The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024902	Burkholderia pyrrocinia strain mHSR5 chromosome mHSR5_A, complete sequence	3619008	419008	480244	3619008	protease,plate,transposase	uncultured_Caudovirales_phage(42.86%)	45	NA	NA
AXF19411.1|419008_419530_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.0	9.6e-21
AXF19412.1|419704_420001_+	hypothetical protein	NA	NA	NA	NA	NA
AXF19413.1|420465_421494_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	43.5	3.1e-71
AXF19414.1|421490_422264_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	57.6	7.2e-81
AXF19415.1|423151_424648_+	hypothetical protein	NA	NA	NA	NA	NA
AXF19416.1|424712_426542_+	hypothetical protein	NA	NA	NA	NA	NA
AXF19417.1|427339_427795_-	hypothetical protein	NA	NA	NA	NA	NA
AXF19418.1|427782_428073_-	hypothetical protein	NA	NA	NA	NA	NA
AXF19419.1|428600_429176_-	hypothetical protein	NA	NA	NA	NA	NA
AXF19420.1|430797_431085_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXF19421.1|434359_435367_+	hypothetical protein	NA	NA	NA	NA	NA
AXF19422.1|435449_437285_-	hypothetical protein	NA	NA	NA	NA	NA
AXF19423.1|437745_439944_+	hypothetical protein	NA	NA	NA	NA	NA
AXF19424.1|441153_443979_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.7	5.2e-52
AXF19425.1|443975_445577_+	hypothetical protein	NA	NA	NA	NA	NA
AXF19426.1|445592_446603_+	hypothetical protein	NA	NA	NA	NA	NA
AXF19427.1|446932_447685_-	histidine biosynthesis protein	NA	NA	NA	NA	NA
AXF19428.1|448084_450580_-	helicase SNF2	NA	NA	NA	NA	NA
AXF19429.1|450576_452265_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	31.8	1.4e-41
AXF19430.1|452261_452465_-	hypothetical protein	NA	NA	NA	NA	NA
AXF19431.1|452796_454410_+	hypothetical protein	NA	NA	NA	NA	NA
AXF19432.1|455125_455353_-	hypothetical protein	NA	NA	NA	NA	NA
AXF19433.1|455582_455951_-	hypothetical protein	NA	NA	NA	NA	NA
AXF22156.1|456694_456898_+	hypothetical protein	NA	NA	NA	NA	NA
AXF19434.1|456957_457758_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXF19435.1|458128_461308_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.5	1.6e-57
AXF19436.1|461365_466036_+	sugar-binding protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.4	1.3e-44
AXF19437.1|466243_466570_-	hypothetical protein	NA	NA	NA	NA	NA
AXF19438.1|467009_467276_-	hypothetical protein	NA	NA	NA	NA	NA
AXF19439.1|467578_467896_+	hypothetical protein	NA	NA	NA	NA	NA
AXF19440.1|467977_468199_+	hypothetical protein	NA	NA	NA	NA	NA
AXF19441.1|468332_468914_+	hypothetical protein	NA	NA	NA	NA	NA
AXF19442.1|468926_469331_+	histidine kinase	NA	NA	NA	NA	NA
AXF19443.1|469373_469829_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AXF19444.1|469812_470181_+	hypothetical protein	NA	NA	NA	NA	NA
AXF19445.1|470238_471021_-	type VI secretion system protein ImpK	NA	NA	NA	NA	NA
AXF19446.1|471017_472364_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXF19447.1|472466_473078_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AXF19448.1|473452_474085_+	hypothetical protein	NA	NA	NA	NA	NA
AXF19449.1|474117_474633_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AXF19450.1|474648_476139_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AXF19451.1|476209_476713_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AXF19452.1|476781_477267_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXF19453.1|477344_479180_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXF19454.1|479143_480244_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
CP024902	Burkholderia pyrrocinia strain mHSR5 chromosome mHSR5_A, complete sequence	3619008	780056	790466	3619008	transposase	Hokovirus(14.29%)	8	NA	NA
AXF19711.1|780056_782009_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.4	3.8e-147
AXF19712.1|782275_783412_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	39.8	1.8e-24
