The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	349739	448712	4784688	integrase,tail,capsid,protease,holin,transposase,portal,head,terminase	Escherichia_phage(49.02%)	106	375370:375386	442836:442852
AXF68397.1|349739_350948_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.5	1.4e-208
AXF68398.1|352016_352145_-	antitermination protein	NA	NA	NA	NA	NA
AXF68399.1|352359_353157_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXF68400.1|353166_353718_-	kinase inhibitor	NA	NA	NA	NA	NA
AXF68401.1|353886_354219_-	multidrug SMR transporter	NA	NA	NA	NA	NA
AXF68402.1|354552_354867_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AXF68403.1|355858_357517_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
AXF68404.1|357509_358505_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AXF68405.1|358814_359501_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AXF68406.1|359500_360874_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
AXF68407.1|360892_361336_+	flagellar protein FliJ	NA	NA	NA	NA	NA
AXF68408.1|361332_362460_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
AXF68409.1|362564_363029_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AXF68410.1|363033_364038_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AXF68411.1|364034_364448_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AXF68412.1|364450_364816_+	flagellar protein FliO	NA	NA	NA	NA	NA
AXF68413.1|364815_365553_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AXF68414.1|365562_365832_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AXF68415.1|365840_366626_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
AXF68416.1|366915_367539_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
AXF68417.1|367582_367825_-	protein DsrB	NA	NA	NA	NA	NA
AXF68418.1|367933_368161_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AXF68419.1|368458_369277_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AXF68420.1|369273_370968_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
AXF68421.1|370888_371077_-	hypothetical protein	NA	NA	NA	NA	NA
AXF68422.1|371177_371360_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AXF68423.1|371438_372356_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AXF68424.1|372528_373449_+	EamA family transporter	NA	NA	NA	NA	NA
AXF68425.1|373437_373908_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	4.0e-34
AXF68426.1|373888_375307_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
375370:375386	attL	GCGCTCAGCCAGCAGGT	NA	NA	NA	NA
AXF68427.1|377415_378774_-	HAMP domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	3.9e-05
AXF72464.1|378773_379445_-	DNA-binding response regulator HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AXF68428.1|379577_379991_+	5-hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AXF68429.1|380099_381104_+	sulfoxide reductase	NA	NA	NA	NA	NA
AXF68430.1|381104_381740_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AXF68431.1|381996_382647_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AXF68432.1|382989_383520_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	99.1	2.5e-56
AXF68433.1|383542_383785_+	hypothetical protein	NA	NA	NA	NA	NA
AXF68434.1|384499_384787_-	hypothetical protein	NA	NA	NA	NA	NA
AXF68435.1|384800_385502_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	62.3	4.1e-59
AXF68436.1|385511_385793_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	9.1e-18
AXF68437.1|385792_388189_-|tail	phage tail protein	tail	I1TE37	Escherichia_virus	41.0	2.8e-83
AXF68438.1|388253_388853_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.0	4.8e-101
AXF68439.1|388920_392400_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
AXF68440.1|392460_393132_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.8	9.9e-103
AXF68441.1|393029_393773_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.6	8.8e-153
AXF68442.1|393777_394476_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	2.0e-130
AXF68443.1|394475_394832_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
AXF68444.1|394809_398037_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.1	0.0e+00
AXF72465.1|398083_398344_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	98.8	7.1e-41
AXF68445.1|398385_398772_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
AXF68446.1|398771_399476_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
AXF68447.1|399535_399880_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
AXF68448.1|399876_400326_-	hypothetical protein	NA	S4TR46	Salmonella_phage	79.9	1.0e-63
AXF68449.1|400322_400661_-|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
AXF68450.1|400669_400975_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
AXF68451.1|400986_401175_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	98.4	1.6e-26
AXF68452.1|401226_402432_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.3	1.2e-223
AXF68453.1|402446_403133_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.6	2.1e-124
AXF68454.1|403074_404316_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
AXF68455.1|404315_404498_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
AXF68456.1|404509_406267_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
AXF68457.1|406266_406749_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
AXF68458.1|406897_407248_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	1.4e-63
AXF68459.1|407386_407926_+	hypothetical protein	NA	NA	NA	NA	NA
AXF68460.1|407931_408198_-	hypothetical protein	NA	NA	NA	NA	NA
AXF68461.1|408415_408601_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
AXF68462.1|408817_409351_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
AXF68463.1|409414_409765_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
AXF68464.1|409769_409985_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
AXF68465.1|410780_411470_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	9.6e-61
