The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030223	Salmonella enterica strain SA20083039 chromosome, complete genome	4688830	1116847	1187419	4688830	holin,plate,lysis,transposase,head,terminase,integrase,capsid,tRNA,tail,portal	Salmonella_phage(50.94%)	74	1122202:1122216	1194735:1194749
AXD75888.1|1116847_1117959_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	6.4e-06
AXD79147.1|1118361_1119591_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	90.7	3.9e-214
AXD79148.1|1120190_1121354_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXD75889.1|1121361_1123542_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
1122202:1122216	attL	CCAGCGCGCCAGCAC	NA	NA	NA	NA
AXD75890.1|1123538_1124948_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AXD75891.1|1125012_1136487_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AXD79149.1|1137100_1137583_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AXD75892.1|1137732_1138209_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AXD75893.1|1138198_1138489_+	RnfH family protein	NA	NA	NA	NA	NA
AXD75894.1|1138499_1138709_+	hypothetical protein	NA	NA	NA	NA	NA
AXD75895.1|1138653_1138992_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AXD75896.1|1139140_1140802_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AXD75897.1|1140887_1141766_-	NAD(+) kinase	NA	NA	NA	NA	NA
AXD79150.1|1141697_1141892_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AXD75898.1|1141888_1142479_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AXD75899.1|1142513_1143119_-	cytoplasmic protein	NA	NA	NA	NA	NA
AXD75900.1|1143248_1144493_-	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AXD79152.1|1146040_1146289_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AXD79151.1|1146307_1146856_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AXD75901.1|1146900_1147668_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AXD75902.1|1147708_1148056_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AXD75903.1|1148200_1148419_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	100.0	1.2e-38
AXD75904.1|1148494_1149664_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	95.9	2.6e-207
AXD75905.1|1149660_1150146_-|tail	phage tail protein	tail	O80317	Escherichia_phage	93.8	1.7e-80
AXD75906.1|1150159_1152601_-|tail	phage tail tape measure protein	tail	A0A218M4J5	Erwinia_phage	85.5	1.5e-297
AXD75907.1|1152593_1152749_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
AXD75908.1|1152745_1153081_-|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	97.3	2.6e-51
AXD75909.1|1153143_1153662_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
AXD75910.1|1153677_1154856_-|tail	phage tail protein	tail	S4TRX2	Salmonella_phage	99.5	2.9e-222
AXD75911.1|1154990_1155539_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	100.0	9.9e-101
AXD75912.1|1155551_1157528_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	99.4	0.0e+00
AXD75913.1|1157538_1158069_-|tail	phage tail protein I	tail	Q6K1H3	Salmonella_virus	97.2	1.5e-101
AXD75914.1|1158061_1158970_-|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	98.3	7.7e-159
AXD75915.1|1159084_1159489_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
AXD75916.1|1159485_1159833_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	1.3e-61
AXD75917.1|1159881_1161420_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.1	1.1e-279
AXD75918.1|1161453_1161786_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	96.4	1.2e-53
AXD75919.1|1161782_1162424_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	96.7	5.5e-111
AXD75920.1|1162492_1162942_-	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	94.6	7.4e-70
AXD75921.1|1162934_1163402_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
AXD75922.1|1163364_1163538_-|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	98.2	2.8e-25
AXD75923.1|1163509_1163923_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0M4R2N5	Salmonella_phage	97.8	1.2e-45
AXD75924.1|1163919_1164417_-	lysozyme	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
AXD75925.1|1164403_1164700_-|holin	holin	holin	Q6K1I2	Salmonella_virus	100.0	5.8e-47
AXD75926.1|1164703_1164907_-|tail	phage tail protein	tail	A0A0M3ULF4	Salmonella_phage	100.0	3.6e-32
AXD75927.1|1164906_1165413_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	98.8	2.9e-91
AXD75928.1|1165506_1166256_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	98.4	1.5e-128
AXD75929.1|1166259_1167327_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
AXD75930.1|1167403_1168258_-|capsid	capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	94.7	3.6e-150
AXD75931.1|1168423_1170196_+	oxidoreductase	NA	S4TT96	Salmonella_phage	99.8	0.0e+00
