAAAAGCCACTCTTTAGAGTGGCTTAATTATATGATTTTAAAGCTAAAATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
AXD51303.1|703367_705350_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AXD51304.1|705364_707107_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.5	8.1e-72
AXD51305.1|707342_707558_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXD51306.1|707785_708799_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.2e-109
AXD51307.1|708702_709041_-	hypothetical protein	NA	NA	NA	NA	NA
AXD51308.1|709048_709660_-	acyl-phosphate--glycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AXD51309.1|709766_710126_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AXD51310.1|710223_711045_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AXD51311.1|711149_712391_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	47.9	6.5e-92
>prophage 2
CP030209	Salmonella enterica strain SA20044414 chromosome, complete genome	4805225	1458117	1495621	4805225	protease,portal,head,holin,lysis,coat,terminase,tail	Enterobacteria_phage(44.44%)	57	NA	NA
AXD51981.1|1458117_1459056_+|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
AXD51982.1|1459077_1459308_-	hypothetical protein	NA	C6ZR23	Salmonella_phage	70.0	7.5e-10
AXD51983.1|1459317_1459521_-	hypothetical protein	NA	C6ZR24	Salmonella_phage	97.0	2.7e-32
AXD51984.1|1459831_1460098_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	97.7	3.7e-45
AXD51985.1|1460174_1460912_-	DUF551 domain-containing protein	NA	H6WRY2	Salmonella_phage	50.7	1.1e-59
AXD51986.1|1460914_1461388_-	SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	2.8e-67
AXD51987.1|1461870_1462230_-	Eaf protein	NA	T1SA95	Salmonella_phage	91.6	2.5e-60
AXD51988.1|1462774_1462945_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AXD51989.1|1462961_1463276_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	95.2	1.1e-48
AXD51990.1|1463287_1463770_-	hypothetical protein	NA	K7P6T5	Enterobacteria_phage	97.5	5.5e-79
AXD51991.1|1463753_1464656_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	87.8	2.6e-146
AXD51992.1|1464652_1464961_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	98.0	7.3e-53
AXD51993.1|1465045_1465198_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	68.0	1.1e-12
AXD51994.1|1465182_1465317_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	70.5	1.4e-08
AXD51995.1|1465649_1465928_-	hypothetical protein	NA	C6ZR42	Salmonella_phage	100.0	1.3e-45
AXD51996.1|1465961_1466621_-	pentapeptide repeat-containing protein	NA	I6S1T3	Salmonella_phage	85.3	5.2e-48
AXD51997.1|1466704_1466899_-	restriction endonuclease	NA	E7C9Q6	Salmonella_phage	98.4	5.5e-30
AXD55124.1|1466830_1467016_+	hypothetical protein	NA	NA	NA	NA	NA
AXD51998.1|1467238_1467574_-	hypothetical protein	NA	Q5G8T5	Enterobacteria_phage	86.0	3.2e-46
AXD55125.1|1468144_1468807_-	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	100.0	1.7e-126
AXD51999.1|1468925_1469141_+	XRE family transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
AXD52000.1|1469251_1469533_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
AXD52001.1|1469567_1469714_+	DUF2740 domain-containing protein	NA	A0A0M4S617	Salmonella_phage	95.8	9.5e-19
AXD52002.1|1469706_1470606_+	DNA replication protein	NA	E7C9R4	Salmonella_phage	99.0	5.1e-155
AXD52003.1|1470580_1472032_+	helicase DnaB	NA	Q7Y2K5	Escherichia_phage	99.4	1.1e-276
AXD52004.1|1472107_1472314_+	hypothetical protein	NA	K7PMD7	Enterobacterial_phage	97.1	1.2e-30
AXD52005.1|1472331_1472649_+	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	97.1	8.1e-55
AXD52006.1|1472651_1472837_+	hypothetical protein	NA	NA	NA	NA	NA
AXD52007.1|1472848_1473259_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	100.0	3.2e-72
AXD52008.1|1473255_1473432_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
AXD52009.1|1473434_1473782_+	DUF2591 domain-containing protein	NA	A5VW89	Enterobacteria_phage	98.3	4.4e-62
AXD52010.1|1473774_1473951_+	protein ninF	NA	Q76H71	Enterobacteria_phage	98.3	1.5e-26
AXD52011.1|1473943_1474555_+	recombination protein NinG	NA	A0A2D1GLP2	Escherichia_phage	99.5	1.0e-98
AXD52012.1|1474551_1474758_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
AXD52013.1|1474735_1475401_+	serine/threonine protein phosphatase	NA	K7P7K6	Enterobacteria_phage	99.5	1.0e-131
AXD52014.1|1475397_1476021_+	antitermination protein	NA	A0A088CQ66	Enterobacteria_phage	99.0	4.4e-113
AXD55126.1|1476445_1476784_+	Fis family transcriptional regulator	NA	A0A1W6DXT8	Salmonella_phage	49.1	1.5e-22
AXD52015.1|1477371_1477695_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	96.3	3.6e-50
AXD52016.1|1477678_1478116_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.2	4.1e-73
AXD52017.1|1478112_1478574_+|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	79.3	4.5e-54
AXD52018.1|1478723_1479329_+	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	99.0	4.4e-110
AXD52019.1|1479556_1479799_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AXD52020.1|1479800_1479980_+	hypothetical protein	NA	A0A2H4A350	Salmonella_phage	96.6	3.2e-24