AXF68466.1|411466_411832_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	3.2e-39
AXF68467.1|411832_412888_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	7.5e-89
AXF68468.1|412889_413168_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
AXF68469.1|413464_413857_-	hypothetical protein	NA	NA	NA	NA	NA
AXF68470.1|414000_414213_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
AXF68471.1|414447_414963_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	75.5	2.8e-36
AXF68472.1|415128_415311_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	1.2e-26
AXF68473.1|415404_415761_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
AXF68474.1|415814_416240_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	1.3e-63
AXF68475.1|416280_417351_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	3.8e-64
AXF68476.1|417422_417848_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AXF68477.1|417844_418072_-	cell division protein	NA	NA	NA	NA	NA
AXF68478.1|418168_418816_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	8.9e-08
AXF72466.1|419093_419249_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AXF68479.1|419208_419379_+	hypothetical protein	NA	NA	NA	NA	NA
AXF68480.1|419408_419627_+	hypothetical protein	NA	NA	NA	NA	NA
AXF68481.1|420194_420383_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AXF68482.1|420379_420571_+	DUF1482 family protein	NA	NA	NA	NA	NA
AXF68483.1|420664_423136_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
AXF68484.1|423194_423398_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AXF68485.1|423397_424423_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
AXF72467.1|424658_425456_+	protein MtfA	NA	NA	NA	NA	NA
AXF68486.1|425918_433022_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
AXF68487.1|434650_435967_+	shikimate transporter	NA	NA	NA	NA	NA
AXF68488.1|436068_437523_+	AMP nucleosidase	NA	NA	NA	NA	NA
AXF68489.1|437865_438582_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXF68490.1|439211_440699_-	FMN/FAD transporter	NA	NA	NA	NA	NA
AXF68491.1|440972_441923_-	transcriptional regulator	NA	NA	NA	NA	NA
AXF68492.1|442024_442942_-	nitrogen assimilation regulatory protein nac	NA	NA	NA	NA	NA
442836:442852	attR	ACCTGCTGGCTGAGCGC	NA	NA	NA	NA
AXF68493.1|443399_444332_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AXF68494.1|444396_445476_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AXF68495.1|445487_446231_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AXF68496.1|446227_446773_-	adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase	NA	NA	NA	NA	NA
AXF68497.1|446924_447047_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
AXF68498.1|447438_448712_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
>prophage 2
CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	611691	619999	4784688		Enterobacteria_phage(83.33%)	9	NA	NA
AXF68638.1|611691_613692_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
AXF68639.1|613816_614278_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	99.3	5.4e-76
AXF68640.1|614317_614788_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AXF68641.1|614834_615554_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AXF68642.1|615550_617236_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AXF68643.1|617457_618189_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AXF68644.1|618248_618356_+	hypothetical protein	NA	NA	NA	NA	NA
AXF68645.1|618336_619068_-	ABC transporter permease	NA	NA	NA	NA	NA
AXF68646.1|619072_619999_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 3
CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	888032	898062	4784688	transposase	Escherichia_phage(50.0%)	8	NA	NA
AXF68879.1|888032_891530_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	3.5e-98
AXF68880.1|891899_892106_+	alkaline phosphatase	NA	NA	NA	NA	NA
AXF68881.1|892390_892537_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AXF68882.1|892563_892920_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.6e-33
AXF68883.1|893204_894418_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AXF68884.1|894443_894635_-	hypothetical protein	NA	A0A0N7BVE9	Escherichia_phage	93.2	5.2e-25
AXF68885.1|896666_897485_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	2.7e-46
AXF68886.1|897576_898062_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	4.0e-13
>prophage 4
CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	1042038	1048252	4784688	transposase	Escherichia_phage(66.67%)	8	NA	NA
AXF69014.1|1042038_1042191_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
AXF69015.1|1042208_1042385_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	96.4	3.8e-22
AXF69016.1|1042431_1043593_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
AXF69017.1|1043722_1043869_+	succinate dehydrogenase	NA	NA	NA	NA	NA
AXF69018.1|1043971_1044490_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	8.5e-62
AXF69019.1|1044505_1045045_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	94.4	3.8e-44
AXF69020.1|1045139_1046717_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
AXF69021.1|1046785_1048252_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 5
CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	1251815	1258955	4784688		Escherichia_phage(83.33%)	6	NA	NA
AXF69205.1|1251815_1254377_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
AXF69206.1|1254482_1255139_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	45.8	1.1e-48
AXF69207.1|1255189_1255957_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AXF69208.1|1256152_1257061_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AXF69209.1|1257057_1258320_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
AXF69210.1|1258316_1258955_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 6
CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	2501435	2582051	4784688	integrase,tail,capsid,protease,tRNA,holin,plate,lysis,transposase,portal,head,terminase	Escherichia_phage(32.0%)	94	2532109:2532155	2566108:2566154
AXF70363.1|2501435_2501873_+|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AXF70364.1|2501869_2502859_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXF70365.1|2502922_2503831_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXF70366.1|2504059_2504371_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXF70367.1|2504371_2504662_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXF72537.1|2505272_2505485_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AXF70368.1|2505727_2505946_+	hypothetical protein	NA	NA	NA	NA	NA
AXF70369.1|2506275_2507205_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
AXF70370.1|2507201_2507837_-	formate dehydrogenase cytochrome b556(fdo) subunit	NA	NA	NA	NA	NA
AXF70371.1|2507833_2508736_-	formate dehydrogenase-O iron-sulfur subunit	NA	NA	NA	NA	NA
AXF70372.1|2508748_2511799_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
AXF70373.1|2511802_2512057_+	hypothetical protein	NA	NA	NA	NA	NA
AXF70374.1|2511992_2512826_+	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AXF70375.1|2512978_2514019_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
AXF70376.1|2514068_2515817_-	HTH domain-containing protein	NA	NA	NA	NA	NA
AXF70377.1|2515816_2516887_-	aminopeptidase	NA	NA	NA	NA	NA
AXF70378.1|2516876_2518328_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
AXF70379.1|2518338_2518785_-	fructose-like phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AXF70380.1|2519097_2519412_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
AXF70381.1|2519421_2520246_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
AXF70382.1|2520487_2521747_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
AXF70383.1|2521743_2523213_-	rhamnulokinase	NA	NA	NA	NA	NA
AXF70384.1|2523500_2524337_+	transcriptional activator RhaS	NA	NA	NA	NA	NA
AXF70385.1|2524320_2525259_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
AXF70386.1|2525255_2526290_-	rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
AXF70387.1|2526574_2527195_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
AXF70388.1|2527369_2527477_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AXF70389.1|2527454_2528438_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AXF70390.1|2528586_2529261_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AXF70391.1|2529366_2530740_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
AXF70392.1|2530736_2531435_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AXF72538.1|2531584_2532085_+	periplasmic protein CpxP	NA	NA	NA	NA	NA
2532109:2532155	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
AXF70393.1|2532271_2533252_-|integrase	site-specific integrase	integrase	S4TP66	Salmonella_phage	99.4	2.3e-185
AXF70394.1|2533321_2533615_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	99.0	1.0e-48
AXF70395.1|2533751_2534024_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
AXF70396.1|2534193_2534694_+	replication protein B	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
AXF70397.1|2534757_2534982_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	8.8e-32
AXF70398.1|2534981_2535281_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	2.5e-45
AXF70399.1|2535283_2535508_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AXF70400.1|2535504_2535780_+	hypothetical protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
AXF70401.1|2535769_2538055_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	98.8	0.0e+00
AXF72539.1|2538054_2538507_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	6.1e-80
AXF70402.1|2538506_2538713_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
AXF70403.1|2538955_2539894_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
AXF70404.1|2539890_2540928_-	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	4.6e-200
AXF70405.1|2540920_2541994_-	hypothetical protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
AXF70406.1|2542409_2543444_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	2.4e-201
AXF70407.1|2543443_2545216_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AXF70408.1|2545389_2546244_+|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
AXF70409.1|2546302_2547376_+|capsid	phage major capsid protein, P2 family	capsid	Q778Z0	Enterobacteria_phage	99.7	2.5e-201
AXF70410.1|2547379_2548123_+|terminase	terminase	terminase	Q94MF3	Enterobacteria_phage	99.2	5.1e-124
AXF70411.1|2548222_2548732_+|head	head completion/stabilization protein	head	A0A0F7L9Y3	Escherichia_phage	100.0	1.9e-90
AXF70412.1|2548731_2548935_+|tail	phage tail protein	tail	A0A0F7LCK1	Escherichia_phage	98.5	8.8e-31
AXF70413.1|2548938_2549220_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
AXF70414.1|2549219_2549717_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AXF70415.1|2549731_2550157_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	100.0	1.8e-62
AXF70416.1|2550144_2550570_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	100.0	4.5e-69
AXF70417.1|2550541_2550715_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	1.5e-23
AXF70418.1|2550677_2551145_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	9.7e-81
AXF70419.1|2551137_2551590_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
AXF70420.1|2551656_2552292_+|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	99.5	1.3e-112
AXF70421.1|2552288_2552636_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AXF70422.1|2552640_2553549_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
AXF70423.1|2553541_2554072_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	1.3e-102
AXF70424.1|2554082_2556092_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	99.3	0.0e+00
AXF70425.1|2556095_2556623_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	95.4	1.8e-91