AXD75932.1|1170192_1170939_+	hypothetical protein	NA	Q6K1I9	Salmonella_virus	96.8	6.6e-140
AXD75933.1|1170935_1171958_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	99.7	1.5e-198
AXD75934.1|1172093_1172276_-	hypothetical protein	NA	NA	NA	NA	NA
AXD75935.1|1172480_1172675_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	79.7	2.0e-19
AXD75936.1|1172808_1173018_-	hypothetical protein	NA	Q6K1F0	Salmonella_virus	97.1	2.6e-33
AXD75937.1|1173213_1173447_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	98.7	8.0e-36
AXD75938.1|1173450_1173633_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
AXD75939.1|1173750_1175973_-	replication endonuclease	NA	A0A0M3ULG0	Salmonella_phage	95.9	0.0e+00
AXD75940.1|1175969_1176800_-	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	97.1	7.1e-159
AXD75941.1|1176803_1177082_-	hypothetical protein	NA	A0A0M4R2Q0	Salmonella_phage	87.0	2.0e-41
AXD75942.1|1177082_1177304_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	98.6	7.1e-34
AXD75943.1|1177303_1177531_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	97.3	9.9e-31
AXD75944.1|1177600_1177801_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	97.0	3.0e-31
AXD75945.1|1177787_1178015_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	1.2e-36
AXD75946.1|1178022_1178532_-	hypothetical protein	NA	Q6K1F8	Salmonella_virus	98.8	9.5e-90
AXD75947.1|1178582_1178936_-	Cro/Cl family transcriptional regulator	NA	Q6K1F9	Salmonella_virus	99.1	1.5e-57
AXD75948.1|1179049_1179892_+	phage repressor protein CI	NA	A0A0M4RE65	Salmonella_phage	70.4	1.7e-112
AXD75949.1|1179891_1180455_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AXD75950.1|1180476_1181526_+|integrase	integrase	integrase	A0A0M4S6G4	Salmonella_phage	90.8	3.7e-189
AXD75951.1|1181778_1182999_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
AXD75952.1|1182991_1183510_-	YfiR family protein	NA	NA	NA	NA	NA
AXD75953.1|1183949_1185020_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	3.1e-90
AXD75954.1|1185029_1186151_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AXD75955.1|1186163_1187419_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
1194735:1194749	attR	GTGCTGGCGCGCTGG	NA	NA	NA	NA
>prophage 2
CP030223	Salmonella enterica strain SA20083039 chromosome, complete genome	4688830	1679808	1688980	4688830	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AXD76387.1|1679808_1680756_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
AXD76388.1|1680739_1681471_+	ABC transporter permease	NA	NA	NA	NA	NA
AXD76389.1|1681451_1681559_-	hypothetical protein	NA	NA	NA	NA	NA
AXD76390.1|1681618_1682350_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AXD76391.1|1682572_1684258_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AXD76392.1|1684254_1684974_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXD76393.1|1685020_1685488_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AXD76394.1|1685544_1686075_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AXD76395.1|1686246_1686705_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
AXD76396.1|1686946_1688980_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
CP030223	Salmonella enterica strain SA20083039 chromosome, complete genome	4688830	2155994	2162655	4688830		Salmonella_phage(33.33%)	9	NA	NA
AXD76831.1|2155994_2156801_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
AXD76832.1|2156802_2157795_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
AXD76833.1|2157794_2158685_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AXD76834.1|2159507_2160230_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.9	4.3e-35
AXD76835.1|2160699_2160882_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	77.6	1.0e-22
AXD76836.1|2161131_2161272_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	77.1	6.5e-09
AXD76837.1|2161310_2161610_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	54.3	3.2e-13
AXD76838.1|2161536_2161962_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
AXD76839.1|2162340_2162655_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	86.1	4.3e-40
>prophage 4
CP030223	Salmonella enterica strain SA20083039 chromosome, complete genome	4688830	2638822	2643241	4688830		Escherichia_phage(50.0%)	6	NA	NA
AXD77298.1|2638822_2639062_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AXD79210.1|2639940_2640750_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AXD77299.1|2640822_2641200_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AXD77300.1|2641347_2641890_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AXD77301.1|2642082_2642811_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.6e-61
