The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031101	Enterobacteriaceae bacterium w17 chromosome, complete genome	4811348	1733604	1790123	4811348	protease,terminase,portal,capsid,integrase,tail,head,lysis	Enterobacteria_phage(27.91%)	65	1732297:1732312	1794475:1794490
1732297:1732312	attL	AGATGTTGCTGAAATA	NA	NA	NA	NA
AXF64150.1|1733604_1734615_-|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	83.6	2.5e-166
AXF64151.1|1734614_1734845_-	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	94.7	1.4e-37
AXF64152.1|1734884_1735718_-	hypothetical protein	NA	NA	NA	NA	NA
AXF64153.1|1736060_1737089_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	82.6	7.7e-155
AXF64154.1|1738443_1738761_+	hypothetical protein	NA	NA	NA	NA	NA
AXF66959.1|1739066_1739726_-	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	63.2	1.7e-70
AXF64155.1|1739834_1740059_+	XRE family transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	56.1	1.8e-13
AXF64156.1|1740084_1740630_+	hypothetical protein	NA	NA	NA	NA	NA
AXF64157.1|1740824_1741037_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.4	5.1e-13
AXF64158.1|1740993_1741920_+	transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	59.7	1.1e-38
AXF64159.1|1741916_1742381_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	29.2	2.3e-10
AXF64160.1|1742377_1743253_+	phage N-6-adenine-methyltransferase	NA	K7PGU4	Enterobacteria_phage	78.0	1.8e-104
AXF64161.1|1743249_1745118_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	51.2	3.8e-192
AXF66960.1|1745129_1745435_+	LexA family transcriptional regulator	NA	S5FXP5	Shigella_phage	50.5	2.2e-17
AXF64162.1|1745431_1745818_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	82.2	1.0e-56
AXF64163.1|1745833_1746520_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	54.7	1.2e-58
AXF64164.1|1746516_1747506_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	68.1	3.2e-134
AXF64165.1|1747523_1748345_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	44.1	1.2e-57
AXF64166.1|1748967_1749543_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
AXF64167.1|1749539_1749965_+	hypothetical protein	NA	NA	NA	NA	NA
AXF64168.1|1750163_1750403_+|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	57.9	8.6e-17
AXF64169.1|1750403_1750907_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	76.0	1.9e-74
AXF64170.1|1750896_1751262_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	45.3	1.8e-13
AXF64171.1|1751595_1751955_+	hypothetical protein	NA	NA	NA	NA	NA
AXF64172.1|1752099_1752450_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	2.1e-51
AXF64173.1|1752446_1752647_+	hypothetical protein	NA	NA	NA	NA	NA
AXF64174.1|1752808_1753279_+|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	61.9	7.8e-46
AXF64175.1|1753275_1755006_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	81.4	4.3e-291
AXF64176.1|1755005_1756310_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	88.7	1.5e-224
AXF64177.1|1756318_1757173_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	77.8	3.3e-119
AXF64178.1|1757185_1758406_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	95.6	3.6e-212
AXF64179.1|1758458_1758644_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	60.7	5.4e-11
AXF64180.1|1758653_1758980_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	52.8	1.1e-25
AXF64181.1|1759050_1759230_+	hypothetical protein	NA	NA	NA	NA	NA
AXF64182.1|1759232_1759565_+|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	69.1	9.4e-38
AXF64183.1|1759557_1760043_+	hypothetical protein	NA	A0A0U3TGT7	Pseudomonas_phage	55.6	3.7e-43
AXF64184.1|1760039_1760405_+	DUF3168 domain-containing protein	NA	K7PHI9	Enterobacteria_phage	78.5	8.7e-53
AXF64185.1|1760455_1760947_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	79.5	4.0e-69
AXF64186.1|1760946_1761354_+|tail	phage tail protein	tail	K7PJU9	Enterobacteria_phage	76.4	2.5e-48
AXF64187.1|1761335_1761605_+|tail	phage tail protein	tail	Q9MCU7	Escherichia_phage	61.8	1.3e-26
AXF64188.1|1761622_1764052_+|tail	phage tail tape measure protein	tail	K7PM62	Enterobacteria_phage	73.7	0.0e+00
AXF64189.1|1764051_1764390_+|tail	phage tail protein	tail	K7PHJ6	Enterobacteria_phage	89.3	6.0e-56
AXF64190.1|1764386_1765142_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	87.6	1.1e-131
AXF64191.1|1765143_1765854_+	peptidase P60	NA	K7PGV2	Enterobacterial_phage	87.7	1.3e-132