AXF19713.1|783416_785366_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	37.1	1.3e-57
AXF19714.1|785445_786666_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	95.6	2.4e-232
AXF19715.1|786804_787620_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.2	7.9e-38
AXF19716.1|787663_788350_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	25.6	1.2e-05
AXF19717.1|788346_788889_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AXF19718.1|788924_790466_-	polynucleotide adenylyltransferase PcnB	NA	A0A1B0V011	Roseobacter_phage	27.8	2.5e-16
>prophage 3
CP024902	Burkholderia pyrrocinia strain mHSR5 chromosome mHSR5_A, complete sequence	3619008	1117395	1125679	3619008		Bacillus_phage(16.67%)	8	NA	NA
AXF19993.1|1117395_1118796_+	UDP-glucose 6-dehydrogenase	NA	A0A127AXI2	Bacillus_phage	38.3	5.1e-77
AXF19994.1|1118803_1119754_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.2	2.2e-15
AXF19995.1|1119817_1120810_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	31.2	9.1e-28
AXF19996.1|1120883_1121228_+	competence protein ComE	NA	NA	NA	NA	NA
AXF19997.1|1121442_1122345_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	39.9	5.3e-51
AXF22193.1|1122421_1123765_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AXF19998.1|1123808_1124732_+	deacetylase	NA	A0A2K9KZC4	Tupanvirus	34.6	6.7e-41
AXF22194.1|1124758_1125679_-	lysophospholipase	NA	Q6TUZ7	Yaba_monkey_tumor_virus	27.2	6.7e-17
>prophage 4
CP024902	Burkholderia pyrrocinia strain mHSR5 chromosome mHSR5_A, complete sequence	3619008	1752116	1831200	3619008	tail,terminase,integrase,head,portal,plate,capsid,tRNA,holin	Burkholderia_virus(29.31%)	103	1761892:1761924	1815808:1815840
AXF20492.1|1752116_1752881_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXF20493.1|1752892_1753438_-	NUDIX hydrolase	NA	A0A192YCC8	Morganella_phage	37.8	7.7e-05
AXF20494.1|1753897_1754395_+	hypothetical protein	NA	NA	NA	NA	NA
AXF20495.1|1754398_1754737_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AXF20496.1|1754768_1755923_+	3-hydroxyisobutyryl-CoA hydrolase	NA	NA	NA	NA	NA
AXF20497.1|1756044_1756473_-	hypothetical protein	NA	NA	NA	NA	NA
AXF22245.1|1756813_1757971_+	alkanesulfonate monooxygenase, FMNH(2)-dependent	NA	NA	NA	NA	NA
AXF20498.1|1757988_1758801_+	ABC transporter permease	NA	NA	NA	NA	NA
AXF20499.1|1758797_1759757_+	aliphatic sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	2.5e-30
AXF20500.1|1759814_1760030_+	transporter	NA	NA	NA	NA	NA
AXF20501.1|1760172_1760370_+	hypothetical protein	NA	NA	NA	NA	NA
AXF20502.1|1760425_1760671_+	hypothetical protein	NA	NA	NA	NA	NA
AXF20503.1|1760753_1761788_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
1761892:1761924	attL	TGGGTTCGAGTCCCATCAGCCACCCCAAAGAAT	NA	NA	NA	NA
AXF20504.1|1761943_1763122_-|integrase	integrase	integrase	Q774Z5	Bordetella_phage	63.0	1.5e-141
AXF20505.1|1763097_1763307_-	excisionase	NA	Q774Z6	Bordetella_phage	73.9	7.0e-23
AXF20506.1|1763343_1763553_+	hypothetical protein	NA	A9YWV5	Burkholderia_phage	76.5	1.1e-23
AXF20507.1|1763902_1764154_+	hypothetical protein	NA	NA	NA	NA	NA
AXF20508.1|1764173_1764353_+	hypothetical protein	NA	NA	NA	NA	NA
AXF20509.1|1764861_1765413_+	hypothetical protein	NA	NA	NA	NA	NA
AXF20510.1|1765405_1765936_-	hypothetical protein	NA	A0A2H4N7D9	Pectobacterium_phage	51.7	2.3e-30
AXF20511.1|1765923_1766679_-	hypothetical protein	NA	A0A076G8E9	Sinorhizobium_phage	53.5	6.2e-69
AXF20512.1|1766848_1767193_+	hypothetical protein	NA	NA	NA	NA	NA
AXF20513.1|1767700_1768096_+	hypothetical protein	NA	NA	NA	NA	NA
AXF22246.1|1768527_1768731_-	hypothetical protein	NA	NA	NA	NA	NA
AXF20514.1|1769204_1769417_-	hypothetical protein	NA	NA	NA	NA	NA
AXF20515.1|1769768_1770497_-	hypothetical protein	NA	NA	NA	NA	NA