AXD77302.1|2642827_2643241_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	4.2e-19
>prophage 5
CP030223	Salmonella enterica strain SA20083039 chromosome, complete genome	4688830	2804461	2849640	4688830	protease,lysis,transposase,terminase,head,integrase,tail	Salmonella_phage(43.14%)	65	2806021:2806080	2848482:2848559
AXD77460.1|2804461_2805572_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	6.4e-06
2806021:2806080	attL	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTC	NA	NA	NA	NA
AXD77461.1|2806289_2806559_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	78.2	3.6e-32
AXD79217.1|2806838_2807258_+	hypothetical protein	NA	NA	NA	NA	NA
AXD77462.1|2808120_2808513_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	8.5e-14
AXD77463.1|2808622_2809231_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	44.7	1.1e-31
AXD77464.1|2809293_2809479_-	hypothetical protein	NA	NA	NA	NA	NA
AXD77465.1|2809727_2810246_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
AXD77466.1|2810260_2811793_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	66.2	1.4e-128
AXD77467.1|2811792_2812473_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
AXD77468.1|2812469_2813669_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	96.7	5.5e-213
AXD77469.1|2813669_2814023_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
AXD77470.1|2814022_2814775_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
AXD77471.1|2814893_2815349_+	hypothetical protein	NA	NA	NA	NA	NA
AXD77472.1|2815432_2815765_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
AXD77473.1|2815761_2816829_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	91.5	2.0e-174
AXD77474.1|2816831_2817134_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
AXD77475.1|2817133_2817709_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	99.5	9.1e-97
AXD77476.1|2817708_2819718_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
AXD79218.1|2819707_2819884_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	72.9	4.7e-12
AXD77477.1|2819895_2820348_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
AXD77478.1|2820351_2820792_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	73.3	2.5e-54
AXD77479.1|2820803_2821949_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.8	5.9e-164
AXD77480.1|2821952_2822498_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	50.8	5.7e-48
AXD77481.1|2822490_2822895_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	69.2	4.1e-43
AXD77482.1|2822894_2823404_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	40.7	1.1e-21
AXD77483.1|2823400_2823811_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	57.4	2.5e-32
AXD77484.1|2823779_2824148_-	hypothetical protein	NA	NA	NA	NA	NA
AXD77485.1|2824197_2825145_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	55.9	1.2e-98
AXD77486.1|2825156_2825660_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	47.0	5.2e-32
AXD77487.1|2825671_2826949_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	42.8	1.6e-77
AXD77488.1|2827000_2827534_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	57.5	1.9e-48
AXD77489.1|2827604_2829074_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	55.7	1.1e-157
AXD77490.1|2829113_2830532_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.0	6.8e-186
AXD77491.1|2830497_2831250_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	55.2	2.6e-11
AXD79219.1|2831313_2831502_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
AXD77492.1|2831814_2832282_-|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	80.6	2.5e-60
AXD77493.1|2832278_2833190_-	site-specific DNA-methyltransferase	NA	A0A088FRS2	Escherichia_phage	53.0	3.2e-88
AXD77494.1|2833186_2833675_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	4.6e-57
AXD79220.1|2833652_2833955_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXD77495.1|2834157_2834346_-	hypothetical protein	NA	NA	NA	NA	NA
AXD77496.1|2834738_2835317_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
AXD77497.1|2835313_2835607_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
AXD77498.1|2835603_2836200_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
AXD77499.1|2836268_2836460_-	hypothetical protein	NA	NA	NA	NA	NA
AXD77500.1|2836643_2836982_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
AXD77501.1|2836981_2837152_-	methyltransferase	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
AXD77502.1|2837148_2837751_-	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
AXD77503.1|2837743_2837992_-	hypothetical protein	NA	NA	NA	NA	NA
AXD77504.1|2837995_2838676_-	hypothetical protein	NA	NA	NA	NA	NA
AXD77505.1|2838713_2840102_-	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
