The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031194	Streptomyces sp. GSSD-12 chromosome, complete genome	8454852	578042	589314	8454852	plate,tail	Bacillus_phage(50.0%)	10	NA	NA
AXG76722.1|578042_579632_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	33.8	1.5e-69
AXG76723.1|579714_580158_+|tail	phage tail protein	tail	NA	NA	NA	NA
AXG76724.1|580157_580667_+	hypothetical protein	NA	NA	NA	NA	NA
AXG76725.1|581951_582260_-	hypothetical protein	NA	NA	NA	NA	NA
AXG76726.1|582680_583118_+|tail	phage tail protein	tail	NA	NA	NA	NA
AXG76727.1|584071_585988_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AXG76728.1|586062_586344_+	PaaR repeat-containing protein	NA	NA	NA	NA	NA
AXG76729.1|586353_586764_+|plate	baseplate protein	plate	A0A1D8KJJ7	Synechococcus_phage	32.5	2.7e-10
AXG76730.1|586760_588713_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
AXG76731.1|588717_589314_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 2
CP031194	Streptomyces sp. GSSD-12 chromosome, complete genome	8454852	1706325	1719313	8454852	plate,tail	Synechococcus_phage(50.0%)	11	NA	NA
AXG77558.1|1706325_1707084_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXG77559.1|1707080_1709039_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
AXG77560.1|1709038_1709482_-|plate	baseplate protein	plate	A0A0E3F3H3	Synechococcus_phage	35.8	1.4e-12
AXG77561.1|1709481_1711380_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AXG77562.1|1711379_1712102_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AXG77563.1|1712105_1712543_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXG77564.1|1712660_1713110_-	extensin	NA	NA	NA	NA	NA
AXG77565.1|1713396_1714509_+	hypothetical protein	NA	NA	NA	NA	NA
AXG77566.1|1716642_1717125_-	hypothetical protein	NA	NA	NA	NA	NA
AXG77567.1|1717124_1717568_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXG77568.1|1717690_1719313_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	33.1	4.7e-66
>prophage 3
CP031194	Streptomyces sp. GSSD-12 chromosome, complete genome	8454852	3097009	3144240	8454852	integrase,transposase	Mycobacterium_phage(28.57%)	41	3082117:3082136	3146542:3146561
3082117:3082136	attL	TGGTGCCGACCACGACGATC	NA	NA	NA	NA
AXG78578.1|3097009_3097549_+|transposase	transposase	transposase	NA	NA	NA	NA
AXG78579.1|3097473_3098094_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXG78580.1|3102249_3103512_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AXG78581.1|3103508_3104657_+	hypothetical protein	NA	NA	NA	NA	NA
AXG78582.1|3104653_3106003_+	hypothetical protein	NA	NA	NA	NA	NA
AXG82570.1|3106413_3107112_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXG78583.1|3107241_3107427_+	DUF1737 domain-containing protein	NA	NA	NA	NA	NA
AXG78584.1|3107884_3108505_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXG78585.1|3108429_3108969_-|transposase	transposase	transposase	NA	NA	NA	NA
AXG78586.1|3110258_3110924_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AXG78587.1|3110920_3111145_-	hypothetical protein	NA	NA	NA	NA	NA
AXG78588.1|3111247_3112294_-	DUF2637 domain-containing protein	NA	NA	NA	NA	NA
AXG78589.1|3112290_3112857_-	WhiB family transcriptional regulator	NA	A0A076G8B1	Mycobacterium_phage	35.0	4.7e-05
AXG78590.1|3112973_3113681_-	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	33.8	3.8e-12
AXG78591.1|3113680_3114700_-	hypothetical protein	NA	I6RTT8	Marinomonas_phage	37.4	4.2e-12
AXG78592.1|3114701_3115028_-	transcriptional regulator	NA	NA	NA	NA	NA
AXG78593.1|3115592_3116468_+	transcriptional regulator	NA	NA	NA	NA	NA
AXG82571.1|3117420_3118272_+	DUF3626 domain-containing protein	NA	NA	NA	NA	NA
AXG78594.1|3118332_3119213_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	39.1	1.9e-16
AXG78595.1|3119479_3119692_+	hypothetical protein	NA	NA	NA	NA	NA
AXG78596.1|3119726_3120329_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXG78597.1|3120451_3120859_+	hypothetical protein	NA	NA	NA	NA	NA
AXG78598.1|3120851_3121124_+	hypothetical protein	NA	NA	NA	NA	NA
AXG78599.1|3123623_3124253_-	HAD family phosphatase	NA	NA	NA	NA	NA
AXG82572.1|3125887_3127204_-	hypothetical protein	NA	NA	NA	NA	NA
AXG78600.1|3129058_3129436_-	hypothetical protein	NA	NA	NA	NA	NA
AXG82573.1|3130184_3130424_-	hypothetical protein	NA	NA	NA	NA	NA
AXG78601.1|3131855_3132050_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