AXF70426.1|2556674_2557948_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
AXF70427.1|2558174_2559074_+	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	100.0	6.2e-169
AXF70428.1|2559393_2560584_+|tail	phage tail protein	tail	Q7Y4D1	Escherichia_virus	99.7	8.1e-225
AXF70429.1|2560596_2561115_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AXF70430.1|2561171_2561447_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AXF72540.1|2561479_2561599_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AXF70431.1|2561591_2564039_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	99.9	0.0e+00
AXF70432.1|2564053_2564533_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	100.0	5.1e-85
AXF70433.1|2564532_2565696_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	98.4	1.3e-206
AXF70434.1|2565741_2565996_+	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AXF70435.1|2566232_2567135_+	cation-efflux pump FieF	NA	NA	NA	NA	NA
2566108:2566154	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
AXF70436.1|2567315_2568278_+	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AXF70437.1|2568597_2569587_+	sulfate-binding protein	NA	NA	NA	NA	NA
AXF70438.1|2569693_2570449_+	CDP-diacylglycerol pyrophosphatase	NA	NA	NA	NA	NA
AXF70439.1|2570503_2571271_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
AXF70440.1|2571378_2571978_-	DUF1454 family protein	NA	NA	NA	NA	NA
AXF70441.1|2572078_2572519_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AXF70442.1|2572730_2573030_+	DUF406 family protein	NA	NA	NA	NA	NA
AXF70443.1|2573056_2573485_+	universal stress protein D	NA	NA	NA	NA	NA
AXF70444.1|2573489_2574236_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AXF70445.1|2574332_2575343_-	fructose 1,6-bisphosphatase	NA	NA	NA	NA	NA
AXF70446.1|2575477_2576986_-	glycerol kinase	NA	NA	NA	NA	NA
AXF70447.1|2577008_2577854_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
AXF70448.1|2578278_2578524_+	cell division protein ZapB	NA	NA	NA	NA	NA
AXF70449.1|2578608_2579094_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AXF70450.1|2579186_2580113_-	prenyltransferase	NA	NA	NA	NA	NA
AXF70451.1|2580179_2581511_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
AXF70452.1|2581520_2582051_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 7
CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	3353227	3360417	4784688		Enterobacteria_phage(33.33%)	7	NA	NA
AXF71126.1|3353227_3354283_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
AXF71127.1|3354570_3355674_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AXF71128.1|3355685_3356939_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
AXF71129.1|3357294_3358509_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	56.2	1.3e-132
AXF71130.1|3358673_3358889_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AXF71131.1|3358936_3359140_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
AXF71132.1|3359583_3360417_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
>prophage 8
CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	3628036	3682203	4784688	tail,capsid,tRNA,lysis,portal,holin,head,terminase	Enterobacteria_phage(46.15%)	58	NA	NA
AXF71377.1|3628036_3629131_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AXF71378.1|3629199_3630126_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
AXF71379.1|3630355_3630838_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
AXF71380.1|3630915_3631731_+	transcriptional regulator	NA	NA	NA	NA	NA
AXF71381.1|3631820_3633602_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	6.0e-38
AXF71382.1|3633614_3634391_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AXF71383.1|3634490_3635369_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AXF71384.1|3635537_3636992_+	putative allantoin permease	NA	NA	NA	NA	NA
AXF71385.1|3637051_3638413_+	allantoinase AllB	NA	NA	NA	NA	NA
AXF71386.1|3638469_3639771_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
AXF71387.1|3639792_3640938_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
AXF71388.1|3641066_3641852_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
AXF71389.1|3641862_3643098_-	allantoate amidohydrolase	NA	NA	NA	NA	NA
AXF71390.1|3643119_3644169_-	ureidoglycolate dehydrogenase (NAD(+))	NA	NA	NA	NA	NA
AXF71391.1|3644485_3646153_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AXF71392.1|3646162_3647422_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AXF71393.1|3647432_3648248_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AXF71394.1|3648244_3649138_+	carbamate kinase	NA	NA	NA	NA	NA
AXF71395.1|3649332_3650400_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AXF71396.1|3650396_3650906_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AXF71397.1|3651023_3651746_-	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AXF71398.1|3651748_3652243_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
AXF71399.1|3652416_3653802_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
AXF71400.1|3653837_3654359_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AXF71401.1|3654466_3654679_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AXF71402.1|3654680_3655547_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.2	1.3e-30
AXF71403.1|3656027_3656570_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AXF71404.1|3656789_3657482_+	molecular chaperone FimC	NA	NA	NA	NA	NA
AXF71405.1|3660133_3661141_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AXF71406.1|3661151_3661667_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AXF71407.1|3661669_3662302_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXF71408.1|3663655_3664111_-	DNA-binding protein	NA	U5P4J3	Shigella_phage	83.3	3.4e-62
AXF71409.1|3664026_3664332_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
AXF71410.1|3664331_3664694_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