AXD77506.1|2840098_2841079_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
AXD77507.1|2841081_2841306_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
AXD77508.1|2841328_2841775_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
AXD79221.1|2841709_2841925_+	hypothetical protein	NA	NA	NA	NA	NA
AXD77509.1|2841839_2842073_-	XRE family transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	48.6	6.2e-12
AXD77510.1|2842171_2842636_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	2.7e-35
AXD77511.1|2843320_2843644_+	hypothetical protein	NA	NA	NA	NA	NA
AXD77512.1|2843651_2843897_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
AXD77513.1|2843926_2846200_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.9	3.6e-104
AXD77514.1|2846196_2846751_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
AXD77515.1|2846753_2846936_+	hypothetical protein	NA	NA	NA	NA	NA
AXD77516.1|2846985_2847183_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	58.5	8.3e-10
AXD77517.1|2847148_2847373_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AXD77518.1|2847373_2848393_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
AXD77519.1|2848980_2849640_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
2848482:2848559	attR	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCGG	NA	NA	NA	NA
>prophage 1
CP030224	Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence	247246	0	59835	247246	transposase	Escherichia_phage(26.32%)	55	NA	NA
AXD79295.1|1202_1688_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79296.1|1775_2093_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79297.1|2114_2513_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79298.1|2831_3059_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79299.1|3239_4163_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79300.1|4198_4522_-	hypothetical protein	NA	NA	NA	NA	NA
AXD79301.1|4804_5023_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79302.1|5283_5520_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79303.1|6080_7694_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	37.0	2.2e-07
AXD79304.1|7809_8109_-	hypothetical protein	NA	NA	NA	NA	NA
AXD79305.1|8523_8730_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79306.1|8830_9082_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79307.1|9118_9616_-	hypothetical protein	NA	NA	NA	NA	NA
AXD79308.1|9698_10403_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXD79554.1|10466_10586_-	ABC transporter	NA	NA	NA	NA	NA
AXD79309.1|10785_11949_+	1,3-propanediol dehydrogenase	NA	NA	NA	NA	NA
AXD79310.1|12220_12925_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXD79311.1|13284_16251_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
AXD79312.1|16329_17334_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AXD79313.1|17693_18215_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXD79314.1|18264_18690_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.1e-50
AXD79315.1|18702_19992_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.9	5.1e-172
AXD79316.1|20037_21789_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AXD79317.1|21806_22169_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AXD79318.1|22216_22570_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	49.1	1.5e-22
AXD79319.1|22690_23182_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	37.4	1.6e-22
AXD79320.1|23396_24320_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	8.1e-172
AXD79321.1|24727_26155_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AXD79322.1|26197_27619_-	glutamine synthetase	NA	NA	NA	NA	NA
AXD79323.1|28027_29053_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXD79555.1|29392_30316_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	1.6e-175
AXD79324.1|32012_34097_-	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	28.4	8.8e-33
AXD79556.1|34123_34753_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
AXD79325.1|34791_36495_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AXD79326.1|36699_36795_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AXD79327.1|37045_39007_+	DUF4118 domain-containing protein	NA	A0A2K9L0Z8	Tupanvirus	27.5	6.9e-11
AXD79328.1|38999_39722_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXD79329.1|39868_40894_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXD79557.1|41233_42157_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	7.1e-176
AXD79330.1|42475_43501_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXD79331.1|43602_44043_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AXD79332.1|44088_44568_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	51.2	6.1e-38