AXF20516.1|1771089_1771476_-	hypothetical protein	NA	Q8W6P8	Burkholderia_virus	70.2	1.3e-43
AXF20517.1|1771561_1771801_+	Cro/Cl family transcriptional regulator	NA	C7BGF8	Burkholderia_phage	79.7	6.8e-30
AXF20518.1|1771882_1772128_-	hypothetical protein	NA	NA	NA	NA	NA
AXF20519.1|1772277_1772595_+	DNA-binding protein	NA	NA	NA	NA	NA
AXF20520.1|1772861_1773707_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	60.6	3.2e-82
AXF20521.1|1774216_1774711_+	hypothetical protein	NA	Q8W6P0	Burkholderia_virus	61.5	1.2e-49
AXF20522.1|1774880_1775444_+	hypothetical protein	NA	Q3HQZ9	Burkholderia_phage	82.4	2.9e-87
AXF20523.1|1775443_1775845_+	hypothetical protein	NA	NA	NA	NA	NA
AXF20524.1|1775841_1776285_+	hypothetical protein	NA	Q3HR02	Burkholderia_phage	82.3	1.3e-71
AXF20525.1|1776287_1776620_+	hypothetical protein	NA	A4JX59	Burkholderia_virus	62.0	1.5e-30
AXF20526.1|1776616_1776865_+	hypothetical protein	NA	NA	NA	NA	NA
AXF20527.1|1776861_1777110_+|portal	phage portal protein	portal	Q3HR04	Burkholderia_phage	81.7	1.3e-36
AXF20528.1|1777147_1777546_+	hypothetical protein	NA	A4JX61	Burkholderia_virus	59.8	2.5e-37
AXF20529.1|1777740_1778034_+	hypothetical protein	NA	NA	NA	NA	NA
AXF20530.1|1778206_1778482_-	hypothetical protein	NA	A9YWZ2	Burkholderia_phage	52.7	5.8e-17
AXF20531.1|1778633_1779029_-	HicB family protein	NA	A0A0R6PJ17	Moraxella_phage	34.1	5.6e-13
AXF20532.1|1779053_1779236_-	addiction module toxin, HicA family	NA	D6R431	Bacillus_phage	70.0	7.7e-18
AXF20533.1|1779277_1779634_+	endonuclease	NA	Q8W6N0	Burkholderia_virus	89.8	1.2e-59
AXF20534.1|1779781_1780267_+|terminase	phage terminase small subunit P27 family	terminase	Q8W6V0	Burkholderia_virus	97.5	9.4e-87
AXF20535.1|1780276_1781989_+|terminase	terminase	terminase	Q8W6U9	Burkholderia_virus	94.7	0.0e+00
AXF20536.1|1781985_1782171_+	hypothetical protein	NA	Q8W6U8	Burkholderia_virus	91.8	1.2e-18
AXF20537.1|1782175_1783435_+|portal	phage portal protein	portal	Q8W6U7	Burkholderia_virus	95.0	1.6e-231
AXF20538.1|1783431_1784400_+|capsid	capsid protein	capsid	A4JX00	Burkholderia_virus	92.2	1.6e-157
AXF20539.1|1784502_1785810_+|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	83.4	3.3e-195
AXF20540.1|1785869_1786055_+	hypothetical protein	NA	A4JX02	Burkholderia_virus	62.3	1.2e-13
AXF20541.1|1786061_1786625_+	hypothetical protein	NA	A4JX03	Burkholderia_virus	68.6	1.3e-68
AXF20542.1|1786624_1786960_+|head,tail	head-tail adaptor protein	head,tail	Q8HAC9	Salmonella_phage	45.7	3.7e-18
AXF20543.1|1786949_1787420_+	hypothetical protein	NA	NA	NA	NA	NA
AXF20544.1|1787426_1788017_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	43.9	5.4e-36
AXF22247.1|1788025_1788277_+	hypothetical protein	NA	A0A0C4UR31	Shigella_phage	43.8	1.2e-05
AXF20545.1|1788273_1789770_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	55.2	3.4e-151
AXF20546.1|1789839_1790187_+|tail	phage tail protein	tail	B5TK68	Pseudomonas_phage	52.2	1.7e-29
AXF20547.1|1790177_1790474_+	ArsR family transcriptional regulator	NA	B5TK69	Pseudomonas_phage	52.0	2.7e-20
AXF20548.1|1790607_1792545_+|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	54.2	2.3e-120
AXF20549.1|1792552_1793791_+	hydroxyacid dehydrogenase	NA	B5TK71	Pseudomonas_phage	39.3	1.5e-80
AXF20550.1|1793791_1794907_+|plate	baseplate protein	plate	B5TK72	Pseudomonas_phage	54.5	1.1e-101
AXF20551.1|1794903_1795482_+|plate	phage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	52.2	6.4e-34
AXF20552.1|1795478_1795907_+	hypothetical protein	NA	B5TK74	Pseudomonas_phage	47.7	5.8e-24
AXF20553.1|1795878_1796925_+|plate	baseplate J protein	plate	B5TK75	Pseudomonas_phage	48.1	1.5e-84
AXF20554.1|1796915_1797515_+|tail	phage tail protein	tail	O22003	Shigella_phage	30.8	3.6e-19
AXF20555.1|1797517_1798534_+	hypothetical protein	NA	R4JJY3	Burkholderia_phage	47.9	6.6e-34
