The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	10379	44499	5536539	plate,tail,tRNA	Salmonella_phage(33.33%)	38	NA	NA
AXG40856.1|10379_10601_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.4	1.1e-18
AXG40857.1|10677_11763_-	late control protein D	NA	E5G6Q3	Salmonella_phage	60.2	1.8e-117
AXG40858.1|11759_12224_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	65.9	2.6e-46
AXG40859.1|12226_14665_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	32.5	1.6e-86
AXG40860.1|14645_14768_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	66.7	5.7e-09
AXG40861.1|14779_15097_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	52.7	2.0e-21
AXG40862.1|15123_15639_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	64.0	1.3e-57
AXG40863.1|15649_16822_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	75.3	7.4e-170
AXG40864.1|17806_18337_+|tail	tail assembly chaperone	tail	A0A0A7NRZ7	Enterobacteria_phage	44.6	2.6e-34
AXG40865.1|18416_18509_+	hypothetical protein	NA	NA	NA	NA	NA
AXG40866.1|18566_19166_-|tail	phage tail protein	tail	M1SV83	Escherichia_phage	45.2	1.1e-41
AXG40867.1|19162_19651_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	46.1	5.8e-28
AXG40868.1|19650_20778_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	53.6	3.1e-93
AXG40869.1|20774_21389_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	64.8	8.8e-74
AXG40870.1|21381_22380_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	56.4	3.1e-84
AXG40871.1|22384_22726_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	59.1	1.6e-29
AXG45119.1|22725_23568_-|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	39.5	1.8e-40
AXG40872.1|23939_24143_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	70.1	2.0e-22
AXG45120.1|24986_25601_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	42.9	1.9e-44
AXG40873.1|25883_26456_-	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	67.9	2.0e-67
AXG40874.1|27561_27903_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	62.1	6.5e-10
AXG45121.1|28321_28906_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	41.4	3.3e-30
AXG40875.1|28953_30039_-	sulfurtransferase	NA	M1TAS6	Escherichia_phage	45.2	2.3e-24
AXG40876.1|30423_30564_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
AXG40877.1|30583_30838_-	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AXG40878.1|30986_32816_-	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.6	1.8e-130
AXG40879.1|32923_34297_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.8	4.8e-35
AXG40880.1|34425_34848_-	ATP synthase epsilon chain	NA	NA	NA	NA	NA
AXG40881.1|34869_36252_-	ATP synthase subunit beta	NA	NA	NA	NA	NA
AXG40882.1|36286_37150_-	ATP synthase subunit gamma	NA	NA	NA	NA	NA
AXG40883.1|37208_38750_-	ATP synthase subunit alpha	NA	NA	NA	NA	NA
AXG40884.1|38764_39298_-	ATP synthase subunit delta	NA	NA	NA	NA	NA
AXG40885.1|39310_39781_-	ATP synthase subunit B	NA	NA	NA	NA	NA
AXG40886.1|39839_40079_-	ATP synthase subunit C	NA	NA	NA	NA	NA
AXG40887.1|40132_40957_-	ATP synthase subunit A	NA	NA	NA	NA	NA
AXG40888.1|40987_41365_-	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
AXG40889.1|41975_42596_-	ribosomal RNA small subunit methyltransferase G	NA	NA	NA	NA	NA
AXG40890.1|42609_44499_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 2
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	142036	208253	5536539	integrase,coat,transposase	Klosneuvirus(37.5%)	55	136722:136737	204581:204596
136722:136737	attL	AAGTCAGGTTTTGGTG	NA	NA	NA	NA
AXG40972.1|142036_143251_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	68.2	2.0e-157
AXG40973.1|143313_146565_+	hypothetical protein	NA	NA	NA	NA	NA
AXG40974.1|146754_148371_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
AXG45123.1|149142_149310_+	hypothetical protein	NA	NA	NA	NA	NA
AXG40975.1|149353_149950_-	hypothetical protein	NA	NA	NA	NA	NA
AXG45124.1|150229_151360_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AXG40976.1|151668_152142_+	hypothetical protein	NA	NA	NA	NA	NA
AXG40977.1|152279_152747_+	hypothetical protein	NA	NA	NA	NA	NA
AXG40978.1|152795_153122_+	antitoxin	NA	NA	NA	NA	NA
AXG40979.1|153196_153484_+	toxin	NA	NA	NA	NA	NA
AXG40980.1|153597_154431_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AXG40981.1|154518_155556_+	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	42.4	3.2e-68
AXG40982.1|156220_156991_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AXG40983.1|157135_157636_+	hydroxyquinol 1,2-dioxygenase	NA	NA	NA	NA	NA
AXG40984.1|157679_158657_+	hydroxyquinol 1,2-dioxygenase	NA	NA	NA	NA	NA
AXG45125.1|158682_160146_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AXG40985.1|160167_161031_+	CoA transferase subunit A	NA	NA	NA	NA	NA
AXG40986.1|161027_161807_+	3-oxoadipate--succinyl-CoA transferase subunit B	NA	NA	NA	NA	NA
AXG40987.1|161803_162868_+	maleylacetate reductase	NA	NA	NA	NA	NA
AXG40988.1|162929_164132_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AXG40989.1|164325_164712_+	2Fe-2S ferredoxin	NA	NA	NA	NA	NA
AXG40990.1|165603_166185_+	hypothetical protein	NA	NA	NA	NA	NA
AXG40991.1|169520_170420_-	3-methyladenine DNA glycosylase 2	NA	NA	NA	NA	NA
AXG40992.1|170565_171504_+	hypothetical protein	NA	NA	NA	NA	NA
AXG40993.1|172439_172742_+	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
AXG40994.1|173505_174606_+	amidinotransferase	NA	NA	NA	NA	NA
AXG45126.1|174618_175626_+	hypothetical protein	NA	NA	NA	NA	NA
AXG45127.1|175717_176581_+	hypothetical protein	NA	NA	NA	NA	NA
AXG40995.1|176740_177622_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AXG40996.1|177666_177852_+	hypothetical protein	NA	NA	NA	NA	NA
AXG40997.1|177994_179587_+	hypothetical protein	NA	NA	NA	NA	NA
AXG40998.1|179749_180253_+	hypothetical protein	NA	NA	NA	NA	NA
AXG40999.1|180748_182338_+	hypothetical protein	NA	NA	NA	NA	NA
AXG41000.1|182772_184365_+	hypothetical protein	NA	A0A1V0SLG8	Klosneuvirus	24.9	8.3e-07
AXG41001.1|184676_186269_+	hypothetical protein	NA	A0A1V0SLG8	Klosneuvirus	29.3	1.6e-05
AXG41002.1|186361_187951_+	hypothetical protein	NA	A0A1V0SLG8	Klosneuvirus	27.0	1.4e-06
AXG41003.1|188349_188550_-	hypothetical protein	NA	NA	NA	NA	NA
AXG41004.1|190576_191764_-	mannonate dehydratase	NA	NA	NA	NA	NA
AXG41005.1|191801_192545_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXG41006.1|192663_193644_-	hypothetical protein	NA	NA	NA	NA	NA
AXG41007.1|193941_194448_+	TRAP transporter small permease	NA	NA	NA	NA	NA
AXG41008.1|194475_195789_+	hypothetical protein	NA	NA	NA	NA	NA
AXG41009.1|195816_197298_+	fructuronate reductase	NA	G9E6E2	Micromonas_pusilla_virus	32.7	1.1e-48
AXG41010.1|197294_198719_+	uronate isomerase	NA	NA	NA	NA	NA
AXG41011.1|198715_199660_+	sugar kinase	NA	NA	NA	NA	NA
AXG41012.1|199677_200307_+	2-dehydro-3-deoxyphosphogluconate aldolase	NA	NA	NA	NA	NA
AXG41013.1|200389_200878_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXG41014.1|200868_201141_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AXG41015.1|202276_203782_+	DUF1933 domain-containing protein	NA	A0A0P0C1V4	Ostreococcus_lucimarinus_virus	30.3	2.2e-17
AXG41016.1|203784_204534_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
AXG41017.1|204547_205369_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
204581:204596	attR	AAGTCAGGTTTTGGTG	NA	NA	NA	NA
AXG41018.1|205445_206630_+	antibiotic biosynthesis protein CarD	NA	NA	NA	NA	NA
AXG41019.1|206616_206871_+	ferredoxin	NA	A0A0E3ETU3	Synechococcus_phage	32.5	1.5e-06
AXG45128.1|206893_207727_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
AXG41020.1|207716_208253_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
>prophage 3
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	320062	378137	5536539	plate,transposase,tRNA	Planktothrix_phage(16.67%)	45	NA	NA
AXG41109.1|320062_320977_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AXG41110.1|320986_323056_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AXG41111.1|323673_324897_-	cytochrome P450, cyclodipeptide synthase-associated	NA	NA	NA	NA	NA
AXG41112.1|324982_325687_-|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	NA	NA	NA	NA
AXG41113.1|326153_326459_+	hypothetical protein	NA	NA	NA	NA	NA
AXG41114.1|326437_327358_+	transporter	NA	NA	NA	NA	NA
AXG41115.1|327960_329568_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXG41116.1|329686_330706_+	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
AXG41117.1|330716_331616_+	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
AXG41118.1|331628_332609_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	4.3e-14
AXG41119.1|332605_333625_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	2.1e-19
AXG41120.1|333987_334695_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
AXG41121.1|334873_336364_+	insulinase family protein	NA	NA	NA	NA	NA
AXG41122.1|336407_336614_-	tautomerase	NA	NA	NA	NA	NA
AXG41123.1|336669_337662_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
AXG41124.1|337891_338074_-	hypothetical protein	NA	NA	NA	NA	NA
AXG41125.1|338189_339242_-|transposase	IS630 family transposase ISPlu8	transposase	NA	NA	NA	NA
AXG41126.1|339642_341037_+	hypothetical protein	NA	NA	NA	NA	NA
AXG41127.1|341184_341640_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	36.8	6.2e-16
AXG41128.1|343307_343856_+	hypothetical protein	NA	NA	NA	NA	NA
AXG41129.1|344194_348637_-	hemolysin activation protein	NA	NA	NA	NA	NA
AXG41130.1|348702_350370_-	hemolysin activation protein	NA	NA	NA	NA	NA
AXG41131.1|351039_351633_-	hypothetical protein	NA	NA	NA	NA	NA
AXG41132.1|352143_352872_+	transcriptional regulator	NA	NA	NA	NA	NA
AXG41133.1|353824_354022_+	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	51.9	1.9e-09
AXG41134.1|355275_355659_-	hypothetical protein	NA	NA	NA	NA	NA
AXG41135.1|356165_356558_-	hypothetical protein	NA	NA	NA	NA	NA
AXG45138.1|356567_356729_-	hypothetical protein	NA	NA	NA	NA	NA
AXG41136.1|356796_357681_-|transposase	IS982 family transposase ISPlu11	transposase	NA	NA	NA	NA
AXG41137.1|357838_358333_-	hypothetical protein	NA	NA	NA	NA	NA
AXG41138.1|359319_360027_-	hypothetical protein	NA	NA	NA	NA	NA
AXG45139.1|360332_360809_-	hypothetical protein	NA	NA	NA	NA	NA
AXG41139.1|361471_361681_+	hypothetical protein	NA	NA	NA	NA	NA
AXG41140.1|361644_363027_-|transposase	IS4 family transposase ISPlu9	transposase	Q9JMP3	Wolbachia_phage	28.1	2.9e-40
AXG41141.1|363037_363931_-	hypothetical protein	NA	NA	NA	NA	NA
AXG41142.1|364023_367569_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AXG41143.1|367565_368999_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AXG41144.1|369004_369652_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AXG41145.1|369648_370449_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXG41146.1|370445_373091_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.7	1.9e-93
AXG41147.1|373101_373872_-	hypothetical protein	NA	NA	NA	NA	NA
AXG41148.1|373871_375224_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXG41149.1|375226_375793_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AXG41150.1|375792_377079_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AXG41151.1|377084_378137_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 4
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	994768	1063489	5536539	bacteriocin,coat,transposase,tRNA	Sodalis_phage(33.33%)	56	NA	NA
AXG41619.1|994768_995719_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AXG41620.1|995781_996237_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AXG41621.1|996432_997140_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AXG41622.1|997644_998190_-	CpmK protein	NA	NA	NA	NA	NA
AXG41623.1|998186_998723_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
AXG41624.1|998712_999528_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
AXG45167.1|999530_999797_-	DUF1933 domain-containing protein	NA	NA	NA	NA	NA
AXG45168.1|1000086_1002576_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.7	8.9e-40