AXF66961.1|1765883_1766297_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	65.7	9.8e-53
AXF64192.1|1766357_1766948_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	79.6	1.4e-79
AXF64193.1|1767001_1771912_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	39.6	2.1e-08
AXF64194.1|1774090_1774510_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.3	6.1e-34
AXF64195.1|1774511_1775780_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	85.8	2.8e-215
AXF64196.1|1776550_1777180_+	hypothetical protein	NA	NA	NA	NA	NA
AXF66962.1|1778471_1779674_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
AXF64197.1|1779705_1779957_+	hypothetical protein	NA	NA	NA	NA	NA
AXF66963.1|1780107_1780422_+	hypothetical protein	NA	NA	NA	NA	NA
AXF64198.1|1780447_1780957_+	hypothetical protein	NA	NA	NA	NA	NA
AXF64199.1|1781050_1781485_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
AXF64200.1|1781780_1782017_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AXF64201.1|1782102_1782423_+	hypothetical protein	NA	NA	NA	NA	NA
AXF64202.1|1782582_1782858_+	hypothetical protein	NA	NA	NA	NA	NA
AXF66964.1|1782907_1783795_-	ferrous iron transporter B	NA	NA	NA	NA	NA
AXF64203.1|1783787_1784195_-	hypothetical protein	NA	NA	NA	NA	NA
AXF64204.1|1784187_1785114_-	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	30.0	3.0e-33
AXF66965.1|1785377_1787372_-	hypothetical protein	NA	NA	NA	NA	NA
AXF64205.1|1788042_1788645_-	hypothetical protein	NA	NA	NA	NA	NA
AXF64206.1|1788676_1788865_-	DNA-binding protein	NA	NA	NA	NA	NA
AXF64207.1|1789001_1790123_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	28.6	5.1e-19
1794475:1794490	attR	AGATGTTGCTGAAATA	NA	NA	NA	NA
>prophage 2
CP031101	Enterobacteriaceae bacterium w17 chromosome, complete genome	4811348	2056025	2109239	4811348	holin,protease,terminase,portal,capsid,integrase,tail,head	Salmonella_phage(21.43%)	64	2054632:2054646	2078899:2078913
2054632:2054646	attL	CAGCGGCGCGCTGGC	NA	NA	NA	NA
AXF64436.1|2056025_2057153_-|integrase	integrase	integrase	O21940	Phage_21	53.0	5.5e-106
AXF64437.1|2057130_2057379_-	excisionase	NA	NA	NA	NA	NA
AXF66983.1|2060278_2060608_-	transcriptional regulator	NA	NA	NA	NA	NA
AXF64438.1|2060663_2060846_-	DUF1482 family protein	NA	NA	NA	NA	NA
AXF64439.1|2061246_2061675_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	56.6	5.1e-36
AXF64440.1|2061764_2061995_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	59.2	6.1e-20
AXF64441.1|2061997_2062552_+	hypothetical protein	NA	NA	NA	NA	NA
AXF64442.1|2062606_2063431_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	48.1	7.0e-58
AXF64443.1|2063433_2064174_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	71.2	1.3e-95
AXF64444.1|2064192_2064612_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AXF64445.1|2064615_2064879_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	66.2	1.6e-24
AXF64446.1|2064871_2065321_+	hypothetical protein	NA	F1C5B6	Cronobacter_phage	36.2	9.5e-09
AXF64447.1|2065317_2065662_+	hypothetical protein	NA	NA	NA	NA	NA
AXF64448.1|2065654_2065954_+	hypothetical protein	NA	NA	NA	NA	NA
AXF64449.1|2066102_2066621_+	hypothetical protein	NA	L0AQW6	Klebsiella_phage	35.1	3.2e-24
AXF64450.1|2066716_2066920_+	hypothetical protein	NA	NA	NA	NA	NA
AXF64451.1|2067248_2067482_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	76.6	1.1e-27
AXF64452.1|2067519_2067765_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	64.0	2.4e-22
AXF64453.1|2067907_2068114_+	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	47.7	1.1e-09
AXF64454.1|2068583_2068943_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.0	2.2e-40
AXF64455.1|2068942_2069983_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	56.3	6.0e-107
AXF64456.1|2069996_2070611_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	59.6	7.0e-63
AXF64457.1|2070894_2071230_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	56.1	2.1e-29
AXF64458.1|2071238_2071853_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.3	3.0e-90
AXF64459.1|2071849_2072200_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	36.4	3.0e-10
AXF64460.1|2072463_2073318_+	hypothetical protein	NA	NA	NA	NA	NA
AXF64461.1|2073363_2073546_-	hypothetical protein	NA	NA	NA	NA	NA
AXF64462.1|2073608_2074148_-	hypothetical protein	NA	NA	NA	NA	NA
AXF64463.1|2074299_2074650_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	78.4	1.4e-52
AXF64464.1|2074771_2075275_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.1	8.5e-83