AXF71411.1|3664684_3665221_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
AXF71412.1|3665348_3666173_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AXF71413.1|3666238_3666601_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
AXF72579.1|3667026_3667587_+	hypothetical protein	NA	NA	NA	NA	NA
AXF71414.1|3667712_3668096_+	antitermination protein	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
AXF71415.1|3668285_3669383_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
AXF71416.1|3669971_3670187_+|holin	holin	holin	A5LH82	Enterobacteria_phage	98.6	3.4e-33
AXF71417.1|3670186_3670684_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
AXF71418.1|3670680_3671142_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.0	1.7e-74
AXF71419.1|3671173_3671467_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
AXF71420.1|3671757_3672168_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
AXF71421.1|3672453_3672660_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
AXF71422.1|3672824_3673019_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
AXF72581.1|3673166_3673268_+	hypothetical protein	NA	NA	NA	NA	NA
AXF71423.1|3673407_3673953_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	5.2e-94
AXF71424.1|3673927_3675853_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
AXF71425.1|3675849_3676056_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	1.3e-29
AXF71426.1|3676052_3676412_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	96.2	1.6e-54
AXF71427.1|3676506_3677040_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	2.1e-92
AXF71428.1|3677012_3677150_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AXF72580.1|3677094_3677721_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXF71429.1|3677819_3678125_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
AXF71430.1|3679812_3680274_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
AXF71431.1|3680301_3682203_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	1.7e-27
>prophage 9
CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	4483125	4500285	4784688	tRNA	Escherichia_phage(75.0%)	26	NA	NA
AXF72614.1|4483125_4484358_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
AXF72176.1|4484612_4485596_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AXF72177.1|4485870_4486044_+	hypothetical protein	NA	NA	NA	NA	NA
AXF72178.1|4486073_4487447_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	5.6e-52
AXF72179.1|4487575_4488511_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	7.7e-146
AXF72180.1|4488562_4489798_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
AXF72181.1|4489799_4490015_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AXF72616.1|4490093_4490303_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AXF72615.1|4490295_4490490_-	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AXF72182.1|4490546_4491356_-	DNA recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AXF72183.1|4491348_4493949_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.6	7.9e-249
AXF72184.1|4494050_4494326_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AXF72617.1|4494400_4494571_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AXF72185.1|4494570_4494792_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	97.3	1.7e-35
AXF72618.1|4494920_4495199_+	hypothetical protein	NA	NA	NA	NA	NA
AXF72186.1|4495233_4495722_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
AXF72187.1|4495718_4495874_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AXF72188.1|4495884_4496064_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72189.1|4496051_4496270_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72190.1|4496306_4496726_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
AXF72191.1|4496805_4497060_+	DNA-binding protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AXF72192.1|4497056_4497479_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.1	5.0e-68
AXF72193.1|4497556_4498345_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.7	1.4e-42
AXF72194.1|4498351_4499098_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.9	1.3e-114
AXF72195.1|4499120_4499846_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.8	6.1e-82
AXF72196.1|4499862_4500285_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	86.9	2.2e-60
>prophage 10
CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	4503453	4517261	4784688	lysis,tail,transposase	Escherichia_phage(41.67%)	14	NA	NA
AXF72200.1|4503453_4504053_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.5	7.2e-105
AXF72201.1|4504052_4504343_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
AXF72202.1|4504339_4504882_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
AXF72619.1|4506167_4506383_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AXF72203.1|4506382_4506880_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
AXF72204.1|4507096_4507282_+	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AXF72205.1|4507478_4508936_+	potassium transporter TrkG	NA	NA	NA	NA	NA
AXF72206.1|4508874_4509156_+	hypothetical protein	NA	NA	NA	NA	NA
AXF72207.1|4509073_4509862_+	transcriptional regulator	NA	R4TG31	Halovirus	40.7	3.3e-49
AXF72208.1|4511554_4512154_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	90.5	5.4e-100
AXF72209.1|4512218_4514594_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
AXF72210.1|4514593_4514899_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	52.8	2.4e-16
AXF72211.1|4514895_4516168_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
AXF72212.1|4516220_4517261_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	84.1	1.6e-160
>prophage 11
CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	4728567	4779002	4784688	tail,protease,lysis,portal,terminase	Enterobacteria_phage(51.02%)	65	NA	NA
AXF72387.1|4728567_4730028_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	2.5e-42
