The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	0	112757	4923235	integrase,head,transposase,terminase,portal,lysis,tail,capsid	Enterobacteria_phage(41.77%)	142	27081:27115	114191:114225
AXG15544.1|468_744_+	hypothetical protein	NA	NA	NA	NA	NA
AXG15545.1|755_2348_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
AXG15546.1|2566_3487_+	transpeptidase	NA	NA	NA	NA	NA
AXG15547.1|3545_4664_-	anion transporter	NA	NA	NA	NA	NA
AXG15548.1|4660_5128_-	transcriptional regulator MntR	NA	NA	NA	NA	NA
AXG15549.1|5313_5442_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
AXG15550.1|5713_7297_+	phosphoethanolamine transferase OpgE	NA	NA	NA	NA	NA
AXG15551.1|7345_7861_-	outer membrane protein X	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
AXG15552.1|8213_9101_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AXG15553.1|9399_9903_+	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
AXG15554.1|10188_10380_+	hypothetical protein	NA	NA	NA	NA	NA
AXG15555.1|10306_11053_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXG15556.1|11191_11851_+	glutamine ABC transporter permease	NA	NA	NA	NA	NA
AXG15557.1|11847_12570_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
AXG15558.1|12686_14912_+	moderate conductance mechanosensitive channel YbiO	NA	NA	NA	NA	NA
AXG15559.1|14908_15916_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
AXG15560.1|15966_16371_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	2.6e-05
AXG15561.1|16634_18917_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
AXG15562.1|18958_19636_+	PKHD-type hydroxylase	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
AXG15563.1|19709_19976_+	DksA/TraR family C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
AXG15564.1|20240_20501_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXG15565.1|20770_21751_+|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
AXG15566.1|22031_23117_-	dehydrogenase	NA	NA	NA	NA	NA
AXG15567.1|23257_24220_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AXG15568.1|24247_26398_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.0	7.4e-43
AXG15569.1|26517_27000_+	NADAR family protein	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
27081:27115	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
AXG15570.1|27259_28240_-|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
AXG15571.1|28510_29875_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
AXG20111.1|30103_30775_+	transcriptional regulator	NA	NA	NA	NA	NA
AXG15572.1|30774_31773_+	secretion protein HlyD	NA	NA	NA	NA	NA
AXG15573.1|31765_33502_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
AXG15574.1|33494_34628_+	inner membrane transport permease YbhS	NA	NA	NA	NA	NA
AXG15575.1|34638_35745_+	inner membrane transport permease YbhR	NA	NA	NA	NA	NA
AXG15576.1|35706_36117_-	hypothetical protein	NA	NA	NA	NA	NA
AXG15577.1|36249_37011_+	EEP domain-containing protein	NA	NA	NA	NA	NA
AXG15578.1|37007_38249_+	cardiolipin synthase B	NA	NA	NA	NA	NA
AXG15579.1|38248_39205_+	UPF0104 family protein	NA	NA	NA	NA	NA
AXG15580.1|39240_39954_-	BAX inhibitor (BI)-1/YccA family protein	NA	NA	NA	NA	NA
AXG15581.1|40158_40863_-	BAX inhibitor (BI)-1/YccA family protein	NA	NA	NA	NA	NA
AXG15582.1|40999_41452_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
AXG15583.1|41453_41699_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
AXG15584.1|41691_42177_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AXG15585.1|42179_42692_-	molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
AXG15586.1|42713_43703_-	cyclic pyranopterin monophosphate synthase	NA	NA	NA	NA	NA
AXG15587.1|44099_45008_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
AXG15588.1|45199_47221_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AXG15589.1|47799_48477_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AXG15590.1|48469_49225_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
AXG15591.1|49211_50366_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AXG15592.1|50362_51403_-	biotin synthase	NA	NA	NA	NA	NA
AXG15593.1|51489_52779_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	5.0e-18
AXG15594.1|52837_53314_+	kinase inhibitor	NA	NA	NA	NA	NA
AXG15595.1|53228_53408_+	hypothetical protein	NA	NA	NA	NA	NA
AXG15596.1|54059_55391_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	2.5e-20
AXG15597.1|55464_56049_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	4.6e-104
AXG15598.1|56048_59120_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
AXG15599.1|59184_59784_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	97.0	2.4e-108
AXG15600.1|59854_63352_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.8	0.0e+00
AXG15601.1|63412_64084_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	90.1	9.9e-103
AXG15602.1|63981_64725_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	1.4e-145
AXG15603.1|64730_65429_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
AXG15604.1|65428_65758_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
AXG15605.1|65754_68316_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.8	0.0e+00
AXG15606.1|68308_68743_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AXG15607.1|68724_69147_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
AXG20112.1|69162_69903_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	5.7e-128
AXG15608.1|69910_70306_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
AXG15609.1|70302_70881_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
AXG15610.1|70892_71246_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
AXG15611.1|71257_71653_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
AXG15612.1|72268_73249_-|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
AXG15613.1|74054_74387_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AXG15614.1|74396_75716_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.4e-230
AXG15615.1|76892_77168_-	hypothetical protein	NA	NA	NA	NA	NA
AXG15616.1|77285_77567_-	hypothetical protein	NA	NA	NA	NA	NA
AXG15617.1|77578_78121_-|terminase	terminase	terminase	O64316	Escherichia_phage	47.5	4.9e-36
AXG15618.1|78120_78330_-	hypothetical protein	NA	NA	NA	NA	NA
AXG15619.1|78322_78706_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXG15620.1|78717_79059_-|head	head decoration protein	head	NA	NA	NA	NA
AXG15621.1|79068_80109_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
AXG15622.1|80326_80776_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AXG15623.1|80772_81024_-	hypothetical protein	NA	NA	NA	NA	NA
AXG15624.1|81020_81269_-	hypothetical protein	NA	NA	NA	NA	NA
AXG15625.1|81225_82641_-	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	58.2	6.9e-114
AXG15626.1|82637_82937_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AXG15627.1|82943_83162_-	hypothetical protein	NA	NA	NA	NA	NA
AXG15628.1|83151_83364_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	42.4	6.7e-05
AXG15629.1|83356_83593_-	hypothetical protein	NA	NA	NA	NA	NA
AXG15630.1|83582_84500_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AXG15631.1|84531_85110_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	63.0	1.2e-56
AXG15632.1|85166_85424_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXG15633.1|85425_86667_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	42.9	1.6e-93
AXG15634.1|86815_87697_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.3	8.6e-163
AXG15635.1|87693_87900_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AXG15636.1|87896_89822_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
AXG15637.1|89796_90342_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.8e-94
AXG20113.1|90481_90625_-	DNA-packaging protein	NA	NA	NA	NA	NA
AXG15638.1|90730_90964_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
AXG15639.1|91020_91431_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AXG15640.1|91476_91641_+	hypothetical protein	NA	NA	NA	NA	NA
AXG15641.1|91717_91975_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
AXG15642.1|91971_92469_-	DNA-binding protein	NA	A0A220NRM9	Escherichia_phage	100.0	1.1e-93
AXG15643.1|92670_93129_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	95.4	6.2e-72
AXG15644.1|93125_93623_-	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	97.0	2.7e-89
AXG15645.1|93622_93838_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
AXG15646.1|94025_94613_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXG15647.1|94621_94756_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXG15648.1|95107_96067_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AXG15649.1|96259_96784_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
AXG15650.1|96939_97317_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
AXG15651.1|97402_97543_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AXG15652.1|97539_97902_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
AXG15653.1|97921_98116_-	protein ninF	NA	NA	NA	NA	NA
AXG15654.1|98108_98492_-	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	96.5	1.7e-62
AXG15655.1|98452_98629_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
AXG15656.1|98625_99153_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
AXG15657.1|99149_99608_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.3e-81
AXG15658.1|99663_99954_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	99.0	6.3e-46
AXG15659.1|99950_100652_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
AXG15660.1|100648_101548_-	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	5.5e-173
AXG15661.1|101580_101874_-	hypothetical protein	NA	A2SY75	Escherichia_phage	99.0	4.8e-46
AXG15662.1|101992_102193_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
AXG15663.1|102293_103007_+	LexA family transcriptional regulator	NA	A4KWS0	Enterobacteria_phage	100.0	1.1e-131
AXG15664.1|103057_103492_+	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	99.3	6.0e-77
AXG15665.1|105313_105637_+	antitermination protein	NA	K7P718	Enterobacteria_phage	98.1	4.2e-51
AXG15666.1|105629_106124_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	99.4	1.4e-85
AXG15667.1|106333_106534_+	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	4.2e-33
AXG15668.1|106716_107085_+	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	97.5	6.5e-64
AXG15669.1|107164_107434_+	host cell division inhibitory peptide Kil	NA	G3CFI2	Escherichia_phage	100.0	1.3e-42
AXG15670.1|107388_107805_+	Host-nuclease inhibitor protein gam	NA	C6ZCV5	Enterobacteria_phage	97.1	2.8e-71