AXF64465.1|2075271_2077005_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	94.7	0.0e+00
AXF64466.1|2077152_2078379_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	90.9	7.9e-223
AXF64467.1|2078371_2078971_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	79.0	1.8e-87
2078899:2078913	attR	CAGCGGCGCGCTGGC	NA	NA	NA	NA
AXF64468.1|2078980_2080201_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	76.6	4.5e-170
AXF66984.1|2080282_2080603_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	47.5	1.2e-21
AXF64469.1|2080611_2080950_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	62.5	1.2e-35
AXF64470.1|2080946_2081393_+	hypothetical protein	NA	K7PH04	Enterobacteria_phage	76.5	1.1e-57
AXF64471.1|2081389_2081737_+	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	52.6	3.5e-27
AXF64472.1|2081794_2082508_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	60.2	4.6e-66
AXF64473.1|2082539_2082905_+|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	65.0	6.0e-38
AXF66985.1|2082928_2083210_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	71.0	6.1e-30
AXF64474.1|2083267_2083567_+	hypothetical protein	NA	NA	NA	NA	NA
AXF64475.1|2083621_2086876_+|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	54.6	7.7e-185
AXF64476.1|2086875_2087343_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.3	1.5e-49
AXF64477.1|2087339_2087828_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	71.2	3.2e-58
AXF64478.1|2087837_2088218_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	75.4	1.1e-53
AXF64479.1|2088214_2091310_+	kinase	NA	A0A286S259	Klebsiella_phage	50.9	1.5e-294
AXF64480.1|2091365_2093471_+	hypothetical protein	NA	A0A291AXF7	Shigella_phage	49.3	5.4e-30
AXF64481.1|2093562_2093802_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	60.8	1.8e-22
AXF64482.1|2093803_2094124_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	5.3e-22
AXF64483.1|2094439_2094712_-	DUF883 family protein	NA	NA	NA	NA	NA
AXF64484.1|2094816_2095050_-	putative sulfurtransferase YedF	NA	NA	NA	NA	NA
AXF64485.1|2096416_2097226_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AXF64486.1|2097225_2098419_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AXF64487.1|2098429_2099788_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
AXF64488.1|2099791_2101387_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.8	6.1e-50
AXF64489.1|2101386_2102949_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
AXF64490.1|2103228_2104110_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
AXF64491.1|2104106_2104727_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AXF64492.1|2105031_2105298_+	hypothetical protein	NA	NA	NA	NA	NA
AXF64493.1|2105683_2106562_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
AXF64494.1|2106594_2107185_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AXF64495.1|2107181_2107943_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.2	1.4e-07
AXF64496.1|2108192_2109239_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	6.0e-22
>prophage 3
CP031101	Enterobacteriaceae bacterium w17 chromosome, complete genome	4811348	2576966	2593751	4811348	tail	Escherichia_phage(30.77%)	13	NA	NA
AXF64880.1|2576966_2581619_-	DUF1983 domain-containing protein	NA	G8C7R4	Escherichia_phage	41.2	3.9e-12
AXF64881.1|2581673_2582267_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	87.5	3.8e-90
AXF64882.1|2582254_2582986_-	peptidase P60	NA	G8C7R2	Escherichia_phage	92.1	3.7e-143
AXF64883.1|2582998_2583769_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	87.1	1.4e-132
AXF67005.1|2584532_2584772_+	DNA breaking-rejoining protein	NA	H6WRX2	Salmonella_phage	58.2	5.0e-25
AXF64884.1|2584900_2587843_+	exodeoxyribonuclease VIII	NA	K7PJT5	Enterobacteria_phage	69.8	2.7e-306
AXF64885.1|2587855_2588941_+	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	58.1	2.2e-112
AXF64886.1|2588978_2589218_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	89.7	1.0e-30
AXF64887.1|2589317_2589569_+	DNA-binding protein	NA	Q859D3	Escherichia_coli_phage	41.0	2.1e-13
AXF64888.1|2589601_2590885_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	59.3	3.6e-154
AXF64889.1|2591072_2592089_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	27.2	1.3e-18
AXF64890.1|2592100_2593315_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	30.0	7.4e-48
AXF64891.1|2593424_2593751_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.1e-21