AXG41625.1|1002669_1005126_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
AXG41626.1|1005610_1007284_+	killer protein of pyocin s3	NA	A4PE23	Ralstonia_virus	48.1	2.2e-05
AXG41627.1|1007283_1007736_+	immunity protein	NA	NA	NA	NA	NA
AXG41628.1|1007817_1008270_+	pyocin immunity protein	NA	NA	NA	NA	NA
AXG45169.1|1008390_1008816_+	HNH endonuclease	NA	NA	NA	NA	NA
AXG41629.1|1008823_1009075_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AXG41630.1|1009360_1009828_+	hypothetical protein	NA	NA	NA	NA	NA
AXG41631.1|1009892_1010360_+	pyocin immunity protein	NA	NA	NA	NA	NA
AXG41632.1|1010421_1010679_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AXG41633.1|1010907_1011369_+	hypothetical protein	NA	NA	NA	NA	NA
AXG41634.1|1011474_1011783_+	hypothetical protein	NA	NA	NA	NA	NA
AXG45170.1|1011934_1012264_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXG41635.1|1012257_1013574_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AXG41636.1|1014366_1017873_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	30.0	2.3e-73
AXG41637.1|1017869_1022603_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.8	4.1e-78
AXG41638.1|1022599_1028629_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.2	2.8e-79
AXG41639.1|1028658_1028856_-	hypothetical protein	NA	NA	NA	NA	NA
AXG41640.1|1028894_1029179_-	XRE family transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	49.5	1.6e-17
AXG41641.1|1029168_1029390_-	hypothetical protein	NA	Q6UAT3	Klebsiella_phage	57.1	7.9e-09
AXG41642.1|1029490_1029754_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXG41643.1|1029795_1031079_-	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AXG41644.1|1031129_1031915_-	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
AXG41645.1|1032223_1032568_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.0e-26
AXG41646.1|1032656_1033484_-	cobalamin-binding protein	NA	NA	NA	NA	NA
AXG41647.1|1033689_1034391_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AXG41648.1|1034518_1036045_+	dGTPase	NA	NA	NA	NA	NA
AXG41649.1|1036059_1038387_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	31.5	1.9e-52
AXG41650.1|1038440_1039757_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.2	1.9e-33
AXG41651.1|1039798_1042030_+	GTP diphosphokinase	NA	NA	NA	NA	NA
AXG41652.1|1042097_1042877_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AXG41653.1|1043098_1044736_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.1	3.2e-155
AXG41654.1|1044809_1046111_+	enolase	NA	W6LP63	Streptococcus_phage	58.0	7.5e-131
AXG41655.1|1046426_1046612_+	hypothetical protein	NA	NA	NA	NA	NA
AXG45171.1|1046807_1047515_+	hypothetical protein	NA	NA	NA	NA	NA
AXG41656.1|1047705_1048887_+	IscS subfamily cysteine desulfurase	NA	H7BUW1	unidentified_phage	39.9	1.3e-36
AXG41657.1|1048909_1050103_+	MFS transporter	NA	NA	NA	NA	NA
AXG41658.1|1050537_1050750_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	2.4e-18
AXG45172.1|1051070_1051793_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	32.6	2.2e-15
AXG41659.1|1051953_1052676_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	35.3	2.0e-16
AXG41660.1|1052997_1053720_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	30.5	4.9e-15
AXG45173.1|1054020_1054743_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	32.6	4.4e-16
AXG45174.1|1055060_1055783_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	30.3	1.1e-17
AXG41661.1|1055920_1056643_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	31.2	2.4e-14
AXG45175.1|1056804_1057527_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	33.3	2.2e-15
AXG45176.1|1057695_1058418_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	28.8	7.6e-16
AXG41662.1|1059605_1060991_+	Anion transporter	NA	NA	NA	NA	NA
AXG41663.1|1061759_1062185_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	47.5	6.2e-26
AXG41664.1|1062241_1063489_+|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	85.3	8.3e-188
>prophage 5
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	1402982	1413949	5536539		Mycobacterium_phage(25.0%)	12	NA	NA
AXG41901.1|1402982_1404182_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	40.2	6.9e-30
AXG41902.1|1404900_1405860_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	70.8	6.7e-129
AXG41903.1|1405880_1408010_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	51.9	2.5e-208
AXG45193.1|1408012_1408435_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	40.3	6.4e-15
AXG41904.1|1408442_1408673_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	48.6	7.7e-15
AXG41905.1|1409004_1409466_+	cysteine methyltransferase	NA	NA	NA	NA	NA
AXG45194.1|1409636_1409894_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	5.6e-22
AXG45195.1|1409970_1410345_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.5	3.4e-20
AXG41906.1|1410484_1411450_-	lipoyl synthase	NA	NA	NA	NA	NA
AXG45196.1|1411560_1412190_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
AXG41907.1|1412333_1412597_-	hypothetical protein	NA	NA	NA	NA	NA
AXG45197.1|1412737_1413949_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.7	4.5e-106
>prophage 6
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	1778439	1862417	5536539	portal,plate,capsid,tail,head,protease,transposase,lysis,terminase,tRNA	Shigella_phage(17.14%)	98	NA	NA
AXG42169.1|1778439_1779168_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.8	1.7e-31
AXG42170.1|1779471_1780371_-	DUF340 domain-containing protein	NA	NA	NA	NA	NA
AXG42171.1|1780691_1781804_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	33.6	8.4e-06
AXG42172.1|1781803_1783747_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.3	1.3e-38
AXG42173.1|1783827_1784049_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	1.1e-15
AXG42174.1|1784391_1784712_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.6	1.4e-14
AXG42175.1|1784744_1787021_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	3.1e-164
AXG42176.1|1787120_1787339_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXG45215.1|1787495_1788188_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXG42177.1|1788194_1789943_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A1V0SJ29	Klosneuvirus	34.2	5.2e-18
AXG42178.1|1789945_1791715_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.0	1.3e-24
AXG42179.1|1791849_1792809_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.3	6.4e-63
AXG42180.1|1793307_1793802_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
AXG42181.1|1793932_1797286_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.5	3.1e-88
AXG42182.1|1797504_1798116_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AXG42183.1|1798123_1799467_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.0	2.6e-78
AXG42184.1|1799698_1800988_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.9	1.2e-96
AXG42185.1|1801083_1801854_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42186.1|1801960_1803577_+|transposase	IS1634 family transposase ISPlu4	transposase	NA	NA	NA	NA
AXG42187.1|1803737_1804163_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42188.1|1804279_1804513_+	transcriptional regulator	NA	NA	NA	NA	NA
AXG45216.1|1804577_1804841_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42189.1|1805091_1805400_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42190.1|1805393_1806941_+	helicase	NA	A0A286N2P9	Klebsiella_phage	68.9	1.1e-216
AXG42191.1|1806937_1807912_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	62.3	1.6e-117
AXG42192.1|1807911_1808676_+	antitermination protein	NA	F1C595	Cronobacter_phage	45.3	2.1e-56
AXG42193.1|1808854_1809214_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXG42194.1|1809279_1809540_-	hypothetical protein	NA	A0A1S5NR91	Burkholderia_phage	39.5	6.1e-08
AXG42195.1|1809828_1810110_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42196.1|1810112_1810577_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42197.1|1810711_1811215_-	hypothetical protein	NA	K7PK22	Enterobacteria_phage	48.7	2.1e-33
AXG42198.1|1811975_1812551_+	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	71.9	1.8e-68
AXG42199.1|1813374_1814001_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	39.8	1.6e-30
AXG42200.1|1814000_1815128_-	hypothetical protein	NA	K7P7Q7	Enterobacteria_phage	47.4	6.0e-28
AXG42201.1|1815130_1815718_-	hypothetical protein	NA	A0A2I7S9L6	Vibrio_phage	35.1	1.7e-26
AXG42202.1|1815708_1816782_-	hypothetical protein	NA	C9DGQ6	Escherichia_phage	45.0	2.2e-83
AXG42203.1|1816782_1817223_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	54.6	1.4e-33
AXG42204.1|1817219_1817762_-|plate	phage baseplate protein	plate	A0A0C4UQZ3	Shigella_phage	42.7	4.8e-31
AXG42205.1|1817758_1818841_-|tail	phage tail protein	tail	A0A0C4UQS1	Shigella_phage	42.4	1.7e-75
AXG45217.1|1818833_1820189_-	DNA circulation protein	NA	A0A0C4UR32	Shigella_phage	27.6	5.9e-30
AXG42206.1|1820191_1821982_-	hypothetical protein	NA	M4MHE6	Vibrio_phage	26.0	2.3e-37
AXG42207.1|1822164_1822515_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	48.1	3.8e-21
AXG42208.1|1822517_1822877_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	43.9	3.0e-21
AXG42209.1|1824357_1824528_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AXG42210.1|1825084_1825537_-	hypothetical protein	NA	A0A1B0T6F3	Thiobacimonas_phage	29.3	1.2e-06
AXG42211.1|1825533_1825830_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42212.1|1826909_1827212_-	DUF2730 domain-containing protein	NA	M4M9P7	Vibrio_phage	39.8	9.5e-13
AXG42213.1|1827195_1827414_-	molecular chaperone DnaK	NA	NA	NA	NA	NA
AXG42214.1|1827410_1828007_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42215.1|1827999_1828260_-	hypothetical protein	NA	A0A2D1GNW8	Pseudomonas_phage	51.4	1.1e-12
AXG42216.1|1828253_1828511_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42217.1|1828510_1829020_-	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	44.5	1.5e-34
AXG42218.1|1829116_1829539_-	transcriptional regulator	NA	A0A0C4UQZ9	Shigella_phage	39.6	1.9e-19
AXG42219.1|1829549_1830014_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42220.1|1830015_1830525_-	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	43.3	5.0e-30
AXG42221.1|1830521_1831043_-	hypothetical protein	NA	A0A0C4UQU3	Shigella_phage	42.5	6.6e-30
AXG42222.1|1831112_1831421_-	hypothetical protein	NA	K7P7P8	Enterobacteria_phage	51.8	4.2e-16
AXG42223.1|1831506_1831695_-	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	59.0	4.1e-14
AXG42224.1|1831696_1832329_-	DUF3164 domain-containing protein	NA	Q6QIE4	Burkholderia_phage	71.5	3.9e-77
AXG42225.1|1832318_1832516_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42226.1|1832528_1832789_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42227.1|1832785_1833739_-	DNA transposition protein	NA	A0A0C4UQR3	Shigella_phage	52.8	1.7e-84
AXG42228.1|1833753_1835736_-	DDE endonuclease	NA	A0A2I7S9A8	Vibrio_phage	51.4	1.2e-193
AXG42229.1|1835775_1836000_-	DNA-binding protein	NA	A0A0M4UV99	Ralstonia_phage	61.5	6.8e-16
AXG42230.1|1836152_1836791_+	hypothetical protein	NA	A0A076FRF7	Pseudomonas_phage	38.7	1.8e-08
AXG42231.1|1837140_1837551_+	structural protein	NA	A0A0A1IX72	Pseudomonas_phage	51.5	6.4e-28
AXG42232.1|1837562_1837787_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42233.1|1837783_1838233_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.3	7.7e-19
AXG42234.1|1838402_1838969_+	hypothetical protein	NA	A0A0N7KZV8	Escherichia_phage	80.2	7.8e-85
AXG42235.1|1838984_1839377_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42236.1|1839373_1839589_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42237.1|1839607_1839793_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42238.1|1840106_1840457_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	74.1	1.3e-45