AXG15671.1|107810_108596_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AXG15672.1|108592_109273_+	exonuclease	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
AXG20114.1|109269_109452_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
AXG15673.1|109424_109616_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
AXG15674.1|109626_109908_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
AXG15675.1|110006_110228_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	98.6	8.4e-35
AXG15676.1|110438_110969_-	hypothetical protein	NA	NA	NA	NA	NA
AXG15677.1|110859_111111_-	hypothetical protein	NA	NA	NA	NA	NA
AXG15678.1|111165_111351_-	hypothetical protein	NA	NA	NA	NA	NA
AXG15679.1|111283_111451_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
AXG15680.1|111490_111709_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AXG15681.1|111686_112757_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
114191:114225	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 2
CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	579855	676295	4923235	integrase,head,portal,terminase,plate,lysis,tail,holin,capsid,protease	Shigella_phage(47.54%)	107	630002:630048	672393:672439
AXG16105.1|579855_581889_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
AXG20127.1|581885_582101_-	hypothetical protein	NA	NA	NA	NA	NA
AXG16106.1|582017_582605_+	transcriptional regulator	NA	NA	NA	NA	NA
AXG16107.1|582618_584091_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AXG16108.1|584104_585775_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
AXG16109.1|586627_586825_+	universal stress protein	NA	NA	NA	NA	NA
AXG16110.1|586731_586944_+	hypothetical protein	NA	NA	NA	NA	NA
AXG16111.1|586898_587594_-	lactate utilization protein C	NA	NA	NA	NA	NA
AXG16112.1|587586_589014_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AXG16113.1|589024_589744_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AXG16114.1|590270_591125_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXG16115.1|591350_592676_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
AXG16116.1|592784_593021_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXG16117.1|593032_593626_+	protein RclC	NA	NA	NA	NA	NA
AXG16118.1|593789_594671_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.4	2.7e-52
AXG16119.1|594871_595762_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXG16120.1|595882_600136_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
AXG16121.1|601251_601353_+	hypothetical protein	NA	NA	NA	NA	NA
AXG16122.1|601715_601979_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
AXG16123.1|601978_602119_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AXG16124.1|602153_602381_-	hypothetical protein	NA	NA	NA	NA	NA
AXG16125.1|603155_603746_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG16126.1|603820_604408_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
AXG16127.1|604465_605134_+	hypothetical protein	NA	NA	NA	NA	NA
AXG16128.1|605159_607685_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AXG16129.1|607674_609318_+	hypothetical protein	NA	NA	NA	NA	NA
AXG16130.1|609286_609997_+	hypothetical protein	NA	NA	NA	NA	NA
AXG16131.1|610309_610639_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AXG16132.1|610633_610813_-	hypothetical protein	NA	NA	NA	NA	NA
AXG16133.1|611611_611737_+	transporter	NA	NA	NA	NA	NA
AXG16134.1|611916_612606_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AXG16135.1|612602_613559_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
AXG16136.1|613555_615754_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
AXG16137.1|615763_616720_+	XdhC family protein	NA	NA	NA	NA	NA
AXG16138.1|616698_617109_+	transcriptional regulator	NA	NA	NA	NA	NA
AXG16139.1|617638_618736_-	hypothetical protein	NA	NA	NA	NA	NA
AXG16140.1|618829_621163_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.4	0.0e+00
AXG16141.1|621177_621501_-	DNA replication protein	NA	NA	NA	NA	NA
AXG16142.1|621497_621722_-	hypothetical protein	NA	NA	NA	NA	NA
AXG16143.1|621721_622270_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	56.9	1.0e-25
AXG16144.1|622266_622527_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
AXG16145.1|622971_623184_-	hypothetical protein	NA	NA	NA	NA	NA
AXG16146.1|623430_624183_+	septation initiation protein	NA	NA	NA	NA	NA
AXG16147.1|624179_624734_+	phage polarity suppression protein	NA	NA	NA	NA	NA
AXG16148.1|624735_625008_+	hypothetical protein	NA	NA	NA	NA	NA
AXG16149.1|627462_628659_-	hypothetical protein	NA	NA	NA	NA	NA
AXG16150.1|628660_629839_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	62.6	1.7e-145
630002:630048	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AXG16151.1|630113_630266_-	hypothetical protein	NA	NA	NA	NA	NA
AXG16152.1|630397_631828_-	hypothetical protein	NA	NA	NA	NA	NA
AXG16153.1|631892_632090_-	hypothetical protein	NA	NA	NA	NA	NA
AXG16154.1|632444_633722_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AXG16155.1|633785_635789_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	2.2e-20
AXG16156.1|636410_637184_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.9	1.1e-36
AXG16157.1|637734_638802_+	acyltransferase	NA	NA	NA	NA	NA
AXG16158.1|639062_639479_-|tail	phage tail protein	tail	U5P0S4	Shigella_phage	71.6	2.9e-20
AXG16159.1|639478_640405_-	carbohydrate kinase	NA	U5P0I1	Shigella_phage	84.3	3.5e-50
AXG16160.1|640408_640993_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.5	1.4e-113
AXG16161.1|640983_642042_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.4	7.5e-198
AXG16162.1|642028_642457_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	100.0	2.3e-81
AXG16163.1|642453_643002_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	96.7	2.4e-94
AXG16164.1|643001_644081_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	2.6e-206
AXG16165.1|644077_645448_-	DNA circularization protein	NA	S5FUX4	Shigella_phage	97.1	3.8e-250
AXG16166.1|645466_647302_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.2	1.1e-305
AXG16167.1|647294_647477_-	hypothetical protein	NA	NA	NA	NA	NA
AXG16168.1|647443_647713_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
AXG16169.1|647712_648069_-|tail	phage tail protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
AXG16170.1|648068_649565_-|tail	phage tail protein	tail	S5FKL0	Shigella_phage	99.6	2.3e-277
AXG16171.1|649548_649719_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
AXG16172.1|649727_650288_-	hypothetical protein	NA	S5FM61	Shigella_phage	100.0	4.7e-106
AXG16173.1|650284_650791_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
AXG16174.1|650765_651176_-|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
AXG16175.1|651172_651496_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	99.1	2.2e-52
AXG16176.1|651574_652804_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.8	1.5e-226
AXG16177.1|652814_653417_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
AXG16178.1|653409_654636_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.5	4.6e-239
AXG16179.1|654783_656517_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	97.3	0.0e+00
AXG16180.1|656513_657017_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	5.2e-88
AXG16181.1|657133_657484_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	92.2	7.0e-60
AXG16182.1|657757_658255_-	DNA-binding protein	NA	Q9AZ05	Salmonella_phage	95.7	1.1e-87
AXG16183.1|658446_658821_-	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	79.8	2.7e-49
AXG16184.1|658859_659327_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	74.3	7.7e-54
AXG16185.1|659310_659787_-	lysozyme	NA	S5FV07	Shigella_phage	97.5	2.4e-87
AXG16186.1|659790_660117_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
AXG16187.1|660414_661746_+	NTPase	NA	R9TRQ8	Vibrio_phage	29.4	3.2e-20
AXG16188.1|661774_662143_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	86.7	2.7e-54
AXG16189.1|662157_663147_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.6e-194
AXG16190.1|663154_663964_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	5.3e-151
AXG16191.1|663983_664373_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	6.0e-68
AXG16192.1|664369_664696_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	2.9e-52
AXG16193.1|664692_665346_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
AXG16194.1|665345_665840_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
AXG16195.1|665836_666778_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.4	1.6e-143
AXG16196.1|666767_666947_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	1.1e-13
AXG20128.1|667122_667674_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
AXG16197.1|667711_667912_-	cell division protein	NA	NA	NA	NA	NA
AXG16198.1|668009_668636_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
AXG16199.1|668821_669118_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
AXG16200.1|669035_669281_-	hypothetical protein	NA	NA	NA	NA	NA
AXG16201.1|669421_669646_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	64.6	1.1e-13
AXG16202.1|669794_670331_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	99.4	4.8e-100
AXG16203.1|670321_670684_+	hypothetical protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
AXG16204.1|670683_670989_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
AXG16205.1|670988_671339_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
AXG20129.1|671440_672379_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	4.7e-183
AXG16206.1|672583_673837_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
672393:672439	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AXG16207.1|673848_674952_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AXG16208.1|675239_676295_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 3
CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	708458	770823	4923235	transposase,protease,plate,tRNA	Shigella_phage(11.11%)	53	NA	NA
AXG16238.1|708458_708872_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXG16239.1|708875_710585_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXG16240.1|710577_711791_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
AXG16241.1|711950_713033_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXG16242.1|713057_714338_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AXG16243.1|714334_714859_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AXG16244.1|714861_716193_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXG16245.1|716197_716959_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AXG16246.1|716967_719781_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.0	6.9e-81