AXF20556.1|1798543_1798957_+	hypothetical protein	NA	U3PCK9	Burkholderia_phage	67.6	1.4e-51
AXF20557.1|1799101_1800154_+	acyltransferase	NA	NA	NA	NA	NA
AXF20558.1|1800307_1800520_+|holin	holin	holin	Q3HQU8	Burkholderia_phage	90.0	8.9e-26
AXF20559.1|1800512_1801010_+	glycosyl hydrolase	NA	Q3HQU9	Burkholderia_phage	90.9	3.2e-82
AXF20560.1|1801006_1801480_+	hypothetical protein	NA	C7BGD9	Burkholderia_phage	63.9	9.6e-44
AXF20561.1|1801756_1803484_+	hypothetical protein	NA	G8GWG3	Rhodobacter_phage	31.0	6.2e-16
AXF20562.1|1803483_1803783_+	hypothetical protein	NA	NA	NA	NA	NA
AXF20563.1|1804092_1804533_-	hypothetical protein	NA	NA	NA	NA	NA
AXF20564.1|1804575_1805070_-	hypothetical protein	NA	C7BGE3	Burkholderia_phage	74.8	8.4e-67
AXF20565.1|1805179_1805605_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
AXF20566.1|1805562_1806288_+	DUF159 family protein	NA	A0A1S5NTJ1	Burkholderia_phage	82.0	1.2e-114
AXF20567.1|1807441_1807651_+	hypothetical protein	NA	C7BGE4	Burkholderia_phage	59.3	3.3e-12
AXF20568.1|1808294_1809044_-	hypothetical protein	NA	NA	NA	NA	NA
AXF20569.1|1809591_1810710_-	hypothetical protein	NA	E5E3X7	Burkholderia_phage	61.1	2.6e-132
AXF20570.1|1810715_1811480_-	nuclease	NA	A4JWV4	Burkholderia_virus	50.0	9.7e-54
AXF20571.1|1811476_1812025_-	hypothetical protein	NA	A4JWV5	Burkholderia_virus	63.4	3.0e-57
AXF20572.1|1812217_1812472_+	DUF159 family protein	NA	A0A1S5NTJ1	Burkholderia_phage	68.7	8.2e-26
AXF20573.1|1812667_1813693_+	hypothetical protein	NA	Q7M293	Enterobacteria_phage	41.5	1.7e-74
AXF20574.1|1814676_1815738_-	hypothetical protein	NA	NA	NA	NA	NA
AXF20575.1|1816585_1817101_+	N-acetyltransferase	NA	NA	NA	NA	NA
1815808:1815840	attR	TGGGTTCGAGTCCCATCAGCCACCCCAAAGAAT	NA	NA	NA	NA
AXF20576.1|1817132_1817597_-	hypothetical protein	NA	NA	NA	NA	NA
AXF20577.1|1817922_1818318_+	hypothetical protein	NA	NA	NA	NA	NA
AXF20578.1|1819010_1819754_-	DUF695 domain-containing protein	NA	NA	NA	NA	NA
AXF22248.1|1819939_1820248_+	phosphatidylserine/phosphatidylglycerophosphate/ cardiolipin synthase	NA	NA	NA	NA	NA
AXF22249.1|1820450_1820690_+	hypothetical protein	NA	NA	NA	NA	NA
AXF20579.1|1820881_1821421_+|tRNA	aspartyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AXF20580.1|1821587_1822061_+	glyoxalase	NA	A0A2K9L1J4	Tupanvirus	37.7	2.4e-18
AXF20581.1|1822434_1822662_+	hypothetical protein	NA	NA	NA	NA	NA
AXF20582.1|1822821_1823445_-	endonuclease	NA	A0A1B2LRT6	Wolbachia_phage	35.0	2.4e-18
AXF20583.1|1823774_1824263_-	transcriptional regulator	NA	NA	NA	NA	NA
AXF20584.1|1824431_1824869_+	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AXF20585.1|1825016_1826069_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AXF20586.1|1826146_1827433_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	42.0	1.3e-82
AXF20587.1|1827468_1828890_-	hypothetical protein	NA	NA	NA	NA	NA
AXF20588.1|1829055_1830009_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXF20589.1|1830072_1831200_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
>prophage 5
CP024902	Burkholderia pyrrocinia strain mHSR5 chromosome mHSR5_A, complete sequence	3619008	2714495	2756049	3619008	tail,terminase,integrase,head,portal,plate,capsid,holin,transposase	uncultured_Caudovirales_phage(35.48%)	48	2719996:2720011	2758123:2758138
AXF22306.1|2714495_2715230_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	39.9	6.3e-34
AXF21335.1|2715951_2717340_+	hypothetical protein	NA	NA	NA	NA	NA
AXF21336.1|2717744_2718773_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	43.5	3.1e-71
AXF21337.1|2718769_2719543_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	57.6	7.2e-81
AXF21338.1|2719700_2720492_-	restriction endonuclease subunit M	NA	Q8W6S4	Burkholderia_virus	88.2	1.4e-140
2719996:2720011	attL	TATCGATCGATACAGA	NA	NA	NA	NA