AXG42239.1|1840453_1840657_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42240.1|1840867_1841362_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	82.3	2.1e-73
AXG42241.1|1841358_1843089_+|terminase	terminase	terminase	U5P0Q5	Shigella_phage	83.2	2.9e-295
AXG42242.1|1843236_1844448_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	79.9	3.2e-192
AXG42243.1|1844440_1845040_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	79.4	4.3e-89
AXG42244.1|1845048_1846275_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	74.6	4.5e-170
AXG42245.1|1846360_1846654_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	54.1	1.5e-23
AXG42246.1|1846662_1846995_+|head,tail	head-tail adaptor protein	head,tail	Q7Y406	Yersinia_phage	51.4	2.1e-21
AXG42247.1|1846981_1847374_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	55.9	6.7e-35
AXG42248.1|1847360_1847780_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	61.9	1.7e-39
AXG42249.1|1847802_1848276_+|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	72.7	2.0e-57
AXG42250.1|1848272_1848611_+|tail	phage tail protein	tail	Q7Y401	Yersinia_phage	42.5	3.5e-16
AXG42251.1|1848625_1848814_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	43.8	9.7e-08
AXG42252.1|1848806_1851716_+|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	46.4	5.7e-46
AXG42253.1|1851720_1852056_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	68.2	6.3e-42
AXG42254.1|1852066_1852816_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.1	2.1e-93
AXG42255.1|1852818_1853526_+	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.5	5.7e-109
AXG42256.1|1853602_1853941_+	hypothetical protein	NA	K7PLP0	Enterobacteria_phage	56.6	2.1e-29
AXG42257.1|1853984_1854599_+|tail	phage tail protein	tail	K7PGY0	Enterobacteria_phage	55.8	9.5e-52
AXG42258.1|1854731_1854938_+	hypothetical protein	NA	A0A0P0ZAX5	Stx2-converting_phage	65.2	1.3e-16
AXG42259.1|1855098_1858803_+	host specificity protein	NA	F1C571	Cronobacter_phage	55.5	0.0e+00
AXG45218.1|1859152_1859965_+	hypothetical protein	NA	A0A2I8TVA9	Erwinia_phage	39.0	5.9e-25
AXG42260.1|1859964_1860591_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	41.4	1.7e-32
AXG42261.1|1861248_1861521_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42262.1|1861676_1862417_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	4.7e-21
>prophage 7
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	1889398	2000381	5536539	plate,transposase,tail,tRNA	Stenotrophomonas_phage(22.22%)	85	NA	NA
AXG42286.1|1889398_1890178_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AXG42287.1|1890188_1891511_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AXG42288.1|1891491_1892214_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
AXG42289.1|1892210_1896659_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
AXG42290.1|1896966_1897650_+	RES domain-containing protein	NA	NA	NA	NA	NA
AXG42291.1|1897688_1898309_-	DNA-binding protein	NA	NA	NA	NA	NA
AXG42292.1|1898552_1898792_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AXG42293.1|1898938_1899901_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	62.7	4.8e-82
AXG42294.1|1900294_1901338_-	photopexin B	NA	NA	NA	NA	NA
AXG42295.1|1902715_1903222_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42296.1|1904626_1905613_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42297.1|1905717_1906620_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
AXG42298.1|1906643_1908743_-	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	33.6	1.3e-07
AXG42299.1|1908752_1910717_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42300.1|1910780_1911998_-	hypothetical protein	NA	F2Y385	Organic_Lake_phycodnavirus	25.1	2.0e-05
AXG42301.1|1912107_1915461_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42302.1|1915457_1918166_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42303.1|1918208_1918625_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42304.1|1918621_1919113_-|plate	phage baseplate protein	plate	M4SKQ1	Cyanophage	28.8	9.7e-07
AXG42305.1|1919125_1920727_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42306.1|1920723_1921407_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42307.1|1921393_1921573_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42308.1|1921569_1922028_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXG42309.1|1922041_1923277_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
AXG42310.1|1923324_1924758_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
AXG42311.1|1924769_1925852_-|tail	phage tail sheath family protein	tail	D5LGY7	Escherichia_phage	27.0	7.4e-07
AXG42312.1|1925905_1926355_-|tail	phage tail protein	tail	A0A1J0GW41	Streptomyces_phage	28.2	9.8e-06
AXG42313.1|1927103_1928030_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	61.4	3.9e-81
AXG42314.1|1928130_1928427_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42315.1|1928457_1929432_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42316.1|1931053_1931746_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
AXG42317.1|1931770_1933855_-	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	34.5	9.8e-08
AXG42318.1|1933864_1935556_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42319.1|1935612_1936644_-	hypothetical protein	NA	R4TQ39	Phaeocystis_globosa_virus	35.0	1.8e-07
AXG42320.1|1936786_1939666_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42321.1|1939658_1942361_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42322.1|1942437_1942854_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42323.1|1942850_1943297_-|plate	phage baseplate protein	plate	A0A0E3ETF4	Synechococcus_phage	30.5	1.6e-08
AXG42324.1|1943309_1944911_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42325.1|1944907_1945591_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42326.1|1945577_1945757_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42327.1|1945753_1946212_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXG42328.1|1946247_1947423_-|tail	phage tail sheath family protein	tail	A0A2I7QP51	Vibrio_phage	31.0	5.7e-05
AXG42329.1|1947478_1948864_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
AXG42330.1|1948875_1949958_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
AXG42331.1|1950133_1950583_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXG42332.1|1951513_1952461_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42333.1|1953662_1954565_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
AXG42334.1|1954589_1956656_-	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	34.5	4.4e-08
AXG42335.1|1956665_1958228_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42336.1|1958301_1959333_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42337.1|1959534_1962441_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42338.1|1962437_1965140_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42339.1|1965236_1965653_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42340.1|1965649_1966141_-|plate	phage baseplate protein	plate	M4SKQ1	Cyanophage	27.9	2.8e-06
AXG42341.1|1966153_1967755_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42342.1|1967751_1968435_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42343.1|1968421_1968601_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42344.1|1968597_1969056_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXG42345.1|1969069_1970275_-|tail	phage tail sheath family protein	tail	A0A2I7QP51	Vibrio_phage	31.9	5.3e-06
AXG42346.1|1970323_1971808_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
AXG42347.1|1971819_1972896_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
AXG42348.1|1972949_1973399_-|tail	phage tail protein	tail	A0A1J0GW41	Streptomyces_phage	28.2	1.3e-05
AXG42349.1|1974426_1975449_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	50.4	4.2e-60
AXG42350.1|1975942_1976965_-	Insecticial toxin	NA	NA	NA	NA	NA
AXG42351.1|1977084_1977927_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42352.1|1978265_1978748_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42353.1|1978849_1979752_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
AXG42354.1|1979776_1981861_-	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	34.5	9.8e-08
AXG42355.1|1981870_1983526_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42356.1|1983589_1984894_-	hypothetical protein	NA	I3PUX0	Vibrio_phage	47.9	4.4e-06
AXG42357.1|1985081_1987982_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42358.1|1987974_1990692_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42359.1|1990735_1991152_-	hypothetical protein	NA	NA	NA	NA	NA
AXG45219.1|1991148_1991580_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
AXG42360.1|1991880_1993482_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42361.1|1993478_1994162_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42362.1|1994148_1994328_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42363.1|1994324_1994783_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXG42364.1|1994796_1995975_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
AXG42365.1|1996029_1997430_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
AXG42366.1|1997441_1998506_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
AXG42367.1|1998520_1998970_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXG42368.1|1999090_1999273_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42369.1|1999340_2000381_-|transposase	IS630 family transposase ISPlu16	transposase	NA	NA	NA	NA
>prophage 8
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	2047567	2100179	5536539	plate,tail,head,protease,transposase	Shigella_phage(37.84%)	57	NA	NA
AXG42403.1|2047567_2049364_-|protease	Lon protease	protease	NA	NA	NA	NA
AXG42404.1|2049504_2049960_+	macrodomain Ter protein	NA	NA	NA	NA	NA
AXG42405.1|2050109_2051216_-	porin OmpA	NA	NA	NA	NA	NA
AXG42406.1|2051765_2052299_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AXG42407.1|2052547_2053150_+	DNA transformation protein tfoX	NA	NA	NA	NA	NA
AXG42408.1|2053209_2055351_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AXG42409.1|2055590_2057645_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	24.3	6.3e-15
AXG42410.1|2057767_2058226_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AXG42411.1|2058348_2058762_+	CoA-binding protein	NA	NA	NA	NA	NA
AXG45222.1|2060752_2061070_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AXG42412.1|2061295_2061574_+	acylphosphatase	NA	NA	NA	NA	NA
AXG45223.1|2061587_2061917_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AXG42413.1|2062147_2062489_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42414.1|2063416_2063845_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42415.1|2064058_2064487_+|transposase	IS200/IS605 family transposase ISPlu2	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	37.9	2.8e-18
AXG42416.1|2065885_2066866_+	subtype I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	37.8	5.8e-51
AXG42417.1|2068169_2068808_-	hypothetical protein	NA	A0A076FRF7	Pseudomonas_phage	38.7	1.8e-08
AXG42418.1|2068960_2069185_+	DNA-binding protein	NA	A0A0M4UV99	Ralstonia_phage	61.5	6.8e-16
AXG42419.1|2069224_2071207_+	DDE endonuclease	NA	A0A2I7S9A8	Vibrio_phage	51.4	1.2e-193
AXG42420.1|2071221_2072175_+	DNA transposition protein	NA	A0A0C4UQR3	Shigella_phage	52.8	1.7e-84
AXG42421.1|2072171_2072432_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42422.1|2072444_2072642_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42423.1|2072631_2073264_+	DUF3164 domain-containing protein	NA	Q6QIE4	Burkholderia_phage	71.5	3.9e-77
AXG42424.1|2073265_2073454_+	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	59.0	4.1e-14
AXG42425.1|2073539_2073848_+	hypothetical protein	NA	K7P7P8	Enterobacteria_phage	51.8	4.2e-16
AXG42426.1|2073917_2074439_+	hypothetical protein	NA	A0A0C4UQU3	Shigella_phage	42.5	6.6e-30