AXG16247.1|719777_720521_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AXG16248.1|720459_721938_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AXG16249.1|722016_725481_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AXG16250.1|725491_726844_+	hypothetical protein	NA	NA	NA	NA	NA
AXG16251.1|726867_727350_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AXG16252.1|727393_728308_+	hypothetical protein	NA	NA	NA	NA	NA
AXG16253.1|728317_728797_+	hypothetical protein	NA	NA	NA	NA	NA
AXG16254.1|728933_729719_-	hypothetical protein	NA	NA	NA	NA	NA
AXG16255.1|730138_730318_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20131.1|730257_730989_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
AXG16256.1|731053_731521_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	62.4	2.3e-50
AXG16257.1|731517_732240_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXG16258.1|732273_733029_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AXG16259.1|733100_734459_+	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AXG16260.1|734506_735277_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXG16261.1|735354_736155_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AXG16262.1|736395_737310_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXG16263.1|737306_738110_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.6e-38
AXG16264.1|744006_744582_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AXG16265.1|744769_745801_+	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
AXG16266.1|745793_746447_+	methionine ABC transporter	NA	NA	NA	NA	NA
AXG16267.1|746486_747302_+	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AXG16268.1|747419_747824_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AXG16269.1|747820_748528_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AXG16270.1|748638_750357_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AXG16271.1|750410_751235_+	endopeptidase	NA	NA	NA	NA	NA
AXG16272.1|751389_752100_-	copper homeostasis/adhesion lipoprotein NlpE	NA	NA	NA	NA	NA
AXG16273.1|752113_752536_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AXG16274.1|752532_753078_-	hypothetical protein	NA	NA	NA	NA	NA
AXG16275.1|753243_753444_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20132.1|753436_753691_+	protein rof	NA	NA	NA	NA	NA
AXG16276.1|753739_755038_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AXG16277.1|755102_755492_-	VOC family protein	NA	NA	NA	NA	NA
AXG16278.1|755548_757690_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
AXG16279.1|757788_758748_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AXG16280.1|758760_762243_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
AXG16281.1|762279_762876_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.9	1.0e-26
AXG16282.1|762872_764021_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AXG16283.1|764020_764809_-	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AXG16284.1|764812_765268_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AXG16285.1|765372_766398_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AXG16286.1|766401_766887_-	chaperone protein Skp	NA	NA	NA	NA	NA
AXG16287.1|767008_769441_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AXG16288.1|769470_770823_-|protease	zinc metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 4
CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	2746276	2755625	4923235	transposase,plate	Acinetobacter_phage(25.0%)	11	NA	NA
AXG18103.1|2746276_2746705_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXG18104.1|2746708_2747245_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AXG18105.1|2747225_2748305_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXG18106.1|2748268_2750029_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXG18107.1|2750104_2750509_-	hypothetical protein	NA	NA	NA	NA	NA
AXG18108.1|2750588_2751011_-	hypothetical protein	NA	NA	NA	NA	NA
AXG18109.1|2751104_2752266_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AXG18110.1|2752368_2752563_-	hypothetical protein	NA	NA	NA	NA	NA
AXG18111.1|2753111_2754092_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	2.6e-184
AXG20215.1|2754129_2754255_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	87.8	1.7e-13
AXG18112.1|2754411_2755625_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
>prophage 5
CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	2853728	2860868	4923235		Escherichia_phage(83.33%)	6	NA	NA
AXG18198.1|2853728_2854367_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AXG18199.1|2854363_2855626_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AXG18200.1|2855622_2856531_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AXG18201.1|2856726_2857494_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AXG18202.1|2857544_2858201_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.9	1.1e-50
AXG18203.1|2858306_2860868_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 6
CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	2930739	3022026	4923235	transposase,terminase,portal,lysis,holin,tail,tRNA,protease	Enterobacteria_phage(35.48%)	100	NA	NA
AXG18269.1|2930739_2931901_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AXG18270.1|2932053_2933772_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
AXG18271.1|2933773_2935522_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
AXG18272.1|2935593_2936010_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
AXG20220.1|2936048_2937278_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
AXG18273.1|2937614_2938538_+	hypothetical protein	NA	NA	NA	NA	NA
AXG18274.1|2938530_2938872_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
AXG18275.1|2938873_2939503_+	hypothetical protein	NA	NA	NA	NA	NA
AXG18276.1|2939515_2940682_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	66.2	2.8e-145
AXG18277.1|2940642_2940849_-	excisionase	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
AXG18278.1|2940890_2941757_-	hypothetical protein	NA	NA	NA	NA	NA
AXG18279.1|2941865_2942390_-	HD family hydrolase	NA	S5MW55	Escherichia_phage	97.1	1.7e-94
AXG18280.1|2942518_2943343_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AXG18281.1|2943408_2943771_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AXG18282.1|2943843_2944038_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	96.9	7.1e-30
AXG18283.1|2944139_2944343_-	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	94.9	1.9e-12
AXG18284.1|2944439_2945114_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
AXG18285.1|2945204_2945405_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AXG18286.1|2945448_2946000_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
AXG18287.1|2945996_2946833_+	ash family protein	NA	Q8SBF3	Shigella_phage	98.9	6.0e-150
AXG20221.1|2946837_2947062_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	95.9	8.5e-35
AXG18288.1|2947058_2947877_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	3.1e-122
AXG18289.1|2947873_2948368_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.0	2.1e-86
AXG18290.1|2948367_2949021_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
AXG18291.1|2949017_2949344_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
AXG18292.1|2949340_2949730_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
AXG18293.1|2949749_2950559_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
AXG18294.1|2950566_2951556_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	8.1e-194
AXG18295.1|2951573_2951939_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.6	1.6e-54
AXG18296.1|2952023_2952470_-	hypothetical protein	NA	NA	NA	NA	NA
AXG18297.1|2952740_2952944_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
AXG18298.1|2953094_2954147_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.4	2.3e-207
AXG18299.1|2954214_2954430_+|holin	holin	holin	A5LH82	Enterobacteria_phage	97.2	4.5e-33
AXG18300.1|2954434_2954785_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.6e-35
AXG18301.1|2954848_2955382_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
AXG18302.1|2955378_2955846_+|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	100.0	2.9e-77
AXG18303.1|2955833_2955986_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
AXG18304.1|2956302_2956503_+	hypothetical protein	NA	K7PJR7	Enterobacteria_phage	92.4	1.3e-31
AXG18305.1|2956671_2957163_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	84.1	1.5e-68
AXG18306.1|2957162_2959265_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.4	0.0e+00
AXG18307.1|2959261_2959474_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AXG18308.1|2959473_2960982_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	3.5e-289
AXG18309.1|2960926_2962954_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
AXG18310.1|2962995_2963364_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	9.7e-52
AXG18311.1|2963356_2963632_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
AXG18312.1|2963643_2964222_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	98.4	3.6e-101
AXG18313.1|2964218_2964620_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
AXG18314.1|2964631_2965375_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
AXG20222.1|2965435_2965822_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	6.1e-65
AXG18315.1|2965830_2966160_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AXG18316.1|2966131_2969197_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
AXG18317.1|2969196_2969526_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
AXG18318.1|2969535_2970234_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
AXG18319.1|2970238_2970982_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	4.3e-147
AXG18320.1|2970879_2971527_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.1e-111
AXG18321.1|2971587_2975085_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.5	0.0e+00
AXG18322.1|2975155_2975755_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	95.5	4.5e-107
AXG20223.1|2975819_2978891_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.7	2.8e-67
AXG18323.1|2978890_2979475_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	6.6e-103
AXG18324.1|2979544_2980318_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
AXG18325.1|2980724_2982158_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
AXG18326.1|2982192_2983401_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
AXG18327.1|2984212_2984695_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AXG18328.1|2984826_2985303_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AXG18329.1|2985292_2985583_+	RnfH family protein	NA	NA	NA	NA	NA