>prophage 4
CP031101	Enterobacteriaceae bacterium w17 chromosome, complete genome	4811348	2697938	2743104	4811348	terminase,holin,head	Salmonella_phage(27.66%)	63	NA	NA
AXF64983.1|2697938_2698256_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	5.3e-22
AXF64984.1|2698255_2698495_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	63.3	1.4e-22
AXF64985.1|2698584_2698950_-	hypothetical protein	NA	NA	NA	NA	NA
AXF64986.1|2700741_2703219_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	89.3	0.0e+00
AXF64987.1|2703205_2703571_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	85.1	3.9e-61
AXF64988.1|2703584_2704055_-	DUF1833 domain-containing protein	NA	F1C5F1	Cronobacter_phage	88.5	1.4e-74
AXF64989.1|2704054_2704552_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.3	7.9e-89
AXF64990.1|2704593_2704821_-	hypothetical protein	NA	NA	NA	NA	NA
AXF64991.1|2704829_2707454_-	hypothetical protein	NA	A0A173GC04	Salmonella_phage	57.1	2.4e-208
AXF64992.1|2707511_2708009_-	hypothetical protein	NA	NA	NA	NA	NA
AXF64993.1|2708158_2708902_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	53.5	4.4e-59
AXF64994.1|2709919_2710651_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
AXF64995.1|2710696_2711365_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	47.3	7.2e-53
AXF64996.1|2711425_2712169_-	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	84.0	1.8e-73
AXF64997.1|2712234_2712618_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	62.2	7.5e-39
AXF64998.1|2712614_2712983_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	86.1	1.1e-52
AXF64999.1|2712984_2713341_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	62.4	4.0e-34
AXF65000.1|2713340_2713514_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	52.6	4.6e-12
AXF65001.1|2713513_2713915_-	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	88.5	3.3e-61
AXF65002.1|2713973_2714267_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	84.5	8.8e-40
AXF65003.1|2714276_2715353_-	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	91.0	1.5e-190
AXF65004.1|2715370_2715820_-	hypothetical protein	NA	H6WRT3	Salmonella_phage	84.6	2.1e-64
AXF65005.1|2715832_2717098_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	89.1	8.1e-215
AXF65006.1|2717100_2718030_-|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	89.0	7.4e-157
AXF65007.1|2717986_2719339_-	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	90.6	2.5e-238
AXF65008.1|2719579_2719780_-	hypothetical protein	NA	NA	NA	NA	NA
AXF65009.1|2719837_2721088_-|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	96.2	2.2e-212
AXF65010.1|2721084_2721519_-	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	75.6	3.4e-48
AXF65011.1|2721527_2721737_-	hypothetical protein	NA	NA	NA	NA	NA
AXF65012.1|2721848_2722076_-	hypothetical protein	NA	NA	NA	NA	NA
AXF65013.1|2722348_2722825_-	Rz lytic protein	NA	NA	NA	NA	NA
AXF65014.1|2722812_2723457_-	glycoside hydrolase family 19 protein	NA	F1C5D2	Cronobacter_phage	44.3	8.8e-40
AXF65015.1|2723440_2723812_-|holin	holin	holin	A0A2H4J1U5	uncultured_Caudovirales_phage	30.2	7.3e-07
AXF65016.1|2724195_2724960_-	antitermination protein	NA	Q5G8R6	Enterobacteria_phage	74.8	3.1e-108
AXF65017.1|2725066_2725246_-	hypothetical protein	NA	NA	NA	NA	NA
AXF65018.1|2725242_2725881_-	hypothetical protein	NA	S4TSR3	Salmonella_phage	78.3	1.1e-90
AXF65019.1|2725873_2726044_-	NinE family protein	NA	G8C7V4	Escherichia_phage	75.0	7.9e-17
AXF65020.1|2726036_2726474_-	recombination protein NinB	NA	Q5G8S5	Enterobacteria_phage	59.3	1.5e-43
AXF65021.1|2726699_2726894_-	hypothetical protein	NA	NA	NA	NA	NA
AXF65022.1|2726893_2727478_-	hypothetical protein	NA	E5DV63	Deep-sea_thermophilic_phage	41.8	2.0e-30
AXF67011.1|2727481_2728006_-	DUF551 domain-containing protein	NA	K7P6H7	Enterobacteria_phage	40.8	1.4e-08
AXF65023.1|2728080_2728350_-	hypothetical protein	NA	A0A0A6Z584	Enterobacter_phage	79.1	4.6e-11
AXF65024.1|2728354_2728609_-	hypothetical protein	NA	A0A248SKU1	Klebsiella_phage	50.7	1.1e-14
AXF65025.1|2729069_2729537_-	transcriptional regulator	NA	NA	NA	NA	NA
AXF65026.1|2729533_2731420_-	toprim domain-containing protein	NA	A0A0M4R313	Salmonella_phage	79.5	9.3e-308
AXF65027.1|2733271_2733517_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	53.5	3.7e-15
AXF65028.1|2733644_2734337_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	53.2	1.8e-59