AXG42427.1|2074435_2074945_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	43.3	5.0e-30
AXG42428.1|2074946_2075411_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42429.1|2075421_2075844_+	transcriptional regulator	NA	A0A0C4UQZ9	Shigella_phage	39.6	1.9e-19
AXG42430.1|2075940_2076450_+	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	44.5	1.5e-34
AXG42431.1|2076449_2076707_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42432.1|2076952_2077561_+	hypothetical protein	NA	NA	NA	NA	NA
AXG45224.1|2077747_2078050_+	DUF2730 domain-containing protein	NA	M4M9P7	Vibrio_phage	39.8	9.5e-13
AXG42433.1|2078345_2078918_+	hypothetical protein	NA	M4MCR3	Vibrio_phage	60.7	7.2e-54
AXG42434.1|2078917_2080480_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	62.3	4.1e-160
AXG42435.1|2080470_2082054_+	hypothetical protein	NA	A0A0C4UQR8	Shigella_phage	52.7	6.5e-145
AXG42436.1|2082037_2083363_+|head	phage head morphogenesis protein	head	C9DGN7	Escherichia_phage	48.3	1.6e-120
AXG42437.1|2083495_2083966_+	phage virion morphogenesis protein	NA	C9DGN8	Escherichia_phage	41.6	2.7e-22
AXG42438.1|2084130_2085339_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	40.3	1.6e-55
AXG42439.1|2085338_2086262_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	57.4	7.7e-106
AXG42440.1|2086321_2086618_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42441.1|2086614_2087067_+	hypothetical protein	NA	A0A1B0T6F3	Thiobacimonas_phage	29.3	1.2e-06
AXG42442.1|2087066_2087630_+	hypothetical protein	NA	A0A0C4UQU7	Shigella_phage	47.9	2.4e-41
AXG42443.1|2087622_2087793_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AXG42444.1|2087793_2089266_+|tail	phage tail protein	tail	A0A0C4UQS0	Shigella_phage	53.4	8.2e-134
AXG42445.1|2089278_2089638_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	43.9	3.0e-21
AXG42446.1|2089640_2089991_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	48.1	3.8e-21
AXG42447.1|2090124_2091963_+	hypothetical protein	NA	M4MHE6	Vibrio_phage	26.3	3.5e-41
AXG45225.1|2091965_2093321_+	DNA circulation protein	NA	A0A0C4UR32	Shigella_phage	27.6	5.9e-30
AXG42448.1|2093313_2094396_+|tail	phage tail protein	tail	A0A0C4UQS1	Shigella_phage	42.4	1.7e-75
AXG42449.1|2094392_2094935_+|plate	phage baseplate protein	plate	A0A0C4UQZ3	Shigella_phage	42.7	4.8e-31
AXG42450.1|2094931_2095372_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	54.6	1.4e-33
AXG42451.1|2095372_2096446_+	hypothetical protein	NA	C9DGQ6	Escherichia_phage	45.0	2.2e-83
AXG42452.1|2096436_2097024_+	hypothetical protein	NA	A0A2I7S9L6	Vibrio_phage	35.1	1.7e-26
AXG42453.1|2097026_2098154_+	hypothetical protein	NA	K7P7Q7	Enterobacteria_phage	47.4	6.0e-28
AXG42454.1|2098153_2098780_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	39.8	1.6e-30
AXG42455.1|2099603_2100179_-	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	71.9	1.8e-68
>prophage 9
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	2318525	2410319	5536539	portal,plate,capsid,tail,integrase,transposase,holin,lysis,terminase,tRNA	Salmonella_phage(40.91%)	100	2341926:2341985	2376365:2376484
AXG42620.1|2318525_2318954_+|transposase	IS200/IS605 family transposase ISPlu2	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	37.9	2.8e-18
AXG42621.1|2319142_2319814_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG42622.1|2319841_2320522_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG42623.1|2320813_2321494_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG42624.1|2321523_2322204_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG42625.1|2322234_2322915_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG42626.1|2322944_2323625_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG42627.1|2323655_2324336_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG42628.1|2324596_2325280_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG42629.1|2325550_2326231_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG42630.1|2326391_2327072_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG42631.1|2327232_2327913_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG42632.1|2327939_2328620_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG42633.1|2328780_2329458_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG42634.1|2329513_2330206_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AXG42635.1|2331114_2331321_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42636.1|2331636_2332305_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG42637.1|2332722_2332854_-	L-asparaginase	NA	NA	NA	NA	NA
AXG42638.1|2333011_2333686_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG42639.1|2334735_2335644_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AXG42640.1|2335679_2336255_-	serine acetyltransferase	NA	NA	NA	NA	NA
AXG42641.1|2336882_2337800_+	DNA-packaging protein	NA	Q9MCR6	Enterobacteria_phage	39.6	3.5e-34
AXG45235.1|2339749_2340376_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	45.9	1.1e-34
AXG42642.1|2340430_2341180_+|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	56.7	6.8e-44
2341926:2341985	attL	AAAAAAGCCACCTTGCGGTGGCCTTTTCTTTTTTCTAACTCACTGTTTTATCAGCGAATT	NA	NA	NA	NA
AXG42643.1|2342152_2343157_-|integrase	integrase	integrase	Q1I119	Pasteurella_virus	58.5	1.9e-105
AXG42644.1|2343153_2343819_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42645.1|2343871_2344219_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42646.1|2344428_2344791_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXG45236.1|2344857_2345061_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42647.1|2345070_2345274_+	DNA-binding protein	NA	R9TMQ7	Vibrio_phage	50.8	4.3e-09
AXG42648.1|2345486_2345924_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42649.1|2345925_2346333_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42650.1|2346484_2346829_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	40.4	1.5e-14
AXG42651.1|2346895_2347141_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42652.1|2347133_2347358_+	hypothetical protein	NA	F1BUS2	Erwinia_phage	52.1	5.7e-15
AXG42653.1|2347357_2348119_+	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	51.1	2.0e-83
AXG42654.1|2348111_2348921_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	55.1	4.1e-71
AXG42655.1|2348920_2349865_+	hypothetical protein	NA	B7SYG0	Stenotrophomonas_phage	44.7	2.0e-61
AXG45237.1|2349985_2352049_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	58.6	7.3e-213
AXG42656.1|2352052_2352355_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42657.1|2352683_2352881_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42658.1|2353072_2353654_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42659.1|2353664_2354042_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
AXG42660.1|2354387_2355455_-|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	69.1	4.5e-134
AXG42661.1|2355458_2357180_-	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	67.6	1.3e-226
AXG42662.1|2357329_2358172_+|capsid	phage capsid protein	capsid	A0A1J0I2E9	Salmonella_phage	48.8	3.2e-66
AXG42663.1|2358200_2359250_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	65.8	7.9e-131
AXG42664.1|2359277_2360090_+|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	57.0	1.0e-61
AXG42665.1|2360186_2360696_+|capsid	capsid assembly protein	capsid	A0A0M4QWR7	Salmonella_phage	61.6	2.5e-42
AXG42666.1|2360695_2360896_+|tail	phage tail protein	tail	A0A0M4RTN6	Salmonella_phage	56.1	7.4e-14
AXG42667.1|2360952_2361270_+|holin	phage holin, lambda family	holin	C6ZR64	Salmonella_phage	57.1	2.1e-26
AXG42668.1|2361266_2361668_+	structural protein	NA	A0A0A0RQM4	Escherichia_phage	54.0	3.9e-38
AXG42669.1|2361677_2362127_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	42.3	1.2e-16
AXG42670.1|2362137_2362599_+|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	44.4	1.5e-33
AXG42671.1|2362595_2363237_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	48.7	1.4e-42
AXG42672.1|2363233_2363863_+|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	61.8	4.5e-65
AXG42673.1|2363859_2364198_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	60.4	1.1e-30
AXG42674.1|2364202_2365111_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	73.8	5.6e-117
AXG42675.1|2365103_2365712_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	65.8	8.5e-77
AXG42676.1|2367396_2368023_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	39.2	3.6e-30
AXG42677.1|2368079_2368280_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42678.1|2368259_2368694_-	oxidoreductase	NA	A0A1J0I2L5	Salmonella_phage	63.9	2.8e-50
AXG42679.1|2368698_2371836_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	33.3	4.8e-115
AXG45238.1|2371832_2371949_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AXG42680.1|2371981_2372287_-|tail	phage tail protein	tail	A0A0M4RCV2	Salmonella_phage	54.3	2.2e-17
AXG42681.1|2372352_2372865_-|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	63.5	9.7e-58
AXG42682.1|2372888_2374067_-|tail	phage tail protein	tail	A0A0M4S6M1	Salmonella_phage	66.8	4.8e-153
AXG42683.1|2374228_2375377_+	hypothetical protein	NA	A0A0M4REC6	Salmonella_phage	64.3	2.3e-131
AXG42684.1|2375418_2375670_+	hypothetical protein	NA	NA	NA	NA	NA
AXG45239.1|2375854_2376088_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42685.1|2376864_2377413_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2376365:2376484	attR	AAAAAAGCCACCTTGCGGTGGCCTTTTCTTTTTTCTAACTCACTGTTTTATCAGCGAATTTCATTTGGTGCCCAGGGCGGGACTTGAACCCGCACAGCCTTACAGCCGAGGGATTTTAAA	NA	NA	NA	NA
AXG42686.1|2377470_2379303_-	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AXG45240.1|2379286_2379952_-	two-component system response regulator UvrY	NA	NA	NA	NA	NA
AXG45241.1|2380386_2380611_+	DUF2594 domain-containing protein	NA	NA	NA	NA	NA
AXG42687.1|2380970_2381399_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	43.0	4.2e-22
AXG42688.1|2381516_2381855_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42689.1|2382013_2382451_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	44.8	1.4e-25
AXG42690.1|2382942_2383638_+	aquaporin	NA	NA	NA	NA	NA
AXG42691.1|2384020_2384740_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	45.2	2.6e-32
AXG42692.1|2384761_2385388_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	39.6	2.7e-33
AXG42693.1|2385625_2386921_+|tail	phage tail protein	tail	A0A1W6JNW0	Morganella_phage	66.2	1.3e-58
AXG42694.1|2387227_2388226_+	deoxyribonuclease I	NA	NA	NA	NA	NA
AXG42695.1|2388877_2389666_+	phosphate starvation protein PhoH	NA	A0A1B2IGB4	Erwinia_phage	70.5	1.1e-81
AXG42696.1|2390580_2390691_+	hypothetical protein	NA	NA	NA	NA	NA
AXG42697.1|2390877_2391711_-	siderophore-interacting protein	NA	NA	NA	NA	NA
AXG42698.1|2391849_2393079_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AXG42699.1|2393146_2393305_-	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
AXG42700.1|2393285_2394293_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AXG42701.1|2394282_2395620_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AXG42702.1|2395751_2397173_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AXG42703.1|2397210_2397411_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXG42704.1|2397607_2398450_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42705.1|2399225_2400032_-	hypothetical protein	NA	NA	NA	NA	NA
AXG42706.1|2400871_2402083_+|tail	phage tail protein	tail	A0A1W6JNZ8	Morganella_phage	28.2	1.1e-27
AXG42707.1|2402151_2402586_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AXG42708.1|2402582_2402804_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AXG42709.1|2404136_2405885_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	26.8	9.7e-41
AXG42710.1|2406026_2407118_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AXG42711.1|2407259_2407850_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AXG42712.1|2408378_2410319_+|tail	phage tail protein	tail	A0A1W6JNZ8	Morganella_phage	36.1	5.7e-34