AXG18330.1|2985644_2985986_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AXG18331.1|2986134_2987796_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AXG18332.1|2987881_2988760_-	NAD(+) kinase	NA	NA	NA	NA	NA
AXG20224.1|2988691_2988886_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AXG18333.1|2988882_2989476_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AXG20225.1|2989530_2990772_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AXG20226.1|2990837_2991629_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AXG18334.1|2991795_2993157_+	signal recognition particle protein	NA	NA	NA	NA	NA
AXG18335.1|2993405_2993654_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AXG18336.1|2993672_2994221_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AXG18337.1|2994251_2995019_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AXG18338.1|2995060_2995408_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AXG18339.1|2995484_2995967_-	OmpA family protein	NA	NA	NA	NA	NA
AXG18340.1|2995982_2997209_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXG18341.1|2997198_2997717_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AXG18342.1|2997866_2998232_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
AXG18343.1|2998441_2999512_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
AXG18344.1|2999522_3000644_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AXG18345.1|3000686_3001847_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AXG20227.1|3001945_3001993_-	hypothetical protein	NA	NA	NA	NA	NA
AXG18346.1|3002096_3002438_-	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AXG18347.1|3002472_3002679_-	hypothetical protein	NA	NA	NA	NA	NA
AXG18348.1|3002708_3003446_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AXG18349.1|3003580_3004561_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AXG18350.1|3004557_3005289_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AXG18351.1|3005418_3007992_+	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
AXG18352.1|3013675_3013789_+	alpha-ketoglutarate permease	NA	NA	NA	NA	NA
AXG18353.1|3013770_3015069_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
AXG18354.1|3015065_3015389_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
AXG18355.1|3015434_3016790_-	phosphatidylserine synthase	NA	NA	NA	NA	NA
AXG18356.1|3016903_3019564_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AXG20228.1|3019595_3020294_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AXG18357.1|3020362_3020782_-	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AXG18358.1|3020795_3020999_+	hypothetical protein	NA	NA	NA	NA	NA
AXG18359.1|3020988_3022026_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 7
CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	3256738	3299828	4923235	portal,terminase,lysis,holin,coat	Enterobacteria_phage(43.55%)	68	NA	NA
AXG18568.1|3256738_3259411_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	3.2e-59
AXG18569.1|3259407_3259791_-	hypothetical protein	NA	NA	NA	NA	NA
AXG18570.1|3259787_3260072_-	hypothetical protein	NA	NA	NA	NA	NA
AXG18571.1|3260103_3260463_-	hypothetical protein	NA	NA	NA	NA	NA
AXG18572.1|3260455_3260632_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
AXG20237.1|3260763_3260943_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	54.2	5.8e-10
AXG18573.1|3260992_3261208_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXG18574.1|3261310_3262192_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20238.1|3262222_3263497_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.3	2.9e-71
AXG18575.1|3263769_3263970_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AXG18576.1|3264027_3264195_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	2.4e-26
AXG18577.1|3264353_3264797_-	hypothetical protein	NA	A0A1B0V865	Salmonella_phage	84.8	8.4e-34
AXG18578.1|3264793_3265159_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	8.7e-69
AXG18579.1|3265160_3265379_-	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	55.6	1.8e-13
AXG18580.1|3265411_3265624_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	91.4	1.5e-33
AXG18581.1|3265674_3266031_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
AXG18582.1|3266032_3266542_-	HNH endonuclease	NA	A0A2I7S010	Vibrio_phage	45.6	2.2e-33
AXG18583.1|3266617_3266785_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	6.6e-24
AXG18584.1|3266795_3267092_-	DUF2856 family protein	NA	G9L665	Escherichia_phage	87.8	3.3e-42
AXG18585.1|3267115_3267703_-	DUF669 domain-containing protein	NA	G9L666	Escherichia_phage	99.0	1.9e-105
AXG18586.1|3267699_3268380_-	ATP-binding protein	NA	A0A2D1GLT5	Escherichia_phage	99.6	2.2e-126
AXG18587.1|3268388_3268577_-	hypothetical protein	NA	A0A2D1GM16	Escherichia_phage	100.0	1.7e-28
AXG18588.1|3268573_3268813_-	host cell division inhibitory peptide Kil	NA	K7PL44	Enterobacteria_phage	98.7	1.5e-37
AXG18589.1|3269001_3269190_-	hypothetical protein	NA	A0A0B7MKW0	Enterobacteria_phage	61.1	1.3e-12
AXG18590.1|3269189_3269486_-	hypothetical protein	NA	A0A2D1GLR6	Escherichia_phage	94.9	5.2e-48
AXG18591.1|3269525_3269777_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	98.8	9.5e-43
AXG18592.1|3270154_3270517_-	antitermination N domain protein	NA	K7PHE0	Enterobacteria_phage	97.5	2.9e-56
AXG18593.1|3270519_3270792_-	hypothetical protein	NA	K7PH69	Enterobacterial_phage	90.0	1.4e-26
AXG18594.1|3271366_3271735_-	hypothetical protein	NA	K7P6G1	Enterobacteria_phage	98.4	8.5e-56
AXG18595.1|3271753_3272470_-	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
AXG18596.1|3272576_3272771_+	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
AXG18597.1|3272879_3273158_+	hypothetical protein	NA	K7P7A2	Enterobacteria_phage	97.8	9.0e-42
AXG18598.1|3273340_3274231_+	DNA replication protein	NA	G5DA89	Enterobacteria_phage	99.7	3.4e-159
AXG18599.1|3274205_3275657_+	helicase DnaB	NA	Q7Y2K5	Escherichia_phage	99.6	5.0e-277
AXG18600.1|3275656_3275755_+	histone H1	NA	Q9MCP6	Enterobacteria_phage	100.0	7.5e-12
AXG18601.1|3275741_3275954_+	hypothetical protein	NA	A0A1V0E5J7	Salmonella_phage	98.6	6.2e-35
AXG18602.1|3275916_3276375_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.6e-80
AXG18603.1|3276371_3276899_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
AXG18604.1|3276895_3277078_+	NinE family protein	NA	K7PH28	Enterobacteria_phage	100.0	7.4e-29
AXG18605.1|3277074_3277248_+	protein ninF	NA	K7PL22	Enterobacteria_phage	98.2	2.8e-25
AXG18606.1|3277237_3277630_+	hypothetical protein	NA	A0A077SL57	Escherichia_phage	35.2	2.2e-14
AXG18607.1|3277622_3277913_+	DUF1364 domain-containing protein	NA	Q9MCN9	Enterobacteria_phage	97.9	2.5e-50
AXG18608.1|3277909_3278434_+	HNH endonuclease	NA	K4F9R1	Cronobacter_phage	42.9	7.1e-32
AXG18609.1|3278434_3278797_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	97.5	6.6e-61
AXG18610.1|3278793_3278982_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
AXG18611.1|3278978_3279602_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
AXG18612.1|3280324_3280648_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AXG18613.1|3280631_3281108_+	lysozyme	NA	G5DA94	Enterobacteria_phage	100.0	9.8e-89
AXG18614.1|3281104_3281542_+|lysis	lysis protein	lysis	K7PJN9	Enterobacteria_phage	98.6	5.0e-71
AXG18615.1|3281743_3282262_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	5.5e-93
AXG18616.1|3282608_3282824_+	DUF551 domain-containing protein	NA	A0A193GZ43	Enterobacter_phage	75.7	3.1e-26
AXG18617.1|3282971_3283214_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
AXG18618.1|3283293_3283782_+	DNA-packaging protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
AXG18619.1|3283759_3285259_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.8	2.4e-306
AXG18620.1|3285259_3287425_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	98.9	0.0e+00
AXG18621.1|3287438_3288350_+	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.3	8.3e-161
AXG18622.1|3288349_3289645_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.8	8.0e-242
AXG20239.1|3289697_3290294_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	62.2	3.9e-58
AXG18623.1|3290271_3290772_+	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	98.8	1.9e-90
AXG18624.1|3290772_3292191_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	99.2	7.8e-275
AXG18625.1|3292190_3293039_+	hypothetical protein	NA	Q716G6	Shigella_phage	94.3	1.9e-98
AXG18626.1|3293038_3293494_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	1.3e-85
AXG18627.1|3293496_3294192_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	92.7	1.5e-85
AXG18628.1|3294201_3295533_+	acyltransferase	NA	A0A2D1GLX5	Escherichia_phage	96.8	2.0e-208
AXG18629.1|3295533_3298302_+	hypothetical protein	NA	A0A2D1GLK8	Escherichia_phage	94.7	0.0e+00
AXG18630.1|3298319_3298472_-	hypothetical protein	NA	A0A088CPT2	Enterobacteria_phage	61.1	2.5e-06
AXG18631.1|3298484_3298961_-	hypothetical protein	NA	NA	NA	NA	NA
AXG18632.1|3298880_3299828_+	DNA transfer domain protein	NA	Q716G2	Shigella_phage	99.0	2.5e-160
>prophage 8
CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	3535931	3545373	4923235		Enterobacteria_phage(85.71%)	10	NA	NA
AXG18845.1|3535931_3536858_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
AXG18846.1|3536862_3537594_+	ABC transporter permease	NA	NA	NA	NA	NA
AXG18847.1|3537574_3537682_-	hypothetical protein	NA	NA	NA	NA	NA
AXG18848.1|3537741_3538473_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AXG18849.1|3538694_3540380_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AXG18850.1|3540376_3541096_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXG18851.1|3541142_3541613_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AXG18852.1|3541653_3542115_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
AXG18853.1|3542239_3544240_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
AXG18854.1|3544236_3545373_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 9
CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	3640363	3649020	4923235		Enterobacteria_phage(42.86%)	9	NA	NA
AXG18926.1|3640363_3641758_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	6.3e-19
AXG18927.1|3641932_3642826_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.0	7.9e-47
AXG18928.1|3642862_3643126_-	hypothetical protein	NA	NA	NA	NA	NA
AXG18929.1|3643198_3644284_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.0e-100
AXG18930.1|3644283_3645183_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	9.7e-29