AXF21339.1|2720659_2721154_-	hypothetical protein	NA	C7BGD9	Burkholderia_phage	38.6	4.5e-20
AXF21340.1|2721150_2721645_-	glycoside hydrolase	NA	Q6J1Q5	Burkholderia_virus	86.0	1.7e-75
AXF21341.1|2721647_2721932_-|holin	holin	holin	C7BGD7	Burkholderia_phage	92.6	5.6e-39
AXF21342.1|2722018_2723068_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	46.5	1.2e-83
AXF21343.1|2723077_2723284_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	62.7	3.1e-15
AXF21344.1|2723258_2724137_-	oxidoreductase	NA	A0A2H4J875	uncultured_Caudovirales_phage	37.0	3.0e-35
AXF21345.1|2724149_2726585_-|tail	phage tail protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	34.1	3.0e-56
AXF21346.1|2726665_2726968_-|tail	phage tail assembly protein	tail	K4I007	Acidithiobacillus_phage	37.3	7.3e-05
AXF21347.1|2727054_2727558_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	51.2	1.9e-42
AXF21348.1|2727568_2728738_-|tail	phage tail protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.4	8.4e-158
AXF21349.1|2728811_2729591_-|tail	phage tail protein	tail	E5E3Q6	Burkholderia_phage	53.4	2.3e-55
AXF21350.1|2729606_2731601_-|tail	phage tail protein	tail	E5E3V2	Burkholderia_phage	54.9	1.8e-115
AXF21351.1|2731588_2732167_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	44.7	3.3e-30
AXF21352.1|2732156_2733053_-|plate	baseplate J protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	43.4	2.1e-47
AXF21353.1|2733049_2733385_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	48.1	1.5e-22
AXF21354.1|2733384_2733585_-	hypothetical protein	NA	NA	NA	NA	NA
AXF21355.1|2733645_2734326_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	27.8	4.2e-16
AXF21356.1|2734329_2734854_-	hypothetical protein	NA	Q75QM3	Wolbachia_phage	42.3	8.4e-25
AXF21357.1|2734843_2735374_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	30.5	6.3e-12
AXF21358.1|2735376_2735664_-	hypothetical protein	NA	NA	NA	NA	NA
AXF21359.1|2735665_2736661_-|capsid	major capsid protein E	capsid	A0A2H4J890	uncultured_Caudovirales_phage	62.7	7.3e-118
AXF21360.1|2736734_2737079_-|head	head decoration protein	head	NA	NA	NA	NA
AXF21361.1|2737109_2738198_-	peptidase S14	NA	A0A2H4JDI2	uncultured_Caudovirales_phage	37.2	1.6e-49
AXF21362.1|2738194_2739685_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	50.9	3.7e-134
AXF21363.1|2739681_2739888_-	hypothetical protein	NA	NA	NA	NA	NA
AXF21364.1|2739897_2742009_-|terminase	terminase	terminase	A0A2D1GMT1	Marinobacter_phage	53.0	3.3e-176
AXF21365.1|2742374_2742701_-	hypothetical protein	NA	NA	NA	NA	NA
AXF21366.1|2742920_2743508_-	hypothetical protein	NA	NA	NA	NA	NA
AXF21367.1|2743730_2746244_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.5	5.0e-99
AXF21368.1|2746518_2746902_-	hypothetical protein	NA	NA	NA	NA	NA
AXF21369.1|2746903_2747461_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	47.1	1.6e-29
AXF21370.1|2747540_2747750_-	hypothetical protein	NA	NA	NA	NA	NA
AXF21371.1|2747820_2748249_+	transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	63.5	2.6e-16
AXF21372.1|2748705_2748924_+	hypothetical protein	NA	NA	NA	NA	NA
AXF22307.1|2748974_2749337_+	beta-hexosaminidase	NA	NA	NA	NA	NA
AXF21373.1|2749336_2750686_+	pyridoxal phosphate biosynthetic protein PdxJ	NA	NA	NA	NA	NA
AXF21374.1|2750787_2751132_+	hypothetical protein	NA	NA	NA	NA	NA
AXF21375.1|2751286_2751592_+	hypothetical protein	NA	NA	NA	NA	NA
AXF21376.1|2751604_2752306_+	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	50.5	8.4e-20
AXF21377.1|2752302_2752533_+	hypothetical protein	NA	NA	NA	NA	NA
AXF21378.1|2752612_2754034_+	hypothetical protein	NA	NA	NA	NA	NA
AXF21379.1|2754036_2754948_+	DNA methyltransferase	NA	NA	NA	NA	NA
AXF21380.1|2754954_2756049_-|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	30.1	1.7e-43
2758123:2758138	attR	TATCGATCGATACAGA	NA	NA	NA	NA
>prophage 1