>prophage 10
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	2765959	2773489	5536539	plate,tail	Streptomyces_phage(25.0%)	9	NA	NA
AXG43005.1|2765959_2766409_+|tail	phage tail protein	tail	A0A1J0GW41	Streptomyces_phage	29.5	4.4e-06
AXG43006.1|2766482_2767559_+|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
AXG43007.1|2767616_2768909_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	38.7	6.9e-28
AXG43008.1|2768963_2770130_+|tail	phage tail sheath family protein	tail	A0A2I7QP51	Vibrio_phage	29.5	5.7e-05
AXG43009.1|2770148_2770607_+|tail	phage tail protein	tail	NA	NA	NA	NA
AXG43010.1|2770603_2770783_+	hypothetical protein	NA	NA	NA	NA	NA
AXG43011.1|2770769_2771453_+	hypothetical protein	NA	NA	NA	NA	NA
AXG43012.1|2771449_2773054_+	hypothetical protein	NA	NA	NA	NA	NA
AXG43013.1|2773066_2773489_+|plate	phage baseplate protein	plate	A0A0E3ETF4	Synechococcus_phage	32.3	1.8e-09
>prophage 11
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	2902835	2911147	5536539		Escherichia_phage(57.14%)	8	NA	NA
AXG43101.1|2902835_2903684_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	34.7	2.2e-14
AXG43102.1|2904114_2904528_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	55.0	4.8e-31
AXG43103.1|2905614_2906520_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	59.9	1.4e-91
AXG43104.1|2906519_2907797_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	50.2	8.7e-108
AXG43105.1|2907789_2908431_+	aldolase	NA	A0A077SK32	Escherichia_phage	54.1	4.9e-59
AXG43106.1|2908449_2909229_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AXG43107.1|2909241_2910009_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	41.9	9.4e-49
AXG43108.1|2910181_2911147_+	hypothetical protein	NA	A0A1V0SAI6	Catovirus	24.8	8.0e-05
>prophage 12
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	2927781	2935387	5536539	plate,tail	Cyanophage(100.0%)	9	NA	NA
AXG43118.1|2927781_2928198_-|plate	phage baseplate protein	plate	M4SKQ1	Cyanophage	32.3	8.8e-09
AXG43119.1|2928211_2929813_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43120.1|2929809_2930493_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43121.1|2930479_2930659_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43122.1|2930655_2931114_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXG43123.1|2931127_2932324_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
AXG43124.1|2932372_2933749_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
AXG43125.1|2933760_2934885_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
AXG43126.1|2934937_2935387_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 13
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	3068920	3082204	5536539	tRNA	Tupanvirus(44.44%)	12	NA	NA
AXG43239.1|3068920_3070903_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.9	3.0e-22
AXG43240.1|3070903_3071881_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	Q76H32	Enterobacteria_phage	34.0	4.3e-38
AXG43241.1|3071881_3073027_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	26.9	6.1e-36
AXG45267.1|3073187_3073934_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	M1H3A1	Paramecium_bursaria_Chlorella_virus	27.6	4.8e-05
AXG43242.1|3073968_3074976_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AXG43243.1|3075041_3075338_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	7.1e-13
AXG43244.1|3075342_3077730_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.2	1.0e-08
AXG43245.1|3077744_3078728_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.1	8.4e-34
AXG43246.1|3079039_3079396_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AXG43247.1|3079437_3079635_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AXG43248.1|3079732_3080272_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.5	2.9e-12
AXG43249.1|3080275_3082204_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	6.3e-126
>prophage 14
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	3370621	3420905	5536539	tail	Escherichia_phage(45.45%)	52	NA	NA
AXG43442.1|3370621_3371044_-|tail	phage tail protein	tail	B6SCW7	Bacteriophage	46.0	1.5e-27
AXG43443.1|3372665_3373088_-|tail	phage tail protein	tail	B6SCW7	Bacteriophage	44.3	2.8e-26
AXG43444.1|3373090_3373678_-|tail	phage tail protein	tail	A0A0M3ULD8	Salmonella_phage	45.5	1.0e-10
AXG43445.1|3373921_3375337_-|tail	phage tail protein	tail	A5X9J3	Aeromonas_virus	57.6	1.1e-18
AXG43446.1|3375419_3376904_-|tail	phage tail protein	tail	A5X9J3	Aeromonas_virus	38.0	1.5e-18
AXG43447.1|3379132_3379771_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43448.1|3380321_3380654_+	hypothetical protein	NA	NA	NA	NA	NA
AXG43449.1|3380825_3381152_+	transcriptional regulator	NA	NA	NA	NA	NA
AXG43450.1|3381214_3381799_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AXG43451.1|3381821_3382490_-	siroheme synthase	NA	NA	NA	NA	NA
AXG43452.1|3382506_3383412_-	GHMP kinase	NA	NA	NA	NA	NA
AXG43453.1|3383359_3384433_-	threonine-phosphate decarboxylase	NA	NA	NA	NA	NA
AXG45285.1|3384464_3385247_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AXG43454.1|3385559_3386972_+	ethanolamine ammonia-lyase reactivating factor EutA	NA	NA	NA	NA	NA
AXG43455.1|3386984_3388346_+	ethanolamine ammonia lyase large subunit	NA	NA	NA	NA	NA
AXG43456.1|3388368_3389223_+	ethanolamine ammonia-lyase light chain	NA	NA	NA	NA	NA
AXG43457.1|3389316_3389964_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43458.1|3390467_3390887_+	hypothetical protein	NA	NA	NA	NA	NA
AXG43459.1|3390943_3391345_+	hypothetical protein	NA	NA	NA	NA	NA
AXG43460.1|3391409_3391817_+	hypothetical protein	NA	NA	NA	NA	NA
AXG43461.1|3391876_3392281_+	hypothetical protein	NA	NA	NA	NA	NA
AXG43462.1|3392268_3393099_-	DUF4225 domain-containing protein	NA	A0A140XBD0	Dickeya_phage	50.0	1.4e-26
AXG43463.1|3393106_3393586_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AXG43464.1|3393984_3394299_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43465.1|3394620_3395670_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AXG43466.1|3395674_3396292_-	alpha-ribazole phosphatase	NA	NA	NA	NA	NA
AXG43467.1|3396572_3396923_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43468.1|3397397_3397706_+	addiction module antidote protein, HigA family	NA	A0A222YWD7	Escherichia_phage	45.7	9.7e-13
AXG43469.1|3397742_3398489_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AXG43470.1|3398485_3399031_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AXG43471.1|3399027_3400566_-	cobyric acid synthase CobQ	NA	NA	NA	NA	NA
AXG43472.1|3400755_3401469_-	cobalt-factor II C(20)-methyltransferase	NA	NA	NA	NA	NA
AXG43473.1|3401468_3402263_-	sirohydrochlorin cobaltochelatase	NA	NA	NA	NA	NA
AXG43474.1|3402276_3403062_-	cobalt-precorrin-6A reductase	NA	NA	NA	NA	NA
AXG43475.1|3403058_3403784_-	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
AXG43476.1|3403777_3404839_-	cobalt-precorrin 5A hydrolase	NA	NA	NA	NA	NA
AXG43477.1|3404819_3405593_-	cobalt-precorrin-4 methyltransferase	NA	NA	NA	NA	NA
AXG43478.1|3405585_3406155_-	decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase	NA	NA	NA	NA	NA
AXG43479.1|3406144_3406747_-	cobalt-precorrin-7 (C(5))-methyltransferase	NA	NA	NA	NA	NA
AXG43480.1|3406743_3407880_-	cobalt-precorrin-5B (C(1))-methyltransferase	NA	NA	NA	NA	NA
AXG43481.1|3407876_3408509_-	cobalt-precorrin-8 methylmutase	NA	NA	NA	NA	NA
AXG43482.1|3408523_3409483_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
AXG43483.1|3409479_3410862_-	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
AXG43484.1|3412639_3414166_+	trypsin	NA	NA	NA	NA	NA
AXG43485.1|3414989_3415271_+	Killer protein	NA	A0A2L1IV28	Escherichia_phage	54.3	4.5e-25
AXG43486.1|3415267_3415558_+	addiction module antidote protein, HigA family	NA	A0A0N7BS23	Escherichia_phage	52.8	1.6e-20
AXG43487.1|3416013_3416274_+	hemolysin XhlA	NA	NA	NA	NA	NA
AXG43488.1|3416447_3416654_+	hypothetical protein	NA	NA	NA	NA	NA
AXG43489.1|3417387_3417621_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43490.1|3417670_3418243_+	hypothetical protein	NA	NA	NA	NA	NA
AXG43491.1|3418686_3419541_+	hypothetical protein	NA	A0A222YYI1	Escherichia_phage	70.0	2.3e-43
AXG43492.1|3420278_3420905_-|tail	phage tail protein	tail	M1SV83	Escherichia_phage	37.7	3.6e-30
>prophage 15
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	3428573	3444835	5536539	plate,tail	Salmonella_phage(25.0%)	18	NA	NA
AXG43496.1|3428573_3429551_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	42.9	2.9e-10
AXG43497.1|3431231_3431720_+	hypothetical protein	NA	NA	NA	NA	NA
AXG43498.1|3431722_3432145_+|tail	tail assembly chaperone	tail	B6SCW7	Bacteriophage	44.2	9.8e-24
AXG43499.1|3432189_3432816_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	41.0	3.8e-32
AXG43500.1|3432815_3434252_-|tail	phage tail protein	tail	A0A219YBC2	Aeromonas_phage	49.2	2.4e-37
AXG43501.1|3434254_3434827_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	43.6	5.8e-35
AXG43502.1|3434823_3436017_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	50.4	1.0e-102
AXG43503.1|3436009_3436357_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	56.0	2.7e-27
AXG43504.1|3436353_3437109_-|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	62.7	2.2e-74
AXG43505.1|3437105_3438062_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	38.9	4.4e-64
AXG43506.1|3438150_3438456_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	41.1	1.1e-13
AXG43507.1|3438440_3439046_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	51.2	1.1e-47
AXG43508.1|3439048_3440818_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	34.8	2.1e-14
AXG43509.1|3441010_3441421_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43510.1|3441534_3441975_-	DUF3277 domain-containing protein	NA	A0A0M5M1K6	Salmonella_phage	67.8	2.7e-48
AXG43511.1|3441984_3443454_-	hypothetical protein	NA	A0A0P0I492	Acinetobacter_phage	47.3	2.3e-120
AXG43512.1|3443457_3444021_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	53.6	4.0e-49
AXG43513.1|3444415_3444835_-	antitermination protein Q	NA	B6SCZ7	Bacteriophage	45.5	2.6e-29
>prophage 16
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	3694476	3869269	5536539	plate,transposase,tail,tRNA	Erwinia_phage(15.38%)	107	NA	NA
AXG43679.1|3694476_3695415_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	50.8	6.3e-63
AXG43680.1|3695905_3696922_-	formamidase	NA	NA	NA	NA	NA
AXG43681.1|3697407_3698961_+	Fic family protein	NA	NA	NA	NA	NA
AXG43682.1|3699479_3699881_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43683.1|3699880_3700441_-	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
AXG43684.1|3700934_3711515_-	MARTX multifunctional-autoprocessing repeats-in-toxin holotoxin RtxA	NA	NA	NA	NA	NA
AXG43685.1|3712665_3713307_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43686.1|3714266_3714956_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AXG43687.1|3714995_3715682_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG43688.1|3715994_3716663_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXG43689.1|3716987_3717416_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXG43690.1|3717420_3717960_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AXG43691.1|3717937_3718990_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXG43692.1|3718989_3720750_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXG43693.1|3720989_3721223_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43694.1|3721276_3722260_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43695.1|3722303_3724781_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AXG43696.1|3724768_3725281_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXG43697.1|3725332_3725845_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXG43698.1|3726632_3730004_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AXG43699.1|3730000_3731119_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43700.1|3731099_3731333_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43701.1|3731351_3731585_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43702.1|3731672_3732722_-	hypothetical protein	NA	NA	NA	NA	NA