AXG18931.1|3645240_3646116_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
AXG18932.1|3646124_3646679_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.3	1.7e-47
AXG18933.1|3646687_3647926_+	flippase	NA	NA	NA	NA	NA
AXG18934.1|3647928_3649020_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	64.4	1.9e-140
>prophage 10
CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	4095916	4111740	4923235		Salmonella_phage(20.0%)	22	NA	NA
AXG19357.1|4095916_4098343_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.3e-213
AXG19358.1|4098541_4098847_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AXG20273.1|4098954_4099665_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AXG19359.1|4099667_4100228_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AXG19360.1|4100262_4100604_-	DUF1283 family protein	NA	NA	NA	NA	NA
AXG19361.1|4100738_4101065_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AXG19362.1|4101101_4101290_+	hypothetical protein	NA	NA	NA	NA	NA
AXG19363.1|4101270_4102485_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.0	1.1e-46
AXG19364.1|4102496_4103516_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
AXG19365.1|4103573_4103702_+	transporter	NA	NA	NA	NA	NA
AXG19366.1|4103703_4104999_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	1.9e-155
AXG19367.1|4105018_4105270_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AXG19368.1|4105342_4107814_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AXG19369.1|4107906_4108098_-	DUF1482 family protein	NA	NA	NA	NA	NA
AXG19370.1|4108094_4108283_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AXG19371.1|4108850_4109069_-	hypothetical protein	NA	NA	NA	NA	NA
AXG19372.1|4109098_4109269_-	hypothetical protein	NA	NA	NA	NA	NA
AXG19373.1|4109228_4109384_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AXG19374.1|4109576_4110035_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.8e-24
AXG19375.1|4110061_4110289_+	transcriptional regulator	NA	NA	NA	NA	NA
AXG19376.1|4110272_4110794_+	hypothetical protein	NA	NA	NA	NA	NA
AXG19377.1|4110720_4111740_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	1.4e-55
>prophage 11
CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	4115716	4148282	4923235	portal,terminase,lysis,tail,protease	Enterobacteria_phage(54.84%)	37	NA	NA
AXG19383.1|4115716_4115929_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
AXG19384.1|4116145_4116397_+	hypothetical protein	NA	NA	NA	NA	NA
AXG19385.1|4116463_4116742_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
AXG19386.1|4116743_4117793_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.2e-109
AXG19387.1|4117805_4118180_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
AXG19388.1|4118176_4118998_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	54.0	5.9e-81
AXG19389.1|4119536_4119863_+	hypothetical protein	NA	NA	NA	NA	NA
AXG19390.1|4119898_4120030_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
AXG19391.1|4120396_4120825_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AXG20274.1|4120996_4121371_+	tolA family protein	NA	NA	NA	NA	NA
AXG19392.1|4121622_4121838_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
AXG19393.1|4121842_4122187_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
AXG19394.1|4122152_4122425_-	hypothetical protein	NA	NA	NA	NA	NA
AXG19395.1|4122530_4123073_+	lysozyme	NA	Q08J98	Stx2-converting_phage	87.2	3.4e-93
AXG19396.1|4123069_4123606_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	83.5	1.1e-72
AXG19397.1|4123774_4124467_-	hypothetical protein	NA	NA	NA	NA	NA
AXG19398.1|4125038_4125533_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
AXG19399.1|4125532_4127635_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.4	0.0e+00
AXG19400.1|4127631_4127844_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AXG19401.1|4127843_4129352_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	3.5e-289
AXG19402.1|4129296_4131324_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
AXG19403.1|4131365_4131734_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	9.7e-52
AXG19404.1|4131726_4132002_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
AXG19405.1|4132013_4132592_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
AXG19406.1|4132588_4132990_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
AXG19407.1|4133001_4133745_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
AXG20275.1|4133805_4134192_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
AXG19408.1|4134200_4134530_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AXG19409.1|4134501_4137567_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	97.1	0.0e+00
AXG19410.1|4137566_4137896_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	5.1e-60
AXG19411.1|4137905_4138604_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	2.3e-134
AXG19412.1|4138609_4139353_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	5.0e-148
AXG19413.1|4139250_4139898_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
AXG19414.1|4139958_4143438_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.7	0.0e+00
AXG19415.1|4143506_4144106_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.5	5.5e-105
AXG20276.1|4144170_4147701_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.9e-11
AXG19416.1|4147700_4148282_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
>prophage 12
CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	4791978	4890113	4923235	integrase,head,portal,transposase,plate,lysis,tail,capsid,tRNA,protease	Salmonella_phage(57.63%)	95	4784939:4784954	4893416:4893431
4784939:4784954	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
AXG19996.1|4791978_4793271_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AXG19997.1|4793361_4794705_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AXG19998.1|4794715_4795327_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AXG19999.1|4795481_4799549_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AXG20000.1|4799683_4800178_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AXG20001.1|4800722_4801688_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AXG20002.1|4801810_4803577_+	ATP-binding/permease CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AXG20003.1|4803577_4805299_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	6.4e-21
AXG20004.1|4805340_4806045_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXG20005.1|4806329_4806548_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXG20006.1|4808430_4808985_-	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
AXG20007.1|4808995_4809997_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	39.9	1.8e-47
AXG20008.1|4810007_4810931_-	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
AXG20009.1|4810927_4812235_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
AXG20010.1|4812565_4815799_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.8	2.8e-62
AXG20011.1|4815795_4816779_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.2	2.9e-42
AXG20012.1|4817971_4820248_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AXG20013.1|4820278_4820599_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AXG20014.1|4820921_4821146_+	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AXG20015.1|4821218_4823165_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AXG20016.1|4823161_4824277_-	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AXG20017.1|4824391_4825384_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AXG20018.1|4825380_4827039_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AXG20019.1|4827464_4828160_+	aquaporin	NA	NA	NA	NA	NA
AXG20020.1|4828654_4829554_+	transporter	NA	NA	NA	NA	NA
AXG20021.1|4829697_4831350_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AXG20022.1|4831361_4832330_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXG20023.1|4832462_4834181_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
AXG20024.1|4834217_4835219_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AXG20025.1|4835229_4836660_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXG20311.1|4836758_4837772_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXG20026.1|4837768_4838599_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AXG20027.1|4838595_4838919_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20028.1|4839044_4839560_+	lipoprotein	NA	NA	NA	NA	NA
AXG20029.1|4839777_4840506_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
AXG20030.1|4840523_4841255_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXG20031.1|4841261_4841978_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AXG20032.1|4841977_4842646_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AXG20033.1|4842937_4843669_+	arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXG20034.1|4843843_4844971_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
AXG20035.1|4845011_4845500_-	DUF2593 family protein	NA	NA	NA	NA	NA
AXG20036.1|4845559_4846405_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AXG20037.1|4846401_4847355_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AXG20038.1|4847364_4848498_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
AXG20039.1|4848592_4849705_-	putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
AXG20040.1|4850056_4850533_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AXG20041.1|4850620_4851523_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AXG20042.1|4852289_4852577_-	DUF1418 family protein	NA	NA	NA	NA	NA
AXG20043.1|4852736_4852994_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
AXG20044.1|4853023_4853401_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20045.1|4853670_4855356_+	transporter	NA	NA	NA	NA	NA
AXG20046.1|4855591_4855810_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AXG20047.1|4855900_4857001_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	2.9e-176
AXG20048.1|4856997_4857483_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	1.8e-66
AXG20049.1|4857479_4860557_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
AXG20050.1|4860549_4860669_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AXG20051.1|4860683_4860986_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AXG20052.1|4861040_4861556_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AXG20053.1|4861565_4862738_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.1e-202
AXG20054.1|4862844_4863258_-|tail	phage tail protein	tail	U5P0S4	Shigella_phage	73.0	1.5e-21