AXF72388.1|4730116_4731400_-	MFS transporter	NA	NA	NA	NA	NA
AXF72389.1|4732185_4732419_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
AXF72390.1|4732737_4733328_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.8e-24
AXF72391.1|4733425_4733515_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	82.8	1.1e-06
AXF72629.1|4733555_4733849_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72392.1|4733891_4734932_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	4.9e-125
AXF72393.1|4734941_4735223_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	9.1e-18
AXF72394.1|4735219_4737607_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	48.5	9.9e-105
AXF72395.1|4737665_4741061_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.4	0.0e+00
AXF72396.1|4741121_4741769_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.1	2.7e-113
AXF72397.1|4741666_4742410_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	9.2e-150
AXF72398.1|4742415_4743114_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.4	1.1e-131
AXF72399.1|4743123_4743453_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AXF72400.1|4743452_4746509_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	98.1	0.0e+00
AXF72401.1|4746480_4746810_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AXF72630.1|4746818_4747205_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
AXF72402.1|4747265_4748009_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
AXF72631.1|4748019_4748421_-|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
AXF72403.1|4748417_4749008_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
AXF72404.1|4749019_4749295_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	6.6e-45
AXF72405.1|4749287_4749656_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	8.2e-51
AXF72406.1|4749697_4751725_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
AXF72407.1|4751669_4753178_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
AXF72408.1|4753177_4753390_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AXF72409.1|4753386_4755489_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
AXF72410.1|4755488_4755983_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
AXF72411.1|4756545_4756752_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
AXF72412.1|4756906_4757107_+	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	69.4	5.0e-10
AXF72413.1|4757052_4757463_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.0	1.0e-62
AXF72414.1|4757614_4757788_-	protein GnsB	NA	NA	NA	NA	NA
AXF72415.1|4757959_4758232_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72416.1|4758262_4758451_-	cold-shock protein	NA	NA	NA	NA	NA
AXF72417.1|4758461_4758674_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AXF72418.1|4759037_4759535_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AXF72419.1|4759531_4760065_-	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AXF72420.1|4760061_4760373_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AXF72421.1|4760377_4760593_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AXF72422.1|4761346_4761562_-	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AXF72423.1|4762237_4762990_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	2.1e-130
AXF72424.1|4763003_4764053_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.3	1.7e-112
AXF72425.1|4764054_4764333_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72426.1|4764399_4764651_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72427.1|4764867_4765080_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
AXF72428.1|4765635_4766301_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72429.1|4766354_4766588_-	methyltransferase	NA	I6S1S6	Salmonella_phage	67.9	2.9e-17
AXF72430.1|4766584_4767007_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.3e-65
AXF72431.1|4767047_4768067_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	5.2e-55
AXF72432.1|4767993_4768515_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72433.1|4768498_4768726_-	transcriptional regulator	NA	NA	NA	NA	NA
AXF72434.1|4768806_4769214_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
AXF72435.1|4769382_4769535_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
AXF72632.1|4769546_4769912_+	hypothetical protein	NA	NA	NA	NA	NA
AXF72436.1|4769880_4770081_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72437.1|4770592_4771447_+	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
AXF72438.1|4771457_4771646_+	cell division inhibitor	NA	NA	NA	NA	NA
AXF72439.1|4771642_4771834_+	DUF1482 family protein	NA	NA	NA	NA	NA
AXF72440.1|4771926_4774398_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	5.0e-59
AXF72441.1|4774470_4774722_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AXF72442.1|4774741_4776037_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	1.9e-155
AXF72443.1|4776062_4776167_-	transporter	NA	NA	NA	NA	NA
AXF72444.1|4776224_4777244_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
AXF72445.1|4777255_4778470_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AXF72446.1|4778450_4778639_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72447.1|4778675_4779002_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
>prophage 1
CP031107	Escherichia coli strain AMSCJX02 plasmid pAMSC2, complete sequence	203856	66038	119972	203856	transposase,integrase,protease	Macacine_betaherpesvirus(36.36%)	53	80699:80718	133678:133697
AXF72866.1|66038_67010_+|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	31.7	3.2e-25
AXF72867.1|67270_67483_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72868.1|67495_68071_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72869.1|69289_70261_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
AXF72870.1|70260_71427_-	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