AXD79333.1|44572_44944_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXD79334.1|48037_48742_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXD79335.1|51549_52572_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXD79336.1|52672_52945_-	hypothetical protein	NA	NA	NA	NA	NA
AXD79337.1|52928_53432_-	hypothetical protein	NA	NA	NA	NA	NA
AXD79558.1|53685_54102_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.7	1.0e-36
AXD79338.1|54101_55367_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	60.6	9.8e-144
AXD79339.1|55516_56407_+	DNA replication protein	NA	NA	NA	NA	NA
AXD79340.1|56521_57100_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79341.1|57388_57646_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	8.3e-18
AXD79342.1|57816_58308_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXD79559.1|58393_58885_-	hypothetical protein	NA	NA	NA	NA	NA
AXD79343.1|59433_59835_+	DNA-binding protein	NA	Q1MVE8	Enterobacteria_phage	69.9	3.5e-47
>prophage 2
CP030224	Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence	247246	63391	64462	247246		unidentified_phage(100.0%)	1	NA	NA
AXD79350.1|63391_64462_+	phosphohydrolase	NA	H7BVI4	unidentified_phage	28.4	6.5e-40
>prophage 3
CP030224	Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence	247246	74385	84647	247246	transposase	Salmonella_phage(50.0%)	12	NA	NA
AXD79366.1|74385_75543_+	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	23.5	1.2e-15
AXD79367.1|75693_76515_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	48.9	3.4e-65
AXD79368.1|76511_76742_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79369.1|76728_77712_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	46.5	1.1e-73
AXD79370.1|77723_78602_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79563.1|78715_79201_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79371.1|79219_79648_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	75.7	5.8e-56
AXD79372.1|79745_80228_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79564.1|80337_80658_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79373.1|80709_81294_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79374.1|81485_83195_+	DUF4942 domain-containing protein	NA	A0A059VA49	Pseudomonas_phage	31.0	3.9e-63
AXD79375.1|83666_84647_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 4
CP030224	Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence	247246	104639	111131	247246	transposase	Acanthocystis_turfacea_Chlorella_virus(33.33%)	10	NA	NA
AXD79396.1|104639_105443_+	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.6e-14
AXD79397.1|105494_105824_-	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
AXD79565.1|105858_106263_+	FCD domain-containing protein	NA	NA	NA	NA	NA
AXD79398.1|106289_106676_-	plasmid stability protein	NA	NA	NA	NA	NA
AXD79566.1|106689_107652_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	41.1	9.6e-59
AXD79399.1|108084_108315_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79400.1|108515_108830_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79567.1|109116_109392_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79401.1|109405_109831_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79402.1|109983_111131_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.1e-146
>prophage 5
CP030224	Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence	247246	115688	116799	247246	transposase	Leptospira_phage(100.0%)	1	NA	NA
AXD79408.1|115688_116799_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.2	7.0e-45
>prophage 6
CP030224	Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence	247246	121057	127641	247246		Bacillus_phage(33.33%)	7	NA	NA
AXD79569.1|121057_122137_+	topoisomerase	NA	A0A1P8CWV0	Bacillus_phage	23.8	9.0e-05
AXD79414.1|122369_123698_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79415.1|124239_124449_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79570.1|124484_125039_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	32.7	2.5e-19
AXD79416.1|125318_125654_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79417.1|125702_125990_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AXD79418.1|126165_127641_+	helicase	NA	A0A1S5R1M3	Pseudomonas_phage	32.6	6.0e-44
>prophage 7
CP030224	Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence	247246	152349	156961	247246		Cronobacter_phage(33.33%)	4	NA	NA
AXD79442.1|152349_153906_+	DNA recombinase	NA	F1C5B8	Cronobacter_phage	36.4	8.1e-31
AXD79443.1|153963_155073_+	DNA recombinase	NA	A8HP48	Thalassomonas_phage	30.1	7.6e-07
AXD79444.1|155444_155822_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79445.1|155881_156961_+	AAA family ATPase	NA	L7TKP0	Rhizobium_phage	36.4	3.2e-26
>prophage 8