AXG20055.1|4863257_4865177_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	47.4	8.0e-81
AXG20056.1|4865173_4865779_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
AXG20057.1|4865771_4866680_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.4	2.2e-145
AXG20058.1|4866666_4867026_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	2.5e-52
AXG20059.1|4867022_4867601_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.4	1.5e-91
AXG20312.1|4869991_4870432_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20060.1|4870507_4870954_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	78.4	4.3e-54
AXG20061.1|4870946_4871378_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
AXG20062.1|4871340_4871544_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	79.1	4.7e-24
AXG20063.1|4871473_4871902_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	92.2	8.6e-60
AXG20064.1|4871898_4872414_-	lysozyme	NA	E5G6N1	Salmonella_phage	93.6	1.9e-90
AXG20065.1|4872394_4872610_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AXG20066.1|4872613_4872817_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AXG20067.1|4872816_4873281_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	2.2e-77
AXG20068.1|4873376_4874027_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	95.8	1.5e-111
AXG20069.1|4874030_4875089_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AXG20070.1|4875105_4875939_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	89.9	1.7e-123
AXG20071.1|4876081_4877848_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
AXG20072.1|4877847_4878915_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.0	1.0e-170
AXG20073.1|4878999_4879626_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20074.1|4880428_4880854_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20075.1|4881013_4881319_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AXG20313.1|4881257_4881446_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AXG20076.1|4881599_4884014_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.3	0.0e+00
AXG20077.1|4884010_4884868_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	1.6e-158
AXG20078.1|4884864_4885092_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AXG20079.1|4885091_4885325_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	93.5	5.0e-30
AXG20080.1|4885392_4885734_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AXG20081.1|4885697_4885898_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
AXG20082.1|4885905_4886415_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AXG20083.1|4886447_4886669_-	regulator	NA	NA	NA	NA	NA
AXG20084.1|4886794_4887364_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	42.9	4.2e-38
AXG20085.1|4887379_4887571_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
AXG20086.1|4887789_4889010_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
AXG20314.1|4889081_4890113_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	56.7	5.6e-105
4893416:4893431	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 1
CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	0	13464	310064		Wolbachia_phage(50.0%)	7	NA	NA
AXG20318.1|1539_1716_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20319.1|1963_4351_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
AXG20320.1|4666_7123_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
AXG20321.1|7625_8825_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
AXG20322.1|8821_9889_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	32.9	3.7e-35
AXG20323.1|10128_11376_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20324.1|11664_13464_-	ATP-dependent helicase	NA	S5M596	Bacillus_phage	23.5	1.8e-29
>prophage 2
CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	18052	26702	310064		Cronobacter_phage(25.0%)	11	NA	NA
AXG20329.1|18052_18883_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	39.6	8.4e-43
AXG20330.1|18963_21030_+	chromosome partitioning protein ParB	NA	G8DH78	Emiliania_huxleyi_virus	26.8	2.4e-22
AXG20331.1|21840_22155_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
AXG20332.1|22251_22461_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20620.1|22457_22751_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXG20621.1|23070_23421_+	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	45.1	1.3e-18
AXG20333.1|23764_24532_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
AXG20334.1|24644_24929_+	DNA-binding protein	NA	NA	NA	NA	NA
AXG20622.1|24955_25798_+	RepA replication protein	NA	NA	NA	NA	NA
AXG20335.1|25812_26067_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20336.1|26063_26702_+	ATPase	NA	B0ZSI1	Halomonas_phage	40.1	1.1e-31
>prophage 3
CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	53944	57415	310064		Escherichia_phage(50.0%)	4	NA	NA
AXG20361.1|53944_54337_-	DNA-binding protein	NA	Q71TH9	Escherichia_phage	62.6	1.0e-43
AXG20362.1|54329_54602_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20626.1|55442_55946_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20363.1|56533_57415_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.3	5.0e-54
>prophage 4
CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	61903	63684	310064		Cronobacter_phage(33.33%)	4	NA	NA
AXG20366.1|61903_62608_-	hypothetical protein	NA	M1EZB9	Cronobacter_phage	27.9	1.8e-17
AXG20367.1|62686_62986_-	hypothetical protein	NA	A0A2P1JU39	Erwinia_phage	60.0	9.4e-05
AXG20368.1|63021_63276_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20369.1|63327_63684_-	hypothetical protein	NA	A0A076YMQ7	Citrobacter_phage	42.3	2.4e-07
>prophage 5
CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	67541	72111	310064		Caulobacter_phage(66.67%)	7	NA	NA
AXG20375.1|67541_67838_+	toxin-plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	36.2	8.4e-06
AXG20376.1|67846_69028_+	flavin reductase	NA	NA	NA	NA	NA
AXG20377.1|69418_69796_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20378.1|69931_70366_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20379.1|70366_70687_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20380.1|70802_71438_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	40.4	1.9e-26
AXG20381.1|71499_72111_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	40.3	5.2e-26
>prophage 6
CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	81234	85991	310064		Escherichia_phage(50.0%)	10	NA	NA
AXG20391.1|81234_81966_+	hypothetical protein	NA	Q71T76	Escherichia_phage	56.0	7.3e-67
AXG20392.1|81962_82271_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20629.1|82304_82829_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	62.7	2.8e-44
AXG20393.1|82859_83468_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20394.1|83623_83860_+	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	1.1e-05
AXG20395.1|83893_84142_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20396.1|84226_84607_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20397.1|84806_85118_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AXG20398.1|85122_85614_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
AXG20399.1|85697_85991_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	35.6	2.4e-05
>prophage 7
CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	91664	94441	310064		Pectobacterium_phage(50.0%)	4	NA	NA
AXG20410.1|91664_92075_-	hypothetical protein	NA	A0A2D2W6B4	Pectobacterium_phage	45.1	1.9e-11
AXG20411.1|92074_92329_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20412.1|92544_92739_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20413.1|93235_94441_+	DNA-binding protein	NA	A0A2P9HXK7	Yersinia_phage	27.8	4.5e-13
>prophage 8
CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	99349	102862	310064	transposase	Escherichia_phage(33.33%)	4	NA	NA
AXG20421.1|99349_100330_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	98.8	4.0e-185
AXG20422.1|100558_100918_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20631.1|100950_101664_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	37.7	3.4e-08
AXG20423.1|101680_102862_-	S49 family peptidase	NA	A0A2I6UG67	Salinibacter_virus	29.5	7.8e-10
>prophage 9
CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	134665	143597	310064		Acinetobacter_phage(33.33%)	10	NA	NA
AXG20450.1|134665_135745_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.4	5.6e-39
AXG20451.1|135746_136520_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20452.1|136512_137655_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	34.1	2.5e-29
AXG20453.1|137664_138723_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AXG20454.1|139045_139627_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.6	5.3e-12
AXG20455.1|139626_140784_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AXG20456.1|140806_141262_+	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
AXG20457.1|141284_142325_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
AXG20458.1|142373_142952_+	tellurium resistance protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	1.5e-06
AXG20459.1|143021_143597_+	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	39.6	5.6e-30
>prophage 10
CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	148203	190939	310064	transposase	Escherichia_phage(33.33%)	46	NA	NA
AXG20463.1|148203_149184_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.5	6.8e-185
AXG20464.1|149315_150413_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20465.1|150517_151042_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20466.1|151374_151668_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20467.1|151688_151988_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20468.1|152051_152282_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20469.1|152303_153251_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20470.1|153247_153763_-	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.9	3.2e-08
AXG20471.1|153985_155413_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	49.4	9.5e-103
AXG20472.1|155538_155709_+	hypothetical protein	NA	A0A1P7WFU2	Pectobacterium_phage	56.4	2.3e-08
AXG20473.1|155732_157052_+	DUF1173 family protein	NA	NA	NA	NA	NA
AXG20474.1|157065_157269_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20475.1|157323_158544_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20634.1|158546_159359_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AXG20635.1|159859_160525_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20476.1|160562_161015_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20477.1|161126_161531_+	DNA-binding protein	NA	NA	NA	NA	NA