AXF72871.1|73294_75037_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.4	2.7e-19
AXF72872.1|75039_76581_-	lasso peptide isopeptide bond-forming cyclase	NA	NA	NA	NA	NA
AXF72873.1|76583_77210_-	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
AXF72874.1|77549_77726_+	lasso peptide microcin J25	NA	NA	NA	NA	NA
AXF72875.1|78852_79065_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72876.1|79793_80051_+	hypothetical protein	NA	NA	NA	NA	NA
AXF72877.1|80146_80593_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	55.3	1.8e-28
80699:80718	attL	TATCACTTAAATAAGTGATA	NA	NA	NA	NA
AXF72878.1|80712_81985_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.0e-176
AXF72879.1|82861_83644_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.0	3.0e-50
AXF72880.1|83644_83950_-	toxin CcdB	NA	NA	NA	NA	NA
AXF72881.1|83951_84170_-	antitoxin CcdA	NA	NA	NA	NA	NA
AXF72985.1|84171_84450_+	hypothetical protein	NA	NA	NA	NA	NA
AXF72882.1|84414_84600_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72883.1|84725_85415_+	DNA-binding protein	NA	NA	NA	NA	NA
AXF72986.1|85446_86136_-	RES domain-containing protein	NA	NA	NA	NA	NA
AXF72987.1|86439_86577_+	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
AXF72884.1|86554_86785_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXF72885.1|86781_87198_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AXF72886.1|87359_89498_-	AAA family ATPase	NA	NA	NA	NA	NA
AXF72887.1|89884_90115_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXF72888.1|90111_90528_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AXF72889.1|90602_92168_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AXF72890.1|92152_93175_+	DNA helicase UvrD	NA	NA	NA	NA	NA
AXF72891.1|94217_94523_+	hypothetical protein	NA	NA	NA	NA	NA
AXF72892.1|94631_96833_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXF72893.1|96914_98192_-	L-lysine N6-monooxygenase	NA	NA	NA	NA	NA
AXF72894.1|98188_99931_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
AXF72895.1|99930_100878_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXF72896.1|100878_102666_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
AXF72897.1|102738_103932_+	MFS transporter	NA	NA	NA	NA	NA
AXF72898.1|104311_104692_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
AXF72899.1|104763_105036_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72900.1|105934_106792_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AXF72901.1|106788_107646_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AXF72902.1|107642_108470_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
AXF72903.1|108469_109384_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXF72904.1|109506_109698_-	prephenate dehydratase	NA	NA	NA	NA	NA
AXF72905.1|111659_111956_+	hypothetical protein	NA	NA	NA	NA	NA
AXF72906.1|112364_113342_+	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
AXF72907.1|113626_114367_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
AXF72908.1|114487_114676_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AXF72909.1|115050_115953_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
AXF72910.1|116021_117131_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
AXF72911.1|117189_117474_+	hypothetical protein	NA	NA	NA	NA	NA
AXF72912.1|117563_118517_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
AXF72913.1|118620_119010_+	GlcNAc transferase	NA	NA	NA	NA	NA
AXF72914.1|119376_119640_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72915.1|119789_119972_-|transposase	transposase	transposase	NA	NA	NA	NA
133678:133697	attR	TATCACTTAAATAAGTGATA	NA	NA	NA	NA
>prophage 2
CP031107	Escherichia coli strain AMSCJX02 plasmid pAMSC2, complete sequence	203856	132409	185620	203856	transposase,bacteriocin,protease	Stx2-converting_phage(22.73%)	44	NA	NA
AXF72922.1|132409_133683_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.8e-175
AXF72923.1|134344_134638_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AXF72924.1|135152_135335_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72988.1|137320_137584_+	hypothetical protein	NA	NA	NA	NA	NA
AXF72925.1|137782_138898_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
AXF72926.1|138911_142697_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.1	1.7e-45
AXF72927.1|142800_144030_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
AXF72928.1|144114_145071_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
AXF72929.1|145115_147293_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
AXF72930.1|147580_147808_+	hypothetical protein	NA	NA	NA	NA	NA
AXF72931.1|148031_148217_-	phospho-2-dehydro-3-deoxyheptonate aldolase	NA	NA	NA	NA	NA
AXF72932.1|148137_149172_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	42.6	1.1e-73
AXF72933.1|149189_149381_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72934.1|149731_150040_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72935.1|150138_150321_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXF72936.1|150317_150515_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
AXF72989.1|151229_152471_+	colicin V secretion protein CvaA	NA	NA	NA	NA	NA
AXF72937.1|152445_154560_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
AXF72938.1|154729_155041_-	colicin V	NA	NA	NA	NA	NA
AXF72939.1|155136_155343_+	hypothetical protein	NA	NA	NA	NA	NA
AXF72940.1|156194_156464_+	hypothetical protein	NA	NA	NA	NA	NA
AXF72941.1|156460_157441_+	FAD-binding protein	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
AXF72990.1|157516_157690_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	100.0	3.2e-21
AXF72942.1|157693_159265_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AXF72943.1|159284_159632_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	75.9	1.5e-46
AXF72944.1|159631_160279_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	2.4e-21