CP030224	Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence	247246	160777	161888	247246	transposase	Leptospira_phage(100.0%)	1	NA	NA
AXD79448.1|160777_161888_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.2	7.0e-45
>prophage 9
CP030224	Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence	247246	187288	198406	247246	transposase	Stx2-converting_phage(42.86%)	18	NA	NA
AXD79478.1|187288_187882_+	hypothetical protein	NA	J9Q753	Salmonella_phage	34.5	1.4e-07
AXD79479.1|187974_188241_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79480.1|188349_188808_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79481.1|188843_189320_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79482.1|189394_189670_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79483.1|189784_190057_+	hypothetical protein	NA	A0A192YCJ5	Morganella_phage	37.2	1.5e-09
AXD79573.1|190115_190448_-	hypothetical protein	NA	NA	NA	NA	NA
AXD79484.1|190529_190823_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79485.1|190917_192990_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	24.4	1.7e-44
AXD79486.1|193010_193331_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79487.1|193418_193841_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79488.1|194113_194509_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79489.1|194690_194882_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79490.1|195012_195708_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79491.1|195730_195928_+	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	48.4	2.6e-11
AXD79492.1|196070_196475_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
AXD79493.1|196471_196819_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	1.3e-61
AXD79494.1|196867_198406_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.1	1.1e-279
>prophage 10
CP030224	Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence	247246	203076	203694	247246		Escherichia_phage(100.0%)	1	NA	NA
AXD79501.1|203076_203694_+	hypothetical protein	NA	A0A076G6Q2	Escherichia_phage	53.4	4.1e-63
>prophage 11
CP030224	Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence	247246	212890	213733	247246		Salmonella_phage(100.0%)	1	NA	NA
AXD79516.1|212890_213733_+	HNH endonuclease	NA	G0X580	Salmonella_phage	39.5	1.8e-16
>prophage 12
CP030224	Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence	247246	217612	227052	247246		Escherichia_phage(50.0%)	11	NA	NA
AXD79520.1|217612_218617_+	peptide transporter	NA	A0A1B0V750	Salmonella_phage	27.2	3.0e-18
AXD79521.1|218740_219142_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79522.1|219113_220814_+	AAA family ATPase	NA	A0A172JHZ0	Bacillus_phage	36.7	3.5e-96
AXD79523.1|220951_221176_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79524.1|221455_221773_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79525.1|221774_222524_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79526.1|222544_223231_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79527.1|223389_224565_+	hypothetical protein	NA	A0A088FQX6	Escherichia_phage	31.3	6.5e-17
AXD79528.1|224738_225260_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79529.1|225256_225625_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79530.1|225633_227052_+	replicative DNA helicase	NA	O80281	Escherichia_phage	73.6	4.3e-188
>prophage 13
CP030224	Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence	247246	232080	233920	247246		Burkholderia_virus(50.0%)	3	NA	NA
AXD79538.1|232080_232905_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	61.1	1.9e-18
AXD79539.1|232966_233626_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79540.1|233674_233920_+	hypothetical protein	NA	S4TRP7	Salmonella_phage	44.4	2.8e-07
>prophage 14
CP030224	Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence	247246	237518	245389	247246	transposase	Salmonella_phage(50.0%)	11	NA	NA
AXD79542.1|237518_238774_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.3	2.6e-27
AXD79543.1|238827_239022_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79544.1|239037_239361_-	hypothetical protein	NA	NA	NA	NA	NA
AXD79545.1|239452_239644_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXD79546.1|239787_240312_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79547.1|240383_240929_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79548.1|241065_241368_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79549.1|241479_241905_+	hypothetical protein	NA	A0A0K1YBA5	Cronobacter_phage	42.8	1.6e-26
AXD79550.1|242058_242778_+	HNH endonuclease	NA	G0X580	Salmonella_phage	39.5	2.2e-07
AXD79551.1|243982_244252_+	hypothetical protein	NA	NA	NA	NA	NA
AXD79552.1|244306_245389_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	56.5	1.1e-79