AXG20478.1|162191_165200_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.2	0.0e+00
AXG20479.1|165359_165917_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	46.1	3.8e-39
AXG20480.1|165933_166797_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
AXG20481.1|166837_167242_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20482.1|167518_167917_-	TIR domain-containing protein	NA	NA	NA	NA	NA
AXG20636.1|167921_169130_-	DUF4071 domain-containing protein	NA	NA	NA	NA	NA
AXG20483.1|169448_170009_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20484.1|170020_170470_+	DNA-binding protein	NA	NA	NA	NA	NA
AXG20485.1|170531_170936_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20486.1|171395_171860_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
AXG20487.1|173923_174274_+	transcriptional regulator	NA	NA	NA	NA	NA
AXG20488.1|174565_175042_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
AXG20489.1|175156_175594_-	PaaI family thioesterase	NA	NA	NA	NA	NA
AXG20490.1|175754_176216_-	dinitrogenase iron-molybdenum cofactor	NA	NA	NA	NA	NA
AXG20491.1|176190_176511_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
AXG20492.1|176970_177975_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AXG20493.1|178039_178567_-	cytochrome C	NA	NA	NA	NA	NA
AXG20494.1|178595_179306_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
AXG20495.1|179307_180513_-	ABC transporter permease	NA	NA	NA	NA	NA
AXG20496.1|180509_181661_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXG20497.1|181657_182266_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXG20498.1|182453_183458_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXG20499.1|184061_184391_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
AXG20500.1|184371_184653_+	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AXG20501.1|184930_185911_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
AXG20502.1|185949_186075_-	ABC transporter	NA	NA	NA	NA	NA
AXG20503.1|186227_186728_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
AXG20504.1|187054_187759_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXG20505.1|188899_190939_+	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	26.4	4.6e-26
>prophage 11
CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	202406	216088	310064		Wolbachia_phage(33.33%)	15	NA	NA
AXG20517.1|202406_203471_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	31.3	7.7e-33
AXG20518.1|203822_204332_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	34.8	1.7e-17
AXG20638.1|204398_206702_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20519.1|207247_208075_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	39.6	1.6e-46
AXG20520.1|208155_210225_+	chromosome partitioning protein ParB	NA	G8DH78	Emiliania_huxleyi_virus	26.1	7.7e-21
AXG20521.1|210286_210496_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20522.1|210857_211253_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20523.1|211271_211586_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
AXG20524.1|211898_212192_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXG20525.1|212479_212827_+	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	46.8	6.6e-18
AXG20526.1|213169_213940_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
AXG20527.1|214051_214336_+	DNA-binding protein	NA	NA	NA	NA	NA
AXG20528.1|214362_215208_+	RepA replication protein	NA	NA	NA	NA	NA
AXG20529.1|215222_215453_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20530.1|215449_216088_+	ATPase	NA	A0A2H4JGZ2	uncultured_Caudovirales_phage	40.0	3.5e-33
>prophage 12
CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	221717	222539	310064		Pithovirus(100.0%)	1	NA	NA
AXG20538.1|221717_222539_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	29.1	4.1e-10
>prophage 13
CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	255801	257034	310064		Pseudomonas_phage(100.0%)	1	NA	NA
AXG20575.1|255801_257034_-	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.3	4.6e-13
>prophage 14
CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	264881	266690	310064		Bacillus_phage(100.0%)	1	NA	NA
AXG20584.1|264881_266690_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	25.9	9.7e-20
>prophage 15
CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	282844	283768	310064		Enterobacteria_phage(100.0%)	1	NA	NA
AXG20595.1|282844_283768_-	stbA family protein	NA	A0A0A7NPX4	Enterobacteria_phage	34.8	6.4e-36
>prophage 16
CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	287015	288020	310064		Aeromonas_phage(100.0%)	1	NA	NA
AXG20600.1|287015_288020_-	peptide transporter	NA	A0A1I9KFW9	Aeromonas_phage	31.1	1.6e-11
>prophage 17
CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	302781	309648	310064		Salmonella_phage(100.0%)	7	NA	NA
AXG20614.1|302781_303657_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.8	1.0e-59
AXG20615.1|304198_305272_+	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	34.1	2.9e-11
AXG20616.1|305289_305490_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20617.1|305486_306206_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20618.1|306472_307294_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20643.1|307308_308133_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	37.8	2.6e-44
AXG20619.1|308493_309648_+	DNA-binding protein	NA	A0A060D5B2	Salmonella_phage	27.8	3.1e-19
>prophage 1
CP031136	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_2, complete sequence	109442	0	82749	109442	tail,capsid,terminase,tRNA	Salmonella_phage(96.34%)	92	NA	NA
AXG20645.1|972_1731_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	46.9	4.5e-51
AXG20646.1|1740_2310_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	2.5e-91
AXG20647.1|2383_4699_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.4	0.0e+00
AXG20648.1|4804_5947_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
AXG20649.1|6024_6894_+	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	81.3	6.3e-134
AXG20650.1|7038_8169_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	86.9	5.1e-192
AXG20651.1|8170_8584_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	84.7	2.3e-62
AXG20652.1|8580_9057_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.5	2.0e-81
AXG20653.1|9056_9701_+	hypothetical protein	NA	J9Q7H4	Salmonella_phage	81.3	7.8e-97
AXG20654.1|9762_10182_+	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	3.2e-51
AXG20655.1|10191_10749_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	82.5	4.8e-87
AXG20656.1|10907_11717_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.2	4.4e-65
AXG20657.1|11900_12494_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	3.4e-99
AXG20658.1|12679_12910_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	85.1	1.7e-30
AXG20659.1|13492_14083_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.8	3.7e-93
AXG20660.1|14231_14726_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	56.2	3.0e-24
AXG20661.1|14735_14924_+	hypothetical protein	NA	J9Q800	Salmonella_phage	53.2	7.2e-11
AXG20662.1|15017_15443_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	78.7	5.7e-56
AXG20663.1|15442_15601_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AXG20664.1|15740_16307_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	62.0	8.5e-55
AXG20665.1|16448_18134_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.2	0.0e+00
AXG20666.1|18194_18899_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	76.4	9.4e-88
AXG20667.1|18898_19279_+	hypothetical protein	NA	J9Q801	Salmonella_phage	67.4	2.2e-27
AXG20668.1|19577_20678_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AXG20669.1|20835_22869_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
AXG20756.1|23108_23330_+	hypothetical protein	NA	J9Q750	Salmonella_phage	52.2	3.3e-15
AXG20757.1|23500_24691_+	hypothetical protein	NA	J9Q803	Salmonella_phage	55.6	3.1e-123
AXG20670.1|26271_26490_+	hypothetical protein	NA	J9Q804	Salmonella_phage	90.3	8.6e-32
AXG20671.1|26628_26958_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20672.1|27111_27423_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
AXG20673.1|27549_27945_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	54.6	3.1e-32
AXG20674.1|28026_28437_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20675.1|28787_29270_+	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	1.0e-61
AXG20676.1|29876_30107_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20677.1|30128_30332_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	89.6	1.7e-26
AXG20678.1|30380_31031_-	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	6.4e-99
AXG20679.1|31326_31851_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	78.4	2.9e-65
AXG20680.1|31847_32447_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20681.1|32462_32951_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20682.1|33096_33696_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20683.1|33728_34007_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
AXG20684.1|34009_35569_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.5	4.1e-277
AXG20685.1|35633_36332_+	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	87.1	5.1e-110
AXG20686.1|36331_37000_+	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	89.2	2.8e-105
AXG20687.1|36996_37635_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	3.6e-110
AXG20688.1|37627_37882_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	5.9e-40
AXG20689.1|37878_38778_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.3	1.3e-166
AXG20690.1|38787_39054_+	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
AXG20691.1|39249_39882_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
AXG20692.1|39881_41138_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.9	3.4e-245
AXG20693.1|41164_42739_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	92.9	8.4e-286
AXG20694.1|42760_43648_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	87.9	1.6e-132
AXG20695.1|43673_44549_+|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	94.2	3.2e-154
AXG20696.1|44622_45543_+	hypothetical protein	NA	J9Q6D6	Salmonella_phage	83.9	2.1e-132
AXG20697.1|45587_46022_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.9	5.7e-59
AXG20698.1|46021_46855_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.3e-141
AXG20699.1|46934_47279_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
AXG20700.1|47269_47743_+	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
AXG20701.1|47744_48128_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	83.5	9.4e-58