AXF65029.1|2734926_2735238_+	hypothetical protein	NA	NA	NA	NA	NA
AXF65030.1|2735221_2735479_+	hypothetical protein	NA	NA	NA	NA	NA
AXF65031.1|2735628_2735808_+	hypothetical protein	NA	NA	NA	NA	NA
AXF65032.1|2735959_2736169_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	82.6	1.6e-27
AXF65033.1|2736179_2736512_+	hypothetical protein	NA	NA	NA	NA	NA
AXF65034.1|2736584_2736869_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	68.1	1.6e-30
AXF65035.1|2736892_2737789_+	DNA recombinase	NA	G8C7T0	Escherichia_phage	71.4	6.3e-121
AXF65036.1|2737785_2738268_+	hypothetical protein	NA	G8C7S9	Escherichia_phage	82.5	1.7e-67
AXF65037.1|2738548_2738728_+	hypothetical protein	NA	G8C7S7	Escherichia_phage	78.0	5.4e-16
AXF65038.1|2738724_2739276_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	57.7	1.6e-53
AXF67012.1|2739281_2739497_+	hypothetical protein	NA	NA	NA	NA	NA
AXF65039.1|2739499_2740603_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	66.3	2.4e-138
AXF65040.1|2740565_2740805_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	43.6	7.8e-10
AXF65041.1|2740814_2741432_+	Eac protein	NA	A0A220NQT7	Salmonella_phage	75.1	8.8e-90
AXF67013.1|2741542_2741791_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	8.3e-15
AXF65042.1|2741823_2743104_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	50.7	1.6e-122
>prophage 5
CP031101	Enterobacteriaceae bacterium w17 chromosome, complete genome	4811348	2927492	2981939	4811348	tRNA,terminase,portal,transposase,capsid,integrase,tail,head,lysis	Enterobacteria_phage(50.0%)	65	2941677:2941691	2980857:2980871
AXF65219.1|2927492_2927732_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	64.1	2.3e-22
AXF65220.1|2927816_2928473_-|tail	tail fiber domain-containing protein	tail	A0A0E3JSS4	Enterobacteria_phage	34.6	1.5e-15
AXF65221.1|2929818_2931270_-	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	39.2	1.0e-32
AXF65222.1|2931347_2932016_-	hypothetical protein	NA	O64337	Escherichia_phage	67.3	2.4e-77
AXF65223.1|2932015_2932318_-	hypothetical protein	NA	O64336	Escherichia_phage	87.0	1.0e-43
AXF65224.1|2932317_2935722_-	DUF1983 domain-containing protein	NA	E4WL39	Enterobacteria_phage	65.9	0.0e+00
AXF65225.1|2935775_2936402_-|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	73.1	7.9e-78
AXF65226.1|2936379_2937126_-	peptidase P60	NA	M9NZD8	Enterobacteria_phage	72.8	5.1e-108
AXF65227.1|2937128_2937866_-|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	83.3	1.3e-124
AXF65228.1|2937923_2938262_-|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	86.6	5.6e-54
AXF65229.1|2938264_2940760_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	71.9	0.0e+00
AXF65230.1|2940737_2941058_-|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	90.5	1.8e-49
AXF65231.1|2941066_2941480_-|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	67.1	7.3e-40
AXF65232.1|2941515_2942253_-|tail	phage tail protein	tail	O64327	Escherichia_phage	87.3	2.9e-116
2941677:2941691	attL	CTGAAGCGCTGGCTG	NA	NA	NA	NA
AXF65233.1|2942260_2942659_-|tail	phage tail protein	tail	K7P7G5	Enterobacteria_phage	87.1	5.4e-64
AXF65234.1|2942655_2943210_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	95.7	1.4e-78
AXF65235.1|2943219_2943573_-|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	88.0	5.3e-55
AXF65236.1|2943583_2943991_-	DNA-packaging protein	NA	K7P7M3	Enterobacteria_phage	79.7	1.4e-35
AXF65237.1|2944036_2945062_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	89.1	3.0e-175
AXF65238.1|2945117_2945450_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	92.7	1.1e-51
AXF65239.1|2945459_2946785_-	S49 family peptidase	NA	O64320	Escherichia_phage	83.2	2.6e-187
AXF65240.1|2946765_2948358_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	91.9	1.0e-291
AXF65241.1|2948354_2948561_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	89.7	1.8e-26
AXF65242.1|2948560_2950483_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	92.7	0.0e+00
AXF65243.1|2950457_2951003_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	95.0	4.9e-92
AXF67023.1|2951311_2951485_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AXF65244.1|2951923_2952151_-	hypothetical protein	NA	NA	NA	NA	NA
AXF65245.1|2953250_2953709_-|lysis	lysis protein	lysis	F1C590	Cronobacter_phage	68.7	2.9e-45
AXF65246.1|2953698_2954202_-	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	76.0	5.5e-74