CP024903	Burkholderia pyrrocinia strain mHSR5 chromosome mHSR5_B, complete sequence	3400486	616147	674919	3400486	plate,protease,transposase	Cronobacter_phage(16.67%)	46	NA	NA
AXF22836.1|616147_616573_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXF22837.1|616589_619313_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.2	1.5e-93
AXF22838.1|619455_619941_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AXF22839.1|620035_621757_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
AXF22840.1|621753_622485_-	type IV secretion protein DotU	NA	NA	NA	NA	NA
AXF22841.1|622481_623834_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXF22842.1|624437_624950_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AXF22843.1|625023_626556_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AXF22844.1|626638_628978_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AXF22845.1|628987_631438_+	hypothetical protein	NA	A0A2D2W2Q1	Stenotrophomonas_phage	30.5	1.8e-08
AXF22846.1|633677_633935_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
AXF22847.1|633938_635177_+	hypothetical protein	NA	NA	NA	NA	NA
AXF22848.1|635173_638737_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
AXF22849.1|638733_640317_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AXF22850.1|640326_642141_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXF22851.1|642137_643073_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXF22852.1|643064_644275_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.4	4.1e-99
AXF22853.1|644580_645132_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AXF22854.1|645593_646634_+	hypothetical protein	NA	NA	NA	NA	NA
AXF22855.1|646647_646851_+	hypothetical protein	NA	NA	NA	NA	NA
AXF22856.1|647366_648002_-	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AXF22857.1|648251_649187_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXF22858.1|649234_650152_-	hypothetical protein	NA	NA	NA	NA	NA
AXF22859.1|650644_651607_+	oxidoreductase	NA	NA	NA	NA	NA
AXF22860.1|651753_652935_-	porin	NA	NA	NA	NA	NA
AXF25101.1|653416_653695_-	hypothetical protein	NA	NA	NA	NA	NA
AXF22861.1|654181_655474_+	acetyl-CoA hydrolase	NA	NA	NA	NA	NA
AXF22862.1|655836_657162_+	protein kinase	NA	NA	NA	NA	NA
AXF22863.1|657577_658024_-	copper transporter	NA	NA	NA	NA	NA
AXF22864.1|658107_658473_-	copper resistance protein	NA	NA	NA	NA	NA
AXF22865.1|658672_659050_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AXF25102.1|659132_659627_-	vanillate O-demethylase oxidoreductase VanB	NA	NA	NA	NA	NA
AXF22866.1|659683_659986_-	ferredoxin	NA	NA	NA	NA	NA
AXF22867.1|660067_661972_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXF25103.1|662549_662741_+	hypothetical protein	NA	NA	NA	NA	NA
AXF22868.1|662980_663268_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AXF22869.1|663509_664811_-	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	37.1	1.0e-63
AXF25104.1|665575_665854_+	hypothetical protein	NA	NA	NA	NA	NA
AXF22870.1|666019_666394_-	hypothetical protein	NA	NA	NA	NA	NA
AXF22871.1|666645_666933_-	hypothetical protein	NA	NA	NA	NA	NA
AXF22872.1|667011_667917_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AXF22873.1|667947_669735_-	short chain dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.4	2.9e-08
AXF22874.1|669773_670670_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AXF22875.1|671233_672511_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
AXF22876.1|672592_673366_-	hypothetical protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	31.6	8.1e-24
AXF22877.1|673362_674919_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 2
CP024903	Burkholderia pyrrocinia strain mHSR5 chromosome mHSR5_B, complete sequence	3400486	1415840	1499221	3400486	plate,terminase,tail,portal,capsid,head,transposase	Burkholderia_phage(82.14%)	83	NA	NA