AXG45289.1|3732775_3734389_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43703.1|3734392_3736918_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	1.6e-04
AXG45290.1|3737756_3741107_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AXG43704.1|3741123_3742269_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43705.1|3742265_3742523_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AXG43706.1|3742519_3745009_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43707.1|3744996_3745512_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43708.1|3745563_3746079_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43709.1|3746130_3746640_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43710.1|3746656_3747442_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43711.1|3747445_3749845_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	35.0	3.2e-18
AXG43712.1|3750683_3754055_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AXG43713.1|3754051_3755170_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43714.1|3755150_3755372_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43715.1|3755390_3755624_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43716.1|3755711_3756818_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43717.1|3756939_3758031_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43718.1|3758023_3759634_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43719.1|3759636_3762165_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.7	5.5e-05
AXG43720.1|3762341_3762833_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AXG43721.1|3762851_3764579_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43722.1|3764575_3765250_-	type VI secretion protein ImpK	NA	NA	NA	NA	NA
AXG43723.1|3765246_3766596_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXG43724.1|3766611_3768138_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AXG43725.1|3768169_3768667_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AXG43726.1|3769822_3785473_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.8	1.1e-175
AXG43727.1|3787678_3788704_+|transposase	IS630 family transposase ISPlu19	transposase	NA	NA	NA	NA
AXG43728.1|3789304_3790921_-|transposase	IS1634 family transposase ISPlu4	transposase	NA	NA	NA	NA
AXG43729.1|3793169_3793421_+	hypothetical protein	NA	NA	NA	NA	NA
AXG43730.1|3793407_3795204_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
AXG43731.1|3795295_3795718_-	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
AXG43732.1|3795753_3797049_-	peptidase B	NA	Q6GYZ8	Mycoplasma_phage	42.3	1.5e-38
AXG43733.1|3797357_3797558_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AXG43734.1|3797576_3797912_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AXG43735.1|3797914_3799765_-	molecular chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.1	3.9e-109
AXG43736.1|3799776_3800298_-	co-chaperone protein HscB	NA	NA	NA	NA	NA
AXG43737.1|3800335_3800659_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	49.5	5.4e-22
AXG43738.1|3800768_3801155_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	3.5e-52
AXG43739.1|3801179_3802394_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	2.7e-34
AXG43740.1|3802443_3802938_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AXG43741.1|3803024_3803750_-|tRNA	tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AXG43742.1|3803883_3804687_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
AXG43743.1|3804789_3806451_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AXG43744.1|3806550_3807972_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AXG43745.1|3808120_3809068_-	trehalose operon repressor	NA	NA	NA	NA	NA
AXG43746.1|3809140_3810286_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
AXG43747.1|3810605_3811859_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	51.3	1.9e-99
AXG43748.1|3812230_3813421_+	flavohemoprotein	NA	NA	NA	NA	NA
AXG43749.1|3814076_3814499_-	regulatory protein RecX	NA	NA	NA	NA	NA
AXG43750.1|3814495_3815890_-	transcriptional regulator	NA	NA	NA	NA	NA
AXG43751.1|3815949_3816531_-	resolvase	NA	A0A0F7LA37	Escherichia_phage	36.6	2.0e-22
AXG43752.1|3816878_3817289_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43753.1|3817697_3817901_+	hypothetical protein	NA	NA	NA	NA	NA
AXG43754.1|3817897_3818029_+	hypothetical protein	NA	NA	NA	NA	NA
AXG43755.1|3818004_3819030_-|transposase	IS630 family transposase ISPlu3	transposase	NA	NA	NA	NA
AXG43756.1|3819103_3820129_-|transposase	IS630 family transposase ISPlu19	transposase	NA	NA	NA	NA
AXG43757.1|3820420_3821071_-	DUF4276 domain-containing protein	NA	NA	NA	NA	NA
AXG43758.1|3821067_3822156_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AXG43759.1|3822715_3823303_-	hypothetical protein	NA	NA	NA	NA	NA
AXG45291.1|3823787_3824891_-	hypothetical protein	NA	NA	NA	NA	NA
AXG45292.1|3825332_3826535_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43760.1|3826723_3827785_-	phenazine antibiotic biosynthesis protein	NA	NA	NA	NA	NA
AXG43761.1|3828467_3828806_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AXG43762.1|3828821_3830444_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.8	1.1e-94
AXG43763.1|3830510_3831848_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	38.2	1.8e-10
AXG43764.1|3831844_3832690_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AXG45293.1|3832693_3834148_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.3	2.0e-15
AXG43765.1|3834908_3835181_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AXG43766.1|3835167_3835515_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AXG43767.1|3835631_3839519_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.0	2.1e-128
AXG43768.1|3839785_3841201_+	membrane-bound lytic murein transglycosylase MltF	NA	A0A1V0E6L2	Klebsiella_phage	36.6	1.1e-07
AXG43769.1|3841331_3843638_+	arginine decarboxylase	NA	NA	NA	NA	NA
AXG45294.1|3843626_3844145_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AXG43770.1|3851338_3852223_-|transposase	IS982 family transposase ISPlu11	transposase	NA	NA	NA	NA
AXG43771.1|3858936_3859437_+	hypothetical protein	NA	M1TAS6	Escherichia_phage	44.5	1.2e-31
AXG43772.1|3859433_3860033_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	45.2	1.7e-45
AXG43773.1|3860872_3861592_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	41.6	3.4e-16
AXG43774.1|3863465_3864293_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	39.2	2.7e-17
AXG43775.1|3864397_3865366_+|transposase	IS30 family transposase ISPlu1	transposase	Q9MBM9	Staphylococcus_prophage	35.7	5.3e-41
AXG43776.1|3865951_3866779_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	42.7	2.7e-09
AXG43777.1|3866780_3867215_+|tail	phage tail protein	tail	B6SCW7	Bacteriophage	50.4	2.7e-29
AXG43778.1|3867601_3868321_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	41.7	8.9e-17
AXG43779.1|3869008_3869269_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	3.8e-18
>prophage 17
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	3907946	3916333	5536539		Cronobacter_phage(57.14%)	9	NA	NA
AXG43816.1|3907946_3908429_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	49.4	7.3e-31
AXG43817.1|3909491_3909692_+	hypothetical protein	NA	NA	NA	NA	NA
AXG43818.1|3909688_3909958_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.5	2.1e-16
AXG43819.1|3910305_3910716_-	antitoxin	NA	F1C593	Cronobacter_phage	57.9	1.9e-35
AXG43820.1|3910769_3910943_-	mRNA interferase HicA	NA	A0A0M3LQ86	Mannheimia_phage	66.7	3.7e-14
AXG43821.1|3911062_3912712_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	50.1	1.4e-158
AXG43822.1|3912711_3913248_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	54.9	2.0e-42
AXG45297.1|3913219_3913828_-	hypothetical protein	NA	NA	NA	NA	NA
AXG43823.1|3914563_3916333_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	53.6	1.5e-73
>prophage 18
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	4002811	4011261	5536539	transposase,tRNA	Sodalis_phage(16.67%)	7	NA	NA
AXG43861.1|4002811_4003807_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	65.5	1.1e-78
AXG43862.1|4004010_4004634_-	antibiotic acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	38.7	1.5e-20
AXG43863.1|4005105_4006620_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	1.8e-83
AXG43864.1|4006629_4007728_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
AXG43865.1|4007885_4009619_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.6	9.8e-62
AXG43866.1|4009618_4010326_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AXG43867.1|4010349_4011261_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.4	2.2e-28
>prophage 19
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	4293284	4365207	5536539	protease,transposase,tRNA	Bacillus_phage(14.29%)	60	NA	NA
AXG44100.1|4293284_4294247_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	50.8	4.9e-63
AXG45313.1|4296751_4297549_+	hypothetical protein	NA	NA	NA	NA	NA
AXG45314.1|4297604_4298879_+	MFS transporter	NA	NA	NA	NA	NA
AXG44101.1|4298939_4300004_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AXG44102.1|4300223_4302656_-	ABC transporter permease	NA	NA	NA	NA	NA
AXG44103.1|4302652_4303339_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.7e-31
AXG45315.1|4303306_4303942_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
AXG44104.1|4303992_4304778_+	oxidoreductase	NA	NA	NA	NA	NA
AXG44105.1|4304846_4305704_+	co-chaperone YbbN	NA	NA	NA	NA	NA
AXG44106.1|4305728_4306649_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AXG44107.1|4306651_4307107_+	NfeD family protein	NA	NA	NA	NA	NA
AXG44108.1|4307100_4307502_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AXG44109.1|4307710_4308595_+|transposase	IS982 family transposase ISPlu6	transposase	NA	NA	NA	NA
AXG44110.1|4308639_4311375_+	Cu+ exporting ATPase	NA	A0A218MNH6	uncultured_virus	36.1	1.2e-106
AXG44111.1|4311501_4311819_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AXG44112.1|4311999_4312812_+	polysaccharide biosynthesis protein GumN	NA	NA	NA	NA	NA
AXG44113.1|4313012_4313489_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AXG44114.1|4313550_4315209_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
AXG44115.1|4315599_4316817_+	MFS transporter	NA	NA	NA	NA	NA
AXG44116.1|4317058_4318765_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
AXG44117.1|4319177_4319789_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44118.1|4320938_4322249_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
AXG44119.1|4322347_4323451_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AXG44120.1|4323634_4324612_-	ferrochelatase	NA	NA	NA	NA	NA
AXG44121.1|4324787_4325432_-	adenylate kinase	NA	NA	NA	NA	NA
AXG44122.1|4325615_4327514_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.7	3.1e-109
AXG44123.1|4328032_4330105_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXG44124.1|4330501_4331107_-	recombination protein RecR	NA	NA	NA	NA	NA
AXG44125.1|4331106_4331436_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AXG44126.1|4331492_4333469_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	37.3	4.0e-43
AXG44127.1|4333565_4334117_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.8	4.1e-30
AXG44128.1|4334260_4334803_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
AXG44129.1|4334825_4334993_+	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AXG44130.1|4335121_4335559_-	DUF1284 domain-containing protein	NA	NA	NA	NA	NA
AXG44131.1|4335681_4336446_+	hypothetical protein	NA	NA	NA	NA	NA
AXG44132.1|4336577_4337126_-	BioY family transporter	NA	NA	NA	NA	NA