AXF65247.1|2954202_2954442_-|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	55.3	1.9e-16
AXF65248.1|2954963_2955287_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AXF65249.1|2955448_2955634_-	hypothetical protein	NA	NA	NA	NA	NA
AXF65250.1|2956812_2957427_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	60.9	1.3e-64
AXF65251.1|2957440_2958472_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	56.8	9.2e-108
AXF67024.1|2958471_2958804_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	63.9	4.2e-38
AXF65252.1|2958824_2959031_-	hypothetical protein	NA	NA	NA	NA	NA
AXF65253.1|2959161_2959407_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	66.7	4.5e-21
AXF65254.1|2959443_2959677_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	75.3	1.2e-26
AXF65255.1|2959951_2960650_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.5	2.2e-89
AXF65256.1|2960735_2961056_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.7	2.6e-21
AXF65257.1|2961100_2962390_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	4.9e-167
AXF65258.1|2962402_2962828_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	8.6e-52
AXF65259.1|2962949_2963210_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	64.3	4.2e-25
AXF65260.1|2963213_2963633_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AXF67025.1|2963648_2964239_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	77.5	7.0e-68
AXF65261.1|2965155_2965710_-	hypothetical protein	NA	NA	NA	NA	NA
AXF65262.1|2965719_2965932_-	XRE family transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	60.6	1.6e-14
AXF65263.1|2966034_2966442_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	64.9	7.0e-19
AXF65264.1|2966652_2966847_+	hypothetical protein	NA	NA	NA	NA	NA
AXF65265.1|2966843_2967026_+	DUF1482 family protein	NA	NA	NA	NA	NA
AXF65266.1|2967190_2967526_+	hypothetical protein	NA	NA	NA	NA	NA
AXF65267.1|2967529_2967871_+	transcriptional regulator	NA	NA	NA	NA	NA
AXF65268.1|2970658_2970904_+	excisionase	NA	NA	NA	NA	NA
AXF65269.1|2970884_2972015_+|integrase	integrase	integrase	O21925	Phage_21	58.5	4.4e-119
AXF65270.1|2972132_2973383_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
AXF65271.1|2973500_2974172_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AXF65272.1|2974164_2974638_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AXF65273.1|2974634_2975789_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AXF65274.1|2975816_2976446_+	lysogenization regulator HflD	NA	NA	NA	NA	NA
AXF65275.1|2976465_2977836_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.2	6.5e-109
AXF65276.1|2977960_2978632_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AXF65277.1|2978632_2980096_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AXF65278.1|2980185_2981307_+	cupin domain-containing protein	NA	NA	NA	NA	NA
2980857:2980871	attR	CAGCCAGCGCTTCAG	NA	NA	NA	NA
AXF65279.1|2981219_2981438_-	hypothetical protein	NA	NA	NA	NA	NA
AXF65280.1|2981447_2981939_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
CP031101	Enterobacteriaceae bacterium w17 chromosome, complete genome	4811348	3855540	3895587	4811348	holin,coat,terminase,portal,integrase	Enterobacteria_phage(31.71%)	58	3855373:3855419	3895602:3895648
3855373:3855419	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATT	NA	NA	NA	NA
AXF66057.1|3855540_3855858_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	2.0e-21
AXF66058.1|3855857_3856097_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	63.3	2.3e-22
AXF66059.1|3856186_3858247_-	hypothetical protein	NA	A0A088CQ58	Enterobacteria_phage	59.4	1.1e-40
AXF67063.1|3858382_3858637_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	63.9	1.4e-20
AXF67064.1|3858683_3859061_-	hypothetical protein	NA	NA	NA	NA	NA
AXF66060.1|3859170_3859494_+	hypothetical protein	NA	Q9AYY8	Salmonella_phage	63.8	1.5e-11
AXF66061.1|3859494_3861594_-	DNA transfer protein	NA	Q9AYY9	Salmonella_phage	72.8	4.4e-242
AXF66062.1|3861593_3862925_-	DNA transfer protein	NA	I1TEJ5	Salmonella_phage	53.7	3.2e-105
AXF66063.1|3863552_3863936_-	hypothetical protein	NA	NA	NA	NA	NA
AXF66064.1|3863944_3864706_-	hypothetical protein	NA	Q9AYZ3	Salmonella_phage	40.2	3.4e-35
AXF66065.1|3864705_3866124_-	hypothetical protein	NA	I1TEJ1	Salmonella_phage	81.4	3.8e-229
AXF66066.1|3866083_3866587_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	80.8	3.4e-71
AXF66067.1|3866570_3867194_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	62.4	4.3e-60