AXF23466.1|1415840_1416974_-|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	53.6	5.4e-109
AXF23467.1|1417087_1417921_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXF23468.1|1417928_1418801_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AXF23469.1|1418797_1419706_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AXF23470.1|1419702_1421136_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AXF25169.1|1421360_1422221_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXF23471.1|1422328_1423051_+	ABC transporter permease	NA	NA	NA	NA	NA
AXF23472.1|1423063_1423810_+	ABC transporter permease	NA	NA	NA	NA	NA
AXF23473.1|1423837_1424629_+	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.6	4.1e-23
AXF23474.1|1424636_1426130_+	histidine ammonia-lyase	NA	NA	NA	NA	NA
AXF23475.1|1426200_1426956_+	histidine utilization repressor	NA	NA	NA	NA	NA
AXF25170.1|1427076_1427496_-	DUF1810 domain-containing protein	NA	A0A2H4UVK5	Bodo_saltans_virus	38.7	1.7e-15
AXF25171.1|1427761_1430515_+	hypothetical protein	NA	NA	NA	NA	NA
AXF23476.1|1430552_1431923_-	MFS transporter	NA	NA	NA	NA	NA
AXF23477.1|1432341_1432833_-	hypothetical protein	NA	NA	NA	NA	NA
AXF23478.1|1433283_1433811_+|transposase	IS21 family transposase	transposase	R4JDM9	Burkholderia_phage	89.7	2.7e-87
AXF23479.1|1433919_1434258_+	hypothetical protein	NA	R4JGF4	Burkholderia_phage	78.6	1.2e-48
AXF23480.1|1434340_1434895_+	PAAR domain-containing protein	NA	R4JMI1	Burkholderia_phage	91.8	1.6e-98
AXF23481.1|1434898_1435519_+	hypothetical protein	NA	R4JJZ3	Burkholderia_phage	93.7	1.2e-113
AXF23482.1|1435518_1435857_+	hypothetical protein	NA	R4JEU5	Burkholderia_phage	79.5	1.5e-46
AXF25172.1|1435996_1436296_-	hypothetical protein	NA	NA	NA	NA	NA
AXF23483.1|1436441_1437521_-	late control protein	NA	R4JDM6	Burkholderia_phage	96.1	3.8e-197
AXF23484.1|1437525_1438032_-	oxidoreductase	NA	R4JGF0	Burkholderia_phage	94.6	2.7e-84
AXF23485.1|1438039_1440958_-	hypothetical protein	NA	R4JMH9	Burkholderia_phage	86.1	0.0e+00
AXF23486.1|1440950_1441067_-|tail	GpE family phage tail protein	tail	A0A1S5NR79	Burkholderia_phage	73.7	1.6e-08
AXF23487.1|1441078_1441384_-|tail	phage tail assembly protein	tail	R4JJY8	Burkholderia_phage	98.0	1.2e-47
AXF23488.1|1441437_1441947_-|tail	phage major tail tube protein	tail	R4JEU1	Burkholderia_phage	97.0	4.6e-92
AXF23489.1|1442002_1443190_-|tail	phage tail protein	tail	R4JDM4	Burkholderia_phage	94.4	6.7e-211
AXF23490.1|1443257_1443590_-	hypothetical protein	NA	R4JGE6	Burkholderia_phage	94.5	2.8e-50
AXF23491.1|1443640_1444066_-	hypothetical protein	NA	R4JMH4	Burkholderia_phage	89.4	1.0e-68
AXF23492.1|1444062_1447500_-|tail	phage tail protein	tail	R4JJY3	Burkholderia_phage	68.5	0.0e+00
AXF23493.1|1447502_1448048_-|tail	phage tail protein I	tail	R4JET8	Burkholderia_phage	96.1	4.3e-96
AXF23494.1|1448037_1448946_-|plate	baseplate assembly protein	plate	R4JDM0	Burkholderia_phage	94.7	3.4e-154
AXF23495.1|1448942_1449317_-|plate	baseplate assembly protein	plate	R4JGE4	Burkholderia_phage	96.8	8.9e-61
AXF23496.1|1449316_1450033_-|plate	phage baseplate assembly protein V	plate	R4JMH2	Burkholderia_phage	88.7	3.7e-116
AXF23497.1|1450166_1450640_-	phage virion morphogenesis protein	NA	R4JJX8	Burkholderia_phage	96.8	1.8e-79
AXF23498.1|1450636_1451113_-|tail	phage tail protein	tail	R4JET5	Burkholderia_phage	91.1	1.4e-74
AXF23499.1|1451109_1451238_-	peptidase	NA	R4JDL9	Burkholderia_phage	90.5	2.4e-10
AXF23500.1|1451239_1451680_-	protein lysB	NA	R4JGE0	Burkholderia_phage	77.4	1.5e-54
AXF23501.1|1451676_1452126_-	peptidase M15	NA	R4JMG7	Burkholderia_phage	94.0	1.9e-73
AXF23502.1|1452161_1452566_-	hypothetical protein	NA	R4JJW4	Burkholderia_phage	97.0	8.7e-62
AXF23503.1|1452553_1452997_-	hypothetical protein	NA	R4JES4	Burkholderia_phage	97.3	3.4e-75