AXG44133.1|4337166_4337796_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AXG44134.1|4337792_4338467_-	cobalt ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	26.2	1.4e-11
AXG44135.1|4338880_4339522_-	DNA-binding transcriptional repressor AcrR	NA	NA	NA	NA	NA
AXG44136.1|4339651_4340845_+	MexE family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXG44137.1|4340872_4344022_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AXG44138.1|4345076_4345280_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AXG44139.1|4345591_4345789_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44140.1|4345914_4347531_+|transposase	IS1634 family transposase ISPlu4	transposase	NA	NA	NA	NA
AXG44141.1|4347521_4347812_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44142.1|4348062_4348926_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
AXG45316.1|4348998_4350282_-	ammonium transporter	NA	NA	NA	NA	NA
AXG44143.1|4350304_4350643_-	transcriptional regulator	NA	NA	NA	NA	NA
AXG44144.1|4350823_4352608_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	6.4e-40
AXG44145.1|4352600_4354370_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.8	5.4e-47
AXG44146.1|4354456_4354918_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AXG44147.1|4355045_4356098_+	cysteine synthase	NA	NA	NA	NA	NA
AXG44148.1|4356130_4356829_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.1	2.7e-87
AXG44149.1|4356857_4357265_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AXG44150.1|4357418_4357793_-	transporter	NA	NA	NA	NA	NA
AXG44151.1|4357943_4359815_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXG44152.1|4360108_4360399_-	DNA-binding protein HU-beta	NA	B5TA87	Burkholderia_phage	54.4	3.8e-19
AXG44153.1|4360612_4362967_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.7	3.4e-222
AXG44154.1|4363175_4364447_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.2	2.1e-130
AXG44155.1|4364583_4365207_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	62.9	3.4e-65
>prophage 20
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	4523249	4581493	5536539	protease,transposase	Cronobacter_phage(23.08%)	55	NA	NA
AXG44286.1|4523249_4523765_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	6.8e-27
AXG44287.1|4523768_4524410_-	stringent starvation protein A	NA	NA	NA	NA	NA
AXG44288.1|4524756_4525149_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AXG44289.1|4525164_4525593_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AXG44290.1|4525847_4526978_-	cell division protein ZapE	NA	NA	NA	NA	NA
AXG44291.1|4527321_4527726_+	cytochrome D ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AXG44292.1|4527963_4529340_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.5	1.9e-20
AXG44293.1|4530535_4531594_+|protease	serine endoprotease DegS	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	37.2	4.4e-12
AXG44294.1|4532380_4533823_+	hypothetical protein	NA	NA	NA	NA	NA
AXG44295.1|4533831_4536327_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AXG44296.1|4536532_4536982_+	hypothetical protein	NA	NA	NA	NA	NA
AXG44297.1|4537085_4538645_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
AXG44298.1|4539069_4540335_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AXG44299.1|4540386_4540641_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AXG44300.1|4541039_4541333_-	STAS domain-containing protein	NA	NA	NA	NA	NA
AXG44301.1|4541334_4541964_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
AXG44302.1|4541997_4542504_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AXG45326.1|4542508_4543291_-	ABC transporter permease	NA	NA	NA	NA	NA
AXG44303.1|4543301_4544105_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	32.7	1.1e-20
AXG44304.1|4544333_4545308_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
AXG44305.1|4545332_4546301_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.5	1.5e-35
AXG44306.1|4546318_4546882_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	79.3	1.5e-56
AXG44307.1|4546902_4547481_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AXG44308.1|4547461_4547995_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AXG44309.1|4548001_4548727_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.9e-22
AXG44310.1|4548754_4550197_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AXG44311.1|4550220_4550508_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AXG44312.1|4550631_4551099_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AXG44313.1|4551182_4552034_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.1e-05
AXG44314.1|4552033_4552306_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AXG44315.1|4552494_4552905_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
AXG44316.1|4553645_4553915_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.5	1.3e-16
AXG44317.1|4554917_4556567_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	50.1	8.2e-159
AXG44318.1|4556566_4557103_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	54.9	2.0e-42
AXG45327.1|4557074_4557683_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44319.1|4558418_4560227_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	53.9	6.4e-80
AXG44320.1|4561413_4561728_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44321.1|4561965_4563306_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AXG44322.1|4563507_4564047_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
AXG44323.1|4564078_4564348_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44324.1|4564352_4564817_-	barnase	NA	NA	NA	NA	NA
AXG44325.1|4564859_4566305_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AXG44326.1|4566310_4567168_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AXG44327.1|4567164_4570965_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
AXG44328.1|4571006_4572476_-	ribonuclease G	NA	NA	NA	NA	NA
AXG44329.1|4572472_4573060_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AXG44330.1|4573225_4573714_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AXG44331.1|4573713_4574748_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AXG44332.1|4574859_4575903_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	1.6e-06
AXG44333.1|4576464_4577442_+	oxidoreductase	NA	NA	NA	NA	NA
AXG44334.1|4577651_4578104_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AXG44335.1|4578133_4578604_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AXG44336.1|4578616_4579966_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AXG44337.1|4580207_4580390_+	hypothetical protein	NA	NA	NA	NA	NA
AXG44338.1|4580440_4581493_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 21
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	4667037	4730543	5536539	plate,transposase	Hyperthermophilic_Archaeal_Virus_2(33.33%)	48	NA	NA
AXG44402.1|4667037_4668063_+|transposase	IS630 family transposase ISPlu19	transposase	NA	NA	NA	NA
AXG44403.1|4668623_4670291_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44404.1|4670808_4671099_+	hypothetical protein	NA	NA	NA	NA	NA
AXG44405.1|4671314_4671779_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AXG44406.1|4672040_4672655_+	LysE family translocator	NA	NA	NA	NA	NA
AXG44407.1|4672996_4673380_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44408.1|4673556_4673985_-|transposase	IS200/IS605 family transposase ISPlu2	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	37.9	2.8e-18
AXG44409.1|4674053_4675136_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44410.1|4675526_4675955_+|transposase	IS200/IS605 family transposase ISPlu2	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	37.9	2.8e-18
AXG44411.1|4676326_4677376_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44412.1|4677436_4678540_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	21.2	5.0e-19
AXG44413.1|4679266_4679668_+	hypothetical protein	NA	NA	NA	NA	NA
AXG44414.1|4679748_4682880_-	toxin	NA	NA	NA	NA	NA
AXG44415.1|4683013_4687708_-	insecticidal toxin complex protein TccB	NA	NA	NA	NA	NA
AXG44416.1|4687802_4690703_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44417.1|4691130_4691598_-	pyocin immunity protein	NA	NA	NA	NA	NA
AXG44418.1|4691706_4692174_-	pyocin immunity protein	NA	NA	NA	NA	NA
AXG44419.1|4692265_4692733_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44420.1|4692842_4693304_-	pyocin immunity protein	NA	NA	NA	NA	NA
AXG44421.1|4693411_4693879_-	pyocin immunity protein	NA	NA	NA	NA	NA
AXG44422.1|4693987_4694455_-	pyocin immunity protein	NA	NA	NA	NA	NA
AXG44423.1|4694563_4695022_-	pyocin immunity protein	NA	NA	NA	NA	NA
AXG44424.1|4695018_4696680_-	killer protein of pyocin s3	NA	A4PE23	Ralstonia_virus	48.1	3.6e-05
AXG44425.1|4697080_4698004_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXG44426.1|4698000_4699272_-	AMP-dependent synthetase	NA	NA	NA	NA	NA
AXG44427.1|4699301_4701707_-	long-chain-fatty-acyl-CoA reductase	NA	NA	NA	NA	NA
AXG44428.1|4701708_4702839_-	acyl-protein synthase	NA	NA	NA	NA	NA
AXG44429.1|4707550_4707802_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44430.1|4707765_4708866_-	cytochrome P450	NA	NA	NA	NA	NA
AXG44431.1|4709897_4710242_+	hypothetical protein	NA	NA	NA	NA	NA
AXG44432.1|4710885_4711602_-	HTH domain-containing protein	NA	NA	NA	NA	NA
AXG44433.1|4712539_4713694_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXG44434.1|4713713_4715156_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44435.1|4715155_4716703_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.4	4.4e-13
AXG44436.1|4716726_4716975_-	acyl carrier protein	NA	NA	NA	NA	NA
AXG44437.1|4717009_4718125_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44438.1|4718117_4719404_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
AXG44439.1|4720055_4720871_-	cyclase	NA	NA	NA	NA	NA
AXG44440.1|4720863_4721577_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44441.1|4721579_4722356_-	ketoacyl reductase	NA	NA	NA	NA	NA
AXG44442.1|4723329_4723650_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXG44443.1|4723737_4724151_-	hypothetical protein	NA	NA	NA	NA	NA
AXG45329.1|4724670_4725048_-	hypothetical protein	NA	A0A0P0ZG22	Escherichia_phage	81.1	2.6e-20
AXG44444.1|4725350_4726730_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44445.1|4726781_4727216_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXG44446.1|4727219_4727756_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AXG44447.1|4727736_4728813_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXG44448.1|4728776_4730543_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 22
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	4862719	4918046	5536539	protease,transposase,tail,tRNA	Lactobacillus_prophage(13.33%)	45	NA	NA
AXG44553.1|4862719_4863745_+|transposase	IS630 family transposase ISPlu19	transposase	NA	NA	NA	NA
AXG44554.1|4864103_4865087_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	51.3	3.3e-38
AXG44555.1|4866182_4867337_+	anticodon nuclease	NA	NA	NA	NA	NA
AXG44556.1|4867362_4870479_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AXG45336.1|4871673_4872513_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
AXG44557.1|4872616_4873045_-|transposase	IS200/IS605 family transposase ISPlu2	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	37.9	2.8e-18
AXG44558.1|4873115_4875203_+	helicase	NA	NA	NA	NA	NA
AXG44559.1|4875733_4876273_-	AAA family ATPase	NA	NA	NA	NA	NA
AXG44560.1|4876726_4877599_-	HNH endonuclease	NA	NA	NA	NA	NA
AXG44561.1|4878216_4879326_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.6	1.6e-33
AXG44562.1|4879448_4880297_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AXG44563.1|4881208_4881538_+	hypothetical protein	NA	NA	NA	NA	NA
AXG44564.1|4881801_4883370_+	hypothetical protein	NA	NA	NA	NA	NA
AXG44565.1|4883604_4884507_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.9	1.0e-09
AXG45337.1|4884529_4885561_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AXG44566.1|4885674_4886850_+	lycopene cyclase	NA	NA	NA	NA	NA