AXG78602.1|3132203_3133013_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXG78603.1|3133022_3134408_-	hypothetical protein	NA	A0A1V0E643	Streptomyces_phage	33.6	1.3e-53
AXG78604.1|3134618_3136139_+	radical SAM protein	NA	NA	NA	NA	NA
AXG78605.1|3136122_3136833_+	hypothetical protein	NA	NA	NA	NA	NA
AXG78606.1|3136829_3137654_+	hypothetical protein	NA	NA	NA	NA	NA
AXG82574.1|3137670_3138489_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
AXG78607.1|3138513_3139467_+	hypothetical protein	NA	NA	NA	NA	NA
AXG78608.1|3139463_3139964_+	hypothetical protein	NA	A0A2R4A195	Microbacterium_phage	37.8	1.4e-08
AXG78609.1|3140046_3140352_+	hypothetical protein	NA	NA	NA	NA	NA
AXG82575.1|3140549_3141008_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
AXG78610.1|3141591_3141879_-	hypothetical protein	NA	NA	NA	NA	NA
AXG78611.1|3141970_3142630_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXG78612.1|3142626_3144240_+|integrase	site-specific integrase	integrase	G8I4Q2	Mycobacterium_phage	23.9	1.7e-20
3146542:3146561	attR	TGGTGCCGACCACGACGATC	NA	NA	NA	NA
>prophage 4
CP031194	Streptomyces sp. GSSD-12 chromosome, complete genome	8454852	6647592	6678479	8454852	capsid	Streptomyces_phage(61.9%)	38	NA	NA
AXG81121.1|6647592_6648477_+	PD-(D/E)XK nuclease family protein	NA	A0A0F6WDT5	Mycobacterium_phage	28.9	9.6e-21
AXG81122.1|6648740_6648950_+	DNA-binding protein	NA	NA	NA	NA	NA
AXG81123.1|6648950_6650105_+	DNA cytosine methyltransferase	NA	Q858Z2	Streptomyces_virus	60.2	4.1e-48
AXG81124.1|6650101_6650800_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81125.1|6650871_6651090_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81126.1|6651090_6651918_+	hypothetical protein	NA	A0A1B0XUA2	Freshwater_phage	43.1	3.5e-41
AXG81127.1|6651917_6652181_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81128.1|6652173_6652368_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81129.1|6652367_6652730_+	DUF2493 domain-containing protein	NA	A0A286MPZ5	Mycobacterium_phage	46.6	2.4e-18
AXG81130.1|6652726_6653014_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81131.1|6653010_6653421_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81132.1|6653360_6653798_+	hypothetical protein	NA	A0A1B0XTT9	Freshwater_phage	35.8	4.6e-08
AXG81133.1|6653628_6654255_+	topoisomerase	NA	A0A2H4PIC1	Streptomyces_phage	44.2	3.5e-41
AXG81134.1|6654325_6654688_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81135.1|6654687_6654846_+	RecBCD nuclease inhibitor	NA	NA	NA	NA	NA
AXG81136.1|6654845_6655160_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81137.1|6655156_6655363_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81138.1|6655538_6655832_-	hypothetical protein	NA	NA	NA	NA	NA
AXG81139.1|6655828_6656065_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
AXG81140.1|6656061_6656343_-	hypothetical protein	NA	A0A1P8DUC6	Mycobacterium_phage	53.4	1.9e-15
AXG81141.1|6656351_6658265_-	hypothetical protein	NA	A0A2H5BMQ8	Streptomyces_phage	44.8	5.8e-148
AXG82985.1|6658274_6658583_-	hypothetical protein	NA	NA	NA	NA	NA
AXG81142.1|6659265_6660171_-	hypothetical protein	NA	A0A2H4PI52	Streptomyces_phage	47.1	1.3e-70
AXG81143.1|6660170_6660455_-	hypothetical protein	NA	A0A1B0XUE1	Freshwater_phage	47.7	4.3e-15
AXG81144.1|6660594_6662415_-	hypothetical protein	NA	A0A1J0GW76	Streptomyces_phage	49.6	8.3e-144
AXG81145.1|6662417_6662633_-	hypothetical protein	NA	A0A2H4PR05	Streptomyces_phage	49.0	1.4e-05
AXG81146.1|6662715_6663285_+	hypothetical protein	NA	A0A088FA48	Yersinia_phage	44.4	2.7e-24
AXG81147.1|6663271_6664246_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2H4PQY8	Streptomyces_phage	60.2	7.1e-102
AXG81148.1|6664290_6664824_-	hypothetical protein	NA	NA	NA	NA	NA
AXG81149.1|6665146_6666346_-	hypothetical protein	NA	A0A2H5BMJ9	Streptomyces_phage	54.0	5.9e-74
AXG81150.1|6666350_6667673_-	hypothetical protein	NA	A0A2H4PQY1	Streptomyces_phage	48.3	1.8e-108
AXG81151.1|6667672_6668968_-	NlpC/P60 family protein	NA	A0A2H4PI41	Streptomyces_phage	42.7	1.1e-97
AXG81152.1|6668967_6669858_-	hypothetical protein	NA	NA	NA	NA	NA
AXG81153.1|6669854_6674804_-	hypothetical protein	NA	A0A2H4PQW9	Streptomyces_phage	28.4	1.3e-162
AXG81154.1|6674977_6675430_-	hypothetical protein	NA	A0A2H5BM46	Streptomyces_phage	44.9	1.7e-18
AXG81155.1|6675477_6675705_-	hypothetical protein	NA	NA	NA	NA	NA
AXG81156.1|6675919_6677713_-	hypothetical protein	NA	A0A2H4PI37	Streptomyces_phage	52.4	1.1e-164