AXD55127.1|1480003_1480426_+	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	99.3	1.6e-74
AXD52021.1|1480422_1481838_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.4	3.7e-277
AXD52022.1|1481839_1484038_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	96.9	0.0e+00
AXD52023.1|1484128_1485022_+	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	97.6	2.0e-127
AXD52024.1|1485040_1486294_+|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	99.3	8.3e-236
AXD52025.1|1486335_1486524_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
AXD52026.1|1486504_1486966_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
AXD52027.1|1486975_1488394_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	96.8	1.2e-270
AXD52028.1|1488397_1489099_+|tail	phage tail protein	tail	C6ZR14	Salmonella_phage	94.4	4.7e-71
AXD52029.1|1489098_1489554_+	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	99.3	5.2e-87
AXD52030.1|1489556_1490246_+	DNA transfer protein	NA	B9UDK9	Salmonella_phage	97.2	8.4e-89
AXD55128.1|1490288_1491611_+	DNA transfer protein	NA	A0A220NR03	Salmonella_phage	94.5	6.7e-228
AXD52031.1|1491610_1493608_+	lytic transglycosylase domain-containing protein	NA	Q76H13	Enterobacteria_phage	86.6	0.0e+00
AXD52032.1|1493764_1495621_+|tail	phage tail protein	tail	I6S5Y0	Salmonella_phage	83.6	7.1e-58
>prophage 3
CP030209	Salmonella enterica strain SA20044414 chromosome, complete genome	4805225	1739982	1749153	4805225	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AXD52256.1|1739982_1740930_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AXD52257.1|1740913_1741645_+	ABC transporter permease	NA	NA	NA	NA	NA
AXD52258.1|1741625_1741733_-	hypothetical protein	NA	NA	NA	NA	NA
AXD52259.1|1741792_1742524_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AXD52260.1|1742746_1744432_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AXD52261.1|1744428_1745148_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXD52262.1|1745194_1745662_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	89.7	2.5e-73
AXD52263.1|1745718_1746249_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AXD52264.1|1746420_1746879_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AXD52265.1|1747119_1749153_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
CP030209	Salmonella enterica strain SA20044414 chromosome, complete genome	4805225	1948117	1959433	4805225	integrase	Burkholderia_phage(25.0%)	12	1938853:1938866	1956409:1956422
1938853:1938866	attL	TTATGTGTTTTGAT	NA	NA	NA	NA
AXD52442.1|1948117_1949299_+	recombinase RecF	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
AXD52443.1|1949299_1950046_+	HNH endonuclease	NA	NA	NA	NA	NA
AXD52444.1|1950147_1951404_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.8	4.4e-80
AXD52445.1|1951884_1952046_+	hypothetical protein	NA	NA	NA	NA	NA
AXD52446.1|1952172_1952592_+	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AXD52447.1|1952594_1953863_+	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.9	1.2e-226
AXD52448.1|1954308_1954521_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	68.6	2.5e-20
AXD55142.1|1954531_1954720_+	cold-shock protein	NA	NA	NA	NA	NA
AXD52449.1|1954980_1956192_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	55.5	2.4e-107
AXD52450.1|1956842_1957154_+	hypothetical protein	NA	NA	NA	NA	NA
1956409:1956422	attR	TTATGTGTTTTGAT	NA	NA	NA	NA
AXD52451.1|1957233_1957929_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	8.1e-07
AXD52452.1|1958002_1959433_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 1
CP030210	Salmonella enterica strain SA20044414 plasmid pSA20044414.1, complete sequence	92624	35171	50063	92624		Bacillus_phage(16.67%)	17	NA	NA
AXD55290.1|35171_35852_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.5	1.9e-32
AXD55291.1|35844_37323_+	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	1.8e-27
AXD55292.1|37559_37991_+	copper-binding protein	NA	NA	NA	NA	NA
AXD55293.1|38139_38490_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	55.2	2.4e-20
AXD55294.1|38661_40488_-	OLD family endonuclease	NA	E5E3R2	Burkholderia_phage	23.2	1.5e-12
AXD55295.1|41095_42301_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
AXD55296.1|42297_43269_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	9.6e-115
AXD55297.1|43413_44685_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.2	2.7e-157
AXD55298.1|44684_45107_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
AXD55299.1|45286_45958_-	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.5e-79
AXD55300.1|46309_46987_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
AXD55301.1|46986_47208_+	hypothetical protein	NA	NA	NA	NA	NA
AXD55302.1|47218_47638_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AXD55303.1|47691_48471_+	hypothetical protein	NA	NA	NA	NA	NA
AXD55304.1|48875_49382_+	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	29.8	3.7e-09
AXD55305.1|49424_49616_+	hypothetical protein	NA	NA	NA	NA	NA
AXD55306.1|49802_50063_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	2.0e-11