AXG44567.1|4886842_4888324_+	phytoene desaturase	NA	NA	NA	NA	NA
AXG44568.1|4888320_4889247_+	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
AXG44569.1|4890010_4892737_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44570.1|4892760_4893177_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44571.1|4893177_4893738_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44572.1|4893727_4895053_-|protease	serine protease	protease	NA	NA	NA	NA
AXG44573.1|4895042_4896125_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44574.1|4897038_4897575_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	8.9e-54
AXG44575.1|4897933_4900768_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.3	5.2e-312
AXG44576.1|4900828_4901767_-	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
AXG44577.1|4901769_4902855_-	kinase	NA	NA	NA	NA	NA
AXG45338.1|4903543_4903720_+	mRNA interferase HicA	NA	A0A0M3LQ86	Mannheimia_phage	50.0	1.3e-09
AXG44578.1|4903771_4904179_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	78.4	1.2e-50
AXG44579.1|4904250_4904505_-	cloacin	NA	NA	NA	NA	NA
AXG44580.1|4904553_4905567_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXG44581.1|4905959_4907159_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AXG44582.1|4907208_4908288_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.5	1.3e-27
AXG44583.1|4908327_4909737_-	replicative DNA helicase DnaB	NA	A0A1B0VG30	Salmonella_phage	76.8	2.7e-195
AXG44584.1|4909907_4910891_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AXG44585.1|4911101_4911479_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	54.4	1.6e-30
AXG44586.1|4911456_4912053_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	44.3	1.2e-38
AXG44587.1|4912095_4913121_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXG44588.1|4913170_4913617_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44589.1|4914197_4915235_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AXG44590.1|4915651_4915936_-	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	57.6	3.9e-24
AXG45339.1|4915932_4916088_-	hypothetical protein	NA	A0A2I6TCA4	Escherichia_phage	71.7	2.9e-10
AXG44591.1|4916376_4916673_-	transcriptional regulator	NA	NA	NA	NA	NA
AXG44592.1|4916875_4917454_-	bleomycin resistance protein	NA	NA	NA	NA	NA
AXG44593.1|4917620_4918046_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	48.6	6.2e-26
>prophage 23
CP024900	Photorhabdus laumondii subsp. laumondii strain DJC chromosome, complete genome	5536539	5345876	5443072	5536539	portal,plate,capsid,tail,head,integrase,transposase,holin	Salmonella_phage(38.78%)	108	5379752:5379790	5416649:5416687
AXG44939.1|5345876_5346761_+|transposase	IS982 family transposase ISPlu6	transposase	NA	NA	NA	NA
AXG44940.1|5348065_5348950_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AXG44941.1|5349294_5351730_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
AXG44942.1|5351732_5352893_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AXG44943.1|5353180_5353498_+	met repressor	NA	NA	NA	NA	NA
AXG44944.1|5353625_5353841_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
AXG44945.1|5354050_5356249_+	primosomal protein N'	NA	NA	NA	NA	NA
AXG44946.1|5356575_5357604_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
AXG44947.1|5357673_5358501_+	cell division protein FtsN	NA	NA	NA	NA	NA
AXG44948.1|5358624_5359155_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AXG44949.1|5359166_5360498_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	28.8	1.3e-40
AXG44950.1|5360593_5361511_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AXG44951.1|5361660_5362170_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AXG44952.1|5362230_5362473_-	cell division protein ZapB	NA	NA	NA	NA	NA
AXG44953.1|5362778_5363609_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.3	1.3e-16
AXG44954.1|5363639_5365163_+	glycerol kinase	NA	NA	NA	NA	NA
AXG44955.1|5365571_5366318_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AXG44956.1|5366320_5366755_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AXG44957.1|5366816_5367425_+	DUF1454 domain-containing protein	NA	NA	NA	NA	NA
AXG44958.1|5367559_5368327_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
AXG44959.1|5368379_5369375_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXG44960.1|5369546_5370518_-	6-phosphofructokinase	NA	NA	NA	NA	NA
AXG44961.1|5370899_5371847_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AXG44962.1|5371840_5372482_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AXG44963.1|5372474_5373149_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
AXG44964.1|5373638_5373989_+	hypothetical protein	NA	NA	NA	NA	NA
AXG45357.1|5373997_5374291_+	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	44.4	8.9e-08
AXG44965.1|5374343_5374562_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AXG44966.1|5374554_5374839_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXG45358.1|5375311_5375710_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	82.4	4.7e-52
AXG44967.1|5375980_5376307_+	cytoplasmic protein	NA	NA	NA	NA	NA
AXG44968.1|5376303_5376642_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	38.7	1.6e-05
AXG44969.1|5377167_5377410_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AXG44970.1|5377402_5377705_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXG44971.1|5378769_5379084_+	addiction module antidote protein, HigA family	NA	NA	NA	NA	NA
AXG44972.1|5379108_5379297_+	C protein	NA	NA	NA	NA	NA
5379752:5379790	attL	CAATCATAAGCAACCGTAGCACTCAAAAGTGTCCACACT	NA	NA	NA	NA
AXG44973.1|5380238_5380586_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AXG44974.1|5380578_5380755_-	toxin HicA	NA	NA	NA	NA	NA
AXG44975.1|5380767_5381202_+|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	75.6	1.8e-44
AXG44976.1|5381914_5382355_+	hypothetical protein	NA	NA	NA	NA	NA
AXG44977.1|5382492_5382738_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44978.1|5382819_5383545_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44979.1|5384213_5384489_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXG44980.1|5384568_5384784_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	66.1	2.9e-16
AXG44981.1|5385194_5385470_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXG44982.1|5385614_5385833_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	66.7	3.6e-22
AXG45359.1|5385887_5386979_-	late control protein D	NA	E5G6Q3	Salmonella_phage	55.0	3.8e-104
AXG44983.1|5386993_5387458_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	64.4	2.6e-46
AXG44984.1|5387454_5390097_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	36.4	3.7e-129
AXG44985.1|5390089_5390209_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	61.5	8.0e-08
AXG44986.1|5390223_5390541_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	56.5	1.6e-18
AXG44987.1|5390586_5391102_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	66.7	9.4e-61
AXG44988.1|5391112_5392285_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	76.5	1.9e-170
AXG44989.1|5392598_5393045_-|tail	phage tail protein	tail	A0A0A0YSY3	Erwinia_phage	38.1	9.7e-14
AXG44990.1|5393045_5394569_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	62.3	7.8e-71
AXG44991.1|5394565_5395174_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	65.3	1.1e-73
AXG44992.1|5395166_5396075_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	68.2	1.0e-110
AXG44993.1|5396077_5396419_-|plate	baseplate assembly protein	plate	O80315	Escherichia_phage	67.4	2.5e-30
AXG44994.1|5396415_5397054_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	62.6	8.3e-67
AXG44995.1|5397091_5397757_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	40.0	2.8e-33
AXG44996.1|5397758_5398175_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	45.7	1.5e-29
AXG44997.1|5398167_5398428_-	peptidase	NA	B6SCZ0	Bacteriophage	55.8	3.0e-15
AXG44998.1|5398315_5398696_-	hypothetical protein	NA	NA	NA	NA	NA
AXG44999.1|5398692_5399088_-	structural protein	NA	A0A0A0RQM4	Escherichia_phage	51.8	3.7e-33
AXG45000.1|5399080_5399404_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	59.4	2.4e-30
AXG45001.1|5399407_5399611_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	65.7	1.1e-20
AXG45002.1|5399610_5400075_-|head	head protein	head	E5E3S2	Burkholderia_phage	46.2	2.0e-30
AXG45003.1|5400157_5400823_-	hypothetical protein	NA	A0A218M4L0	Erwinia_phage	49.1	2.2e-46
AXG45004.1|5400822_5401926_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	69.3	1.9e-135
AXG45005.1|5401938_5402775_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	55.5	8.4e-59
AXG45006.1|5402917_5404675_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	77.9	4.2e-278
AXG45007.1|5404674_5405709_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	70.6	3.7e-141
AXG45008.1|5406038_5406626_-	hypothetical protein	NA	NA	NA	NA	NA
AXG45009.1|5407310_5408315_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXG45010.1|5408576_5409182_+	hypothetical protein	NA	NA	NA	NA	NA
AXG45011.1|5409269_5410049_+	hypothetical protein	NA	NA	NA	NA	NA
AXG45012.1|5410681_5412814_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	57.2	6.6e-209
AXG45013.1|5412810_5413629_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	47.0	1.7e-59
AXG45014.1|5413630_5413852_-	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	46.6	1.4e-10
AXG45015.1|5413844_5414039_-	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
AXG45016.1|5414112_5414472_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	35.2	6.9e-10
AXG45017.1|5414594_5414822_-	hypothetical protein	NA	NA	NA	NA	NA
AXG45018.1|5414832_5415123_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	63.5	2.6e-31
AXG45019.1|5415319_5415613_+	XRE family transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	60.8	4.5e-28
AXG45020.1|5415679_5416648_+|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	65.3	6.6e-116
AXG45021.1|5416890_5417385_-	hypothetical protein	NA	NA	NA	NA	NA
5416649:5416687	attR	CAATCATAAGCAACCGTAGCACTCAAAAGTGTCCACACT	NA	NA	NA	NA
AXG45022.1|5417542_5418238_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	1.5e-05
AXG45023.1|5418234_5419605_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.5	1.8e-18
AXG45024.1|5420006_5421317_+	nucleotide sugar dehydrogenase	NA	M1HKZ1	Paramecium_bursaria_Chlorella_virus	30.5	2.1e-40
AXG45025.1|5421331_5422381_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AXG45026.1|5422399_5422987_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXG45027.1|5423001_5424072_+	aminotransferase DegT	NA	A0A2K9L0G1	Tupanvirus	30.1	2.8e-35
AXG45028.1|5424077_5425295_+	hypothetical protein	NA	NA	NA	NA	NA
AXG45029.1|5425302_5426409_+	hypothetical protein	NA	NA	NA	NA	NA
AXG45030.1|5426398_5427628_+	hypothetical protein	NA	NA	NA	NA	NA
AXG45031.1|5427624_5428728_+	glycosyl transferase	NA	NA	NA	NA	NA
AXG45032.1|5428733_5429804_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	37.2	1.2e-54
AXG45033.1|5429800_5431039_+	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AXG45034.1|5431208_5432219_+	hypothetical protein	NA	NA	NA	NA	NA
AXG45035.1|5432229_5433387_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	30.8	4.1e-40
AXG45036.1|5433387_5433999_+	glycosyl transferase	NA	NA	NA	NA	NA
AXG45037.1|5434008_5435883_+	polysaccharide biosynthesis protein	NA	L7Y3T9	Megavirus	33.7	7.2e-26
AXG45038.1|5436292_5437252_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AXG45039.1|5438027_5438900_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	2.1e-108
AXG45040.1|5438896_5439304_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
AXG45041.1|5439364_5440483_+	aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	31.7	1.2e-44
AXG45042.1|5440479_5441733_+	O-antigen translocase	NA	NA	NA	NA	NA
AXG45043.1|5442046_5443072_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