AXG81157.1|6677774_6678479_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0E3JQE4	Streptomyces_phage	44.8	3.1e-38
>prophage 5
CP031194	Streptomyces sp. GSSD-12 chromosome, complete genome	8454852	7723456	7859869	8454852	plate,tail,transposase	Paenibacillus_phage(30.0%)	51	NA	NA
AXG81873.1|7723456_7724911_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	32.2	1.2e-36
AXG81874.1|7724907_7725483_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	38.5	4.2e-25
AXG81875.1|7726090_7726971_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	39.6	4.1e-16
AXG81876.1|7727111_7727672_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXG81877.1|7728280_7728673_-	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXG81878.1|7728722_7730021_+	MFS transporter	NA	NA	NA	NA	NA
AXG83080.1|7730143_7730467_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81879.1|7730640_7731162_-	hypothetical protein	NA	NA	NA	NA	NA
AXG81880.1|7731413_7731821_-	hypothetical protein	NA	NA	NA	NA	NA
AXG81881.1|7735476_7737279_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	34.6	1.0e-40
AXG81882.1|7737289_7737811_+|tail	phage tail protein	tail	NA	NA	NA	NA
AXG81883.1|7737821_7738550_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81884.1|7738542_7739253_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81885.1|7739225_7740437_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
AXG81886.1|7740436_7742395_+	ATP-binding protein	NA	A0A109WUE1	Acidianus_tailed_spindle_virus	30.8	2.9e-09
AXG81887.1|7742385_7742634_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81888.1|7742630_7748858_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
AXG81889.1|7748961_7749465_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
AXG81890.1|7749461_7750103_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81891.1|7750165_7750498_+	LysM domain-containing protein	NA	NA	NA	NA	NA
AXG81892.1|7750581_7751709_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81893.1|7751718_7752231_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
AXG81894.1|7752233_7752563_+	hypothetical protein	NA	NA	NA	NA	NA
AXG83081.1|7752656_7752938_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81895.1|7752934_7755982_+|plate	putative baseplate assembly protein	plate	A0A1J0GW37	Streptomyces_phage	26.1	9.3e-15
AXG81896.1|7755978_7759824_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
AXG81897.1|7759820_7762025_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81898.1|7762057_7763530_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81899.1|7764382_7766029_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AXG81900.1|7766370_7766613_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
AXG81901.1|7766856_7767417_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
AXG81902.1|7767639_7768740_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXG81903.1|7769266_7770481_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXG81904.1|7771296_7772928_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81905.1|7773648_7774092_+	hypothetical protein	NA	NA	NA	NA	NA
AXG81906.1|7775359_7775890_-	ATP-binding protein	NA	NA	NA	NA	NA
AXG81907.1|7775955_7777077_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXG81908.1|7777190_7777517_-	hypothetical protein	NA	NA	NA	NA	NA
AXG81909.1|7777967_7778720_+	PAS domain S-box protein	NA	NA	NA	NA	NA
AXG81910.1|7778904_7779627_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AXG81911.1|7781542_7782694_+	cytochrome P450	NA	NA	NA	NA	NA
AXG81912.1|7782714_7784598_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.6e-41
AXG81913.1|7784594_7786331_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.2	1.5e-33
AXG81914.1|7786527_7814217_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.1	4.5e-31
AXG81915.1|7814232_7819602_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXG81916.1|7819639_7825612_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXG81917.1|7826006_7827065_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
AXG83082.1|7827097_7828474_-	glycosyltransferase	NA	NA	NA	NA	NA
AXG81918.1|7828742_7837850_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXG81919.1|7837901_7857218_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	31.8	1.9e-28
AXG81920.1|7859048_7859869_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