AXF66068.1|3867246_3868536_-|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	84.8	1.5e-208
AXF66069.1|3868535_3869450_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	78.3	1.3e-121
AXF66070.1|3869463_3871638_-|portal	portal protein	portal	A0A075B8I1	Enterobacteria_phage	78.1	0.0e+00
AXF66071.1|3871637_3873137_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	89.7	8.5e-280
AXF66072.1|3873114_3873603_-	DNA-packaging protein	NA	G8EYI7	Enterobacteria_phage	91.4	4.1e-82
AXF66073.1|3873685_3873976_-	hypothetical protein	NA	NA	NA	NA	NA
AXF66074.1|3874025_3874214_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	77.3	2.4e-14
AXF66075.1|3874170_3874443_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	61.9	4.4e-17
AXF66076.1|3874439_3874982_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	71.5	5.4e-75
AXF66077.1|3874978_3875260_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	41.0	1.4e-10
AXF66078.1|3875256_3875655_-	hypothetical protein	NA	NA	NA	NA	NA
AXF66079.1|3875992_3876682_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.2	6.9e-59
AXF66080.1|3876678_3876801_-	hypothetical protein	NA	NA	NA	NA	NA
AXF66081.1|3876797_3877433_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	81.7	8.8e-93
AXF66082.1|3877425_3877596_-	NinE family protein	NA	G8C7V4	Escherichia_phage	75.0	7.9e-17
AXF66083.1|3877588_3878026_-	recombination protein NinB	NA	Q5G8S5	Enterobacteria_phage	59.3	1.5e-43
AXF66084.1|3878251_3878446_-	hypothetical protein	NA	NA	NA	NA	NA
AXF66085.1|3878445_3879030_-	hypothetical protein	NA	E5DV63	Deep-sea_thermophilic_phage	41.8	2.0e-30
AXF66086.1|3879033_3879531_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
AXF66087.1|3879527_3879893_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	91.7	2.9e-64
AXF66088.1|3879896_3880331_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
AXF66089.1|3880327_3880531_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	80.0	1.3e-21
AXF66090.1|3880964_3881432_-	transcriptional regulator	NA	NA	NA	NA	NA
AXF66091.1|3881428_3883312_-	toprim domain-containing protein	NA	A0A0M4R313	Salmonella_phage	80.0	3.4e-310
AXF66092.1|3883426_3884281_-	replication protein	NA	C6ZR51	Salmonella_phage	77.4	3.5e-113
AXF66093.1|3884459_3884744_-	hypothetical protein	NA	Q5G8T2	Enterobacteria_phage	61.7	8.1e-22
AXF66094.1|3884884_3885070_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	93.4	5.6e-24
AXF66095.1|3885149_3885800_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	82.9	6.2e-102
AXF67065.1|3886161_3886524_+	antitermination protein	NA	C6ZR44	Salmonella_phage	72.5	6.2e-43
AXF66096.1|3887073_3887484_+	hypothetical protein	NA	NA	NA	NA	NA
AXF66097.1|3887577_3887823_+	hypothetical protein	NA	NA	NA	NA	NA
AXF66098.1|3887982_3888222_+	hypothetical protein	NA	NA	NA	NA	NA
AXF66099.1|3888373_3888532_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
AXF66100.1|3888518_3888743_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
AXF66101.1|3888809_3889007_+	thioredoxin reductase	NA	NA	NA	NA	NA
AXF66102.1|3889158_3889884_+	recombinase	NA	Q76H40	Enterobacteria_phage	66.9	6.3e-87
AXF66103.1|3889884_3890367_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	77.6	4.5e-57
AXF66104.1|3890436_3890766_+	hypothetical protein	NA	NA	NA	NA	NA
AXF66105.1|3890762_3890942_+	hypothetical protein	NA	G8C7S7	Escherichia_phage	70.0	1.3e-14
AXF66106.1|3891187_3891460_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	59.5	4.2e-20
AXF66107.1|3891515_3892016_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	53.6	3.0e-35
AXF66108.1|3892124_3892343_+	TraR/DksA family transcriptional regulator	NA	A0A2I7S9S9	Vibrio_phage	44.4	1.2e-06
AXF67066.1|3892654_3893023_+	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	53.3	4.2e-31
AXF66109.1|3893414_3893624_+	hypothetical protein	NA	NA	NA	NA	NA
AXF66110.1|3894423_3895587_+|integrase	site-specific integrase	integrase	F1C5B2	Cronobacter_phage	93.2	9.7e-215
3895602:3895648	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATT	NA	NA	NA	NA
>prophage 1
CP031102	Enterobacteriaceae bacterium w17 plasmid pW17-1, complete sequence	221681	4859	13442	221681	transposase	uncultured_Caudovirales_phage(85.71%)	10	NA	NA
AXF67099.1|4859_6338_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
AXF67100.1|6356_7184_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