AXG20702.1|48202_48949_+	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	83.0	6.2e-106
AXG20703.1|49011_49329_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
AXG20704.1|49409_49679_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.8	1.7e-34
AXG20705.1|49686_54261_+|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	83.8	0.0e+00
AXG20706.1|55465_56197_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	97.0	5.3e-134
AXG20758.1|56189_56987_+|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	94.3	5.9e-155
AXG20707.1|56974_57568_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	3.4e-99
AXG20708.1|57585_62313_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.2	0.0e+00
AXG20709.1|62948_63644_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20759.1|64488_66705_+	chaperone of endosialidase	NA	J9Q6E3	Salmonella_phage	50.2	1.4e-73
AXG20710.1|66765_67020_+	hypothetical protein	NA	J9Q7R5	Salmonella_phage	67.9	3.0e-28
AXG20711.1|67019_67628_+	hypothetical protein	NA	J9Q7G0	Salmonella_phage	74.3	2.6e-78
AXG20712.1|67635_67869_+	hypothetical protein	NA	J9Q714	Salmonella_phage	59.2	3.3e-21
AXG20713.1|67950_68274_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	89.7	5.9e-45
AXG20714.1|68287_68980_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.4e-123
AXG20715.1|68981_69233_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	81.9	1.1e-27
AXG20716.1|69605_70025_+	hypothetical protein	NA	J9Q6E9	Salmonella_phage	61.3	2.8e-39
AXG20717.1|70009_70783_+	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	34.5	2.3e-31
AXG20718.1|70932_71601_+	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
AXG20719.1|71600_71960_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	96.9	3.3e-44
AXG20720.1|72011_73718_+	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.3	1.3e-13
AXG20721.1|73899_74640_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.6	2.2e-127
AXG20722.1|74683_76024_+	DNA helicase	NA	J9Q7G4	Salmonella_phage	93.3	1.3e-234
AXG20723.1|76105_77287_+	DNA primase	NA	J9Q720	Salmonella_phage	90.8	1.3e-203
AXG20724.1|77278_78532_-	sel1 repeat family protein	NA	NA	NA	NA	NA
AXG20725.1|78759_79173_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	48.1	3.9e-25
AXG20726.1|79298_80081_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	43.4	3.0e-58
AXG20727.1|80361_80619_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	60.2	2.3e-15
AXG20728.1|80615_81938_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	90.5	2.2e-239
AXG20760.1|81937_82114_+	hypothetical protein	NA	J9Q729	Salmonella_phage	72.4	1.1e-16
AXG20729.1|82097_82313_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	9.7e-20
AXG20730.1|82309_82462_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	76.0	1.6e-13
AXG20731.1|82458_82749_+	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	78.1	6.9e-37
>prophage 2
CP031136	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_2, complete sequence	109442	85810	108512	109442	integrase	Salmonella_phage(91.3%)	26	82309:82328	92179:92198
82309:82328	attL	AATGATTCCATACATCTCAT	NA	NA	NA	NA
AXG20761.1|85810_86056_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	4.5e-13
AXG20733.1|86266_87370_+|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
AXG20734.1|87364_87751_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXG20735.1|88001_88214_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20736.1|88312_90421_+	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	67.1	6.3e-228
AXG20737.1|90516_91752_+	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	81.3	6.7e-198
AXG20738.1|91754_91958_+	hypothetical protein	NA	J9Q6I7	Salmonella_phage	89.6	4.4e-30
AXG20739.1|91932_94296_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	89.6	0.0e+00
92179:92198	attR	ATGAGATGTATGGAATCATT	NA	NA	NA	NA
AXG20740.1|94344_95079_+	HNH endonuclease	NA	NA	NA	NA	NA
AXG20741.1|95075_96245_+	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	92.2	2.2e-206
AXG20742.1|96371_96803_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.0	4.4e-64
AXG20743.1|96920_97949_+	regulator	NA	J9Q7Z3	Salmonella_phage	86.3	1.4e-143
AXG20744.1|98009_98954_+	exonuclease	NA	J9Q7S6	Salmonella_phage	91.4	5.6e-168
AXG20745.1|98953_99220_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
AXG20746.1|99222_101562_+	recombinase RecA	NA	J9Q736	Salmonella_phage	85.1	1.8e-29
AXG20747.1|101653_101854_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	60.6	3.2e-09
AXG20748.1|101857_102688_+	SPFH/Band 7/PHB domain protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
AXG20762.1|102788_103205_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	75.4	1.4e-59
AXG20749.1|103260_103536_+	hypothetical protein	NA	J9Q738	Salmonella_phage	73.6	9.8e-33
AXG20750.1|103575_103755_+	hypothetical protein	NA	J9Q6J1	Salmonella_phage	67.8	4.0e-11
AXG20751.1|103751_104087_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	8.6e-39
AXG20752.1|104086_104299_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
AXG20753.1|104878_105973_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	45.4	1.3e-75
AXG20754.1|106294_106939_+	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
AXG20755.1|107193_108279_+	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
AXG20763.1|108320_108512_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	74.6	8.3e-23
>prophage 1
CP031137	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_3, complete sequence	77958	4522	53298	77958	protease,integrase,transposase	Escherichia_phage(45.45%)	53	4311:4325	13275:13289
4311:4325	attL	ATGGTGATCCCCTGG	NA	NA	NA	NA
AXG20768.1|4522_5329_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
AXG20769.1|6101_6857_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
AXG20770.1|7444_8611_+	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
AXG20771.1|8610_9582_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
AXG20772.1|10138_10411_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20828.1|10448_11351_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AXG20773.1|11735_12419_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
AXG20774.1|12419_12641_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20775.1|12654_13089_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AXG20776.1|13236_13941_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
13275:13289	attR	CCAGGGGATCACCAT	NA	NA	NA	NA
AXG20777.1|14753_15500_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
AXG20778.1|15554_16115_+	conjugal transfer protein	NA	NA	NA	NA	NA
AXG20779.1|16245_16458_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20829.1|17328_17463_+	type I toxin-antitoxin system hok family toxin	NA	NA	NA	NA	NA
AXG20780.1|17759_18014_+	replication protein	NA	NA	NA	NA	NA
AXG20781.1|18173_18920_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
AXG20782.1|18934_20476_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
AXG20783.1|20616_20754_-	replication protein RepA	NA	NA	NA	NA	NA
AXG20830.1|20837_20912_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
AXG20784.1|22123_22510_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20785.1|22699_23353_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXG20786.1|23572_24037_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AXG20831.1|24056_24137_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20787.1|24320_25631_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AXG20788.1|25907_26768_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AXG20789.1|27352_28057_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXG20790.1|28415_28874_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.0	7.8e-59
AXG20791.1|29176_30037_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AXG20792.1|30049_30592_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AXG20793.1|31073_31265_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20794.1|31270_31516_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20795.1|31566_32694_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AXG20796.1|32730_33435_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXG20797.1|33556_34462_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AXG20798.1|34458_35697_+	MFS transporter	NA	NA	NA	NA	NA
AXG20799.1|35696_36281_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXG20800.1|36226_36583_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20832.1|36773_37538_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXG20833.1|37524_37776_+	hypothetical protein	NA	NA	NA	NA	NA
AXG20801.1|37666_38371_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXG20802.1|39017_39365_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXG20803.1|39570_40359_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AXG20834.1|40489_40963_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
AXG20804.1|41865_42570_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXG20835.1|42713_43268_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AXG20836.1|43398_44229_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AXG20805.1|44366_44999_+	type B chloramphenicol O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
AXG20806.1|45382_46087_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXG20807.1|47583_47775_-	hypothetical protein	NA	NA	NA	NA	NA
AXG20808.1|47973_48954_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	2.6e-184
AXG20837.1|49027_49687_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AXG20809.1|49887_50265_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXG20810.1|50331_53298_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
>prophage 2
CP031137	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_3, complete sequence	77958	59052	69617	77958		Escherichia_phage(44.44%)	9	NA	NA
AXG20816.1|59052_59793_+	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
AXG20817.1|60077_61055_-	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
AXG20818.1|62187_62547_-	pdcB	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
AXG20819.1|62574_62754_-	PdcA protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
AXG20820.1|62758_63139_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
AXG20821.1|63138_63360_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AXG20839.1|63542_65099_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
AXG20822.1|65095_66379_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
AXG20823.1|66500_69617_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	2.9e-27