AXF23504.1|1453004_1453211_-|tail	phage tail protein	tail	R4JDL4	Burkholderia_phage	97.1	1.3e-32
AXF23505.1|1453210_1453711_-|head	phage head completion protein	head	R4JGC6	Burkholderia_phage	95.8	1.1e-85
AXF25173.1|1453806_1454508_-|terminase	terminase	terminase	R4JMF4	Burkholderia_phage	92.8	1.2e-106
AXF23506.1|1454517_1455549_-|capsid	phage major capsid protein, P2 family	capsid	R4JJT6	Burkholderia_phage	94.8	4.2e-185
AXF23507.1|1455594_1456461_-|capsid	phage capsid protein	capsid	R4JEQ3	Burkholderia_phage	83.7	1.0e-131
AXF23508.1|1456615_1458433_+|terminase	terminase	terminase	R4JDJ3	Burkholderia_phage	92.6	0.0e+00
AXF23509.1|1458432_1459494_+|portal	phage portal protein	portal	R4JG97	Burkholderia_phage	96.4	5.2e-138
AXF23510.1|1459916_1460171_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	100.0	1.6e-42
AXF23511.1|1460167_1460557_+	toxin-antitoxin system HicB family antitoxin	NA	R4JJS9	Burkholderia_phage	97.6	1.5e-66
AXF23512.1|1460967_1461240_-	hypothetical protein	NA	NA	NA	NA	NA
AXF23513.1|1461236_1461734_-	hypothetical protein	NA	R4JEP8	Burkholderia_phage	78.8	2.8e-46
AXF23514.1|1461730_1462657_-	chromosome partitioning protein ParB	NA	R4JDJ1	Burkholderia_phage	94.5	6.9e-155
AXF23515.1|1462758_1463979_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	95.6	2.4e-232
AXF23516.1|1464250_1464529_-	hypothetical protein	NA	R4JMD0	Burkholderia_phage	96.7	4.2e-47
AXF23517.1|1464540_1466562_-	hypothetical protein	NA	R4JJS4	Burkholderia_phage	96.6	0.0e+00
AXF23518.1|1466570_1467545_-	hypothetical protein	NA	Q8W6P3	Burkholderia_virus	72.2	1.5e-136
AXF23519.1|1467740_1467941_-	hypothetical protein	NA	A4JWW3	Burkholderia_virus	72.7	2.0e-19
AXF23520.1|1467966_1468185_-	hypothetical protein	NA	R4JG87	Burkholderia_phage	85.3	6.6e-24
AXF23521.1|1468186_1469092_-	DNA methyltransferase	NA	R4JMC6	Burkholderia_phage	89.0	1.0e-155
AXF23522.1|1469088_1469319_-	hypothetical protein	NA	R4JJR9	Burkholderia_phage	84.2	3.4e-31
AXF23523.1|1469315_1469495_-	hypothetical protein	NA	R4JEN9	Burkholderia_phage	79.7	6.4e-17
AXF25174.1|1469525_1470401_-	DUF550 domain-containing protein	NA	R4JG80	Burkholderia_phage	79.9	6.8e-120
AXF23524.1|1470397_1470550_-	hypothetical protein	NA	R4JMC2	Burkholderia_phage	84.0	4.9e-18
AXF23525.1|1470789_1471128_+	hypothetical protein	NA	A4JWW9	Burkholderia_virus	97.3	3.0e-55
AXF23526.1|1471252_1471936_-	hypothetical protein	NA	NA	NA	NA	NA
AXF23527.1|1471757_1476164_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	36.0	2.7e-23
AXF23528.1|1476299_1477565_-	hypothetical protein	NA	NA	NA	NA	NA
AXF23529.1|1477580_1479785_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.1	3.8e-26
AXF23530.1|1479781_1482439_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	1.5e-77
AXF25175.1|1482451_1483552_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXF23531.1|1483548_1485420_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXF23532.1|1485424_1485973_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXF23533.1|1485989_1486481_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AXF23534.1|1486528_1488037_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AXF23535.1|1488029_1488584_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AXF23536.1|1488657_1489788_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AXF23537.1|1489774_1492123_-	serine/threonine protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	26.2	1.5e-09
AXF23538.1|1492183_1492879_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
AXF23539.1|1492860_1496487_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AXF23540.1|1496488_1497808_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
AXF23541.1|1497823_1499221_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