AXF67101.1|7243_7669_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
AXF67102.1|7681_8971_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
AXF67295.1|9016_9337_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
AXF67103.1|9423_10128_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
AXF67104.1|10160_11564_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AXF67105.1|11755_12073_+	hypothetical protein	NA	NA	NA	NA	NA
AXF67106.1|12095_12278_+	hypothetical protein	NA	NA	NA	NA	NA
AXF67107.1|12291_13442_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.5	5.4e-48
>prophage 2
CP031102	Enterobacteriaceae bacterium w17 plasmid pW17-1, complete sequence	221681	172667	211737	221681	transposase	Salmonella_phage(33.33%)	39	NA	NA
AXF67248.1|172667_173672_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXF67249.1|173750_176717_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
AXF67250.1|176875_177166_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AXF67251.1|177162_177564_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AXF67252.1|177553_177910_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXF67253.1|178164_178491_+	hypothetical protein	NA	NA	NA	NA	NA
AXF67254.1|178487_178988_+|transposase	transposase	transposase	NA	NA	NA	NA
AXF67255.1|178984_179356_+	hypothetical protein	NA	NA	NA	NA	NA
AXF67256.1|179349_179907_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AXF67257.1|182926_183913_-	hypothetical protein	NA	NA	NA	NA	NA
AXF67258.1|184833_185226_+	hypothetical protein	NA	NA	NA	NA	NA
AXF67259.1|185204_185516_+	hypothetical protein	NA	NA	NA	NA	NA
AXF67260.1|185884_186541_+	hypothetical protein	NA	NA	NA	NA	NA
AXF67261.1|186743_187241_+	hypothetical protein	NA	NA	NA	NA	NA
AXF67262.1|187245_188634_+	hypothetical protein	NA	NA	NA	NA	NA
AXF67301.1|189034_189328_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXF67263.1|189332_190658_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AXF67264.1|190718_190925_+	hypothetical protein	NA	NA	NA	NA	NA
AXF67265.1|191025_191436_+	hypothetical protein	NA	NA	NA	NA	NA
AXF67266.1|191448_192264_+	HNH endonuclease	NA	G0X580	Salmonella_phage	37.2	2.5e-15
AXF67267.1|192516_192942_+	hypothetical protein	NA	NA	NA	NA	NA
AXF67268.1|193490_193799_+	hypothetical protein	NA	NA	NA	NA	NA
AXF67269.1|193814_194672_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
AXF67270.1|194733_194937_+	hypothetical protein	NA	NA	NA	NA	NA
AXF67271.1|195278_195683_-	DNA-binding protein	NA	NA	NA	NA	NA
AXF67272.1|195860_196154_-	hypothetical protein	NA	NA	NA	NA	NA
AXF67273.1|196179_196416_-	hypothetical protein	NA	NA	NA	NA	NA
AXF67274.1|196456_196912_-	hypothetical protein	NA	NA	NA	NA	NA
AXF67275.1|197026_197149_+	ABC transporter	NA	NA	NA	NA	NA
AXF67276.1|197187_198168_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
AXF67277.1|198213_198837_-	hypothetical protein	NA	NA	NA	NA	NA
AXF67278.1|198894_199275_-	hypothetical protein	NA	NA	NA	NA	NA
AXF67279.1|203430_204135_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
AXF67280.1|205027_206053_+	AAA family ATPase	NA	NA	NA	NA	NA
AXF67281.1|206246_206915_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.9	2.7e-23
AXF67282.1|206890_208240_+	sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.6	2.9e-08
AXF67283.1|208452_208929_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AXF67284.1|209005_210625_-	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
AXF67285.1|210813_211737_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	2.4e-176
>prophage 1
CP031103	Enterobacteriaceae bacterium w17 plasmid pW17-2, complete sequence	92616	7078	18366	92616	transposase	uncultured_Caudovirales_phage(57.14%)	9	NA	NA
AXF67306.1|7078_10063_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.8	9.6e-299
AXF67307.1|10221_10800_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	37.2	3.3e-22
AXF67308.1|10975_12181_+	chromate transporter	NA	NA	NA	NA	NA
AXF67309.1|12191_12497_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXF67310.1|12620_13319_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.4	3.4e-90
AXF67311.1|13404_13725_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	2.9e-20
AXF67386.1|13769_15059_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	4.4e-168
AXF67312.1|15071_15500_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	68.6	1.8e-49
AXF67313.1|15723_18366_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.4	1.8e-155