AXF72945.1|160327_161673_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.3	3.5e-75
AXF72946.1|161671_161941_+	hypothetical protein	NA	NA	NA	NA	NA
AXF72947.1|162025_162373_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AXF72948.1|164549_168683_-|protease	hemoglobin-binding protease autotransporter Hbp	protease	Q9LA54	Enterobacteria_phage	41.6	4.3e-297
AXF72949.1|169323_169692_+|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.9e-39
AXF72950.1|170711_171924_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.0	5.5e-168
AXF72951.1|172234_172600_+|transposase	transposase	transposase	NA	NA	NA	NA
AXF72952.1|173066_174077_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	1.1e-20
AXF72953.1|174665_176243_-	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
AXF72954.1|176552_177113_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AXF72955.1|177116_180083_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
AXF72956.1|180059_180257_-	hypothetical protein	NA	NA	NA	NA	NA
AXF72957.1|180299_180890_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	6.2e-24
AXF72958.1|181244_182243_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXF72959.1|182242_183280_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AXF72960.1|183279_184041_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	8.8e-15
AXF72961.1|184052_185285_+	MFS transporter	NA	NA	NA	NA	NA
AXF72962.1|185362_185620_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 1
CP031108	Escherichia coli strain AMSCJX02 plasmid pAMSC3, complete sequence	27197	0	5040	27197		Escherichia_phage(100.0%)	10	NA	NA
AXF72992.1|716_938_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	52.1	1.2e-09
AXF72993.1|930_1665_-	DUF551 domain-containing protein	NA	A0A2I6TCG8	Escherichia_phage	95.6	2.1e-77
AXF72994.1|1661_1952_-	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	99.0	4.3e-47
AXF72995.1|1951_2371_-	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	99.3	4.3e-72
AXF72996.1|2370_2928_-	3'-5' exoribonuclease	NA	A0A2I6TCA6	Escherichia_phage	98.4	1.6e-106
AXF72997.1|2995_3181_+	hypothetical protein	NA	NA	NA	NA	NA
AXF72998.1|3177_3423_-	hypothetical protein	NA	A0A2I6TCB2	Escherichia_phage	100.0	1.4e-43
AXF72999.1|3430_4141_-	phage antitermination protein	NA	A0A2I6TCB3	Escherichia_phage	100.0	8.8e-134
AXF73028.1|4130_4352_-	hypothetical protein	NA	A0A2I6TCB1	Escherichia_phage	100.0	2.1e-33
AXF73000.1|4443_5040_+	XRE family transcriptional regulator	NA	A0A2I6TCW0	Escherichia_phage	100.0	2.8e-109
>prophage 2
CP031108	Escherichia coli strain AMSCJX02 plasmid pAMSC3, complete sequence	27197	9470	27005	27197		Escherichia_phage(95.65%)	26	NA	NA
AXF73002.1|9470_9797_+	hypothetical protein	NA	O64345	Escherichia_phage	63.6	1.6e-34
AXF73003.1|9799_10195_+	hypothetical protein	NA	A0A2I6TCB8	Escherichia_phage	97.7	6.5e-70
AXF73004.1|10885_11050_+	host cell division inhibitor Icd-like protein	NA	A0A2I6TCE0	Escherichia_phage	98.1	1.9e-20
AXF73005.1|11046_11280_+	hypothetical protein	NA	A0A2I6TCC2	Escherichia_phage	92.2	7.8e-31
AXF73006.1|11276_11441_+	hypothetical protein	NA	A0A2I6TCD0	Escherichia_phage	94.1	7.4e-20
AXF73007.1|11486_13406_-	protelomerase	NA	A0A2I6TCW8	Escherichia_phage	98.7	0.0e+00
AXF73008.1|13788_15708_+	protelomerase	NA	A0A2I6TCW8	Escherichia_phage	98.7	0.0e+00
AXF73009.1|15753_15918_-	hypothetical protein	NA	A0A2I6TCD0	Escherichia_phage	94.1	7.4e-20
AXF73010.1|15914_16148_-	hypothetical protein	NA	A0A2I6TCC2	Escherichia_phage	92.2	7.8e-31
AXF73011.1|16144_16309_-	host cell division inhibitor Icd-like protein	NA	A0A2I6TCE0	Escherichia_phage	98.1	1.9e-20
AXF73012.1|16685_16973_-	hypothetical protein	NA	NA	NA	NA	NA
AXF73013.1|17000_17396_-	hypothetical protein	NA	A0A2I6TCB8	Escherichia_phage	97.7	6.5e-70
AXF73014.1|17398_17725_-	hypothetical protein	NA	O64345	Escherichia_phage	63.6	1.6e-34
AXF73015.1|17729_17921_-	hypothetical protein	NA	NA	NA	NA	NA
AXF73016.1|17913_21909_-	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	95.1	0.0e+00
AXF73017.1|22154_22751_-	XRE family transcriptional regulator	NA	A0A2I6TCW0	Escherichia_phage	100.0	2.8e-109
AXF73018.1|22842_23064_+	hypothetical protein	NA	A0A2I6TCB1	Escherichia_phage	100.0	2.1e-33
AXF73019.1|23053_23764_+	phage antitermination protein	NA	A0A2I6TCB3	Escherichia_phage	100.0	8.8e-134
AXF73020.1|23771_24017_+	hypothetical protein	NA	A0A2I6TCB2	Escherichia_phage	100.0	1.4e-43
AXF73021.1|24013_24199_-	hypothetical protein	NA	NA	NA	NA	NA
AXF73022.1|24266_24824_+	3'-5' exoribonuclease	NA	A0A2I6TCA6	Escherichia_phage	98.4	1.6e-106
AXF73023.1|24823_25243_+	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	99.3	4.3e-72
AXF73024.1|25242_25533_+	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	99.0	4.3e-47
AXF73025.1|25529_26264_+	DUF551 domain-containing protein	NA	A0A2I6TCG8	Escherichia_phage	95.6	2.1e-77
AXF73026.1|26256_26478_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	52.1	1.2e-09
AXF73029.1|26477_27005_+	hypothetical protein	NA	A0A0F6TJ66	Escherichia_coli_O157_typing_phage	95.2	1.5e-37
>prophage 1
CP031110	Escherichia coli strain AMSCJX02 plasmid pAMSC5, complete sequence	50124	3021	14113	50124	transposase,integrase	Enterobacteria_phage(42.86%)	8	1171:1182	12389:12400
1171:1182	attL	AAACTGCCGCCG	NA	NA	NA	NA
AXF73085.1|3021_3552_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	33.3	1.7e-09
AXF73086.1|3653_4667_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXF73087.1|4605_5220_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AXF73088.1|5345_5906_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AXF73089.1|5908_8875_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AXF73090.1|9343_10204_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AXF73091.1|10386_10944_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AXF73092.1|11107_14113_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
12389:12400	attR	CGGCGGCAGTTT	NA	NA	NA	NA
