The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031231	Escherichia coli strain Es_ST410_NW1_NDM_09_2017 chromosome, complete genome	4800614	773420	779982	4800614	transposase	Rhizobium_phage(16.67%)	7	NA	NA
AXH84357.1|773420_774245_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
AXH84358.1|774293_774866_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
AXH84359.1|774966_775317_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
AXH84360.1|775236_776391_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
AXH84361.1|777286_777700_+	hypothetical protein	NA	NA	NA	NA	NA
AXH84362.1|778257_779025_-	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AXH84363.1|779025_779982_-	iron-dicitrate ABC transporter permease FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 2
CP031231	Escherichia coli strain Es_ST410_NW1_NDM_09_2017 chromosome, complete genome	4800614	868288	884544	4800614	tail,integrase	Enterobacteria_phage(61.54%)	15	862443:862455	873158:873170
862443:862455	attL	AGAGCGTATCAGC	NA	NA	NA	NA
AXH84450.1|868288_869512_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.3	1.8e-235
AXH84451.1|869620_872263_+	hypothetical protein	NA	A0A1S6KZY3	Salmonella_phage	41.1	1.7e-20
AXH84452.1|872396_872591_-	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	95.3	4.9e-31
AXH84453.1|872590_873211_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	89.8	9.1e-111
873158:873170	attR	GCTGATACGCTCT	NA	NA	NA	NA
AXH84454.1|873210_873573_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.4	1.7e-64
AXH84455.1|873563_874100_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	98.9	4.8e-100
AXH84456.1|874227_875052_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AXH87991.1|875117_875480_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AXH84457.1|876111_876855_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	4.7e-146
AXH84458.1|876752_877394_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.0	8.6e-96
AXH87992.1|877607_877970_+	Ail/Lom-like protein	NA	Q687E7	Enterobacteria_phage	100.0	8.3e-64
AXH84459.1|878034_881736_+	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	85.5	0.0e+00
AXH84460.1|882173_883544_-	reverse transcriptase	NA	NA	NA	NA	NA
AXH84461.1|883521_884073_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
AXH84462.1|884295_884544_-	damage-inducible protein DinI	NA	K7PLW4	Enterobacteria_phage	98.8	5.4e-38
>prophage 3
CP031231	Escherichia coli strain Es_ST410_NW1_NDM_09_2017 chromosome, complete genome	4800614	1670860	1689429	4800614	tail,lysis,integrase,terminase,capsid	Enterobacteria_phage(46.15%)	39	1664095:1664109	1686737:1686751
1664095:1664109	attL	AAATTAATGAAAAAA	NA	NA	NA	NA
AXH85151.1|1670860_1671931_-|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
AXH85152.1|1671908_1672127_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AXH85153.1|1672166_1672334_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
AXH88014.1|1672266_1672452_+	hypothetical protein	NA	NA	NA	NA	NA
AXH85154.1|1672682_1673180_+	hypothetical protein	NA	NA	NA	NA	NA
AXH85155.1|1673390_1673612_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
AXH85156.1|1673710_1673992_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
AXH85157.1|1674002_1674194_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
AXH85158.1|1674166_1674349_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
AXH85159.1|1674329_1675031_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.5	1.8e-115
AXH88015.1|1674939_1675227_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	97.1	1.5e-28
AXH85160.1|1675263_1675455_-	hypothetical protein	NA	NA	NA	NA	NA
AXH85161.1|1675711_1676272_+	UDP-N-acetylglucosamine acyltransferase	NA	NA	NA	NA	NA
AXH85162.1|1676268_1676721_+	hypothetical protein	NA	NA	NA	NA	NA
AXH85163.1|1676813_1676915_+	hypothetical protein	NA	NA	NA	NA	NA
AXH85164.1|1676911_1677367_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
AXH85165.1|1677366_1677537_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AXH85166.1|1677529_1677820_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
AXH85167.1|1677816_1678179_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
AXH85168.1|1678175_1678316_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
AXH85169.1|1678401_1678779_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
AXH85170.1|1678934_1679459_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
AXH85171.1|1679651_1680611_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AXH85172.1|1680962_1681097_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXH85173.1|1681105_1681693_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXH85174.1|1681880_1682096_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
AXH85175.1|1682095_1682593_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
AXH85176.1|1682589_1683057_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
AXH85177.1|1683044_1683197_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
AXH85178.1|1683338_1683503_-	hypothetical protein	NA	NA	NA	NA	NA
AXH85179.1|1683548_1683959_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AXH85180.1|1684015_1684249_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
AXH85181.1|1684354_1684498_+	DNA-packaging protein	NA	NA	NA	NA	NA
AXH85182.1|1684637_1685198_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
AXH85183.1|1686006_1686144_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AXH88016.1|1686088_1686715_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXH85184.1|1686906_1687083_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
1686737:1686751	attR	TTTTTTCATTAATTT	NA	NA	NA	NA
AXH85185.1|1687156_1688488_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
AXH85186.1|1689246_1689429_-	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	90.6	2.5e-08
>prophage 4
CP031231	Escherichia coli strain Es_ST410_NW1_NDM_09_2017 chromosome, complete genome	4800614	1771423	1843404	4800614	tail,portal,lysis,integrase,capsid,plate,head,protease,tRNA	Salmonella_phage(67.35%)	78	1762351:1762365	1793196:1793210
1762351:1762365	attL	CCTGCTGGACGTGGT	NA	NA	NA	NA
AXH85251.1|1771423_1772476_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AXH85252.1|1772559_1774236_-	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	67.0	9.8e-83
AXH85253.1|1774256_1774853_-	hypothetical protein	NA	A0A1S6KZZ7	Salmonella_phage	42.4	3.6e-40
AXH85254.1|1774948_1775170_+	regulator	NA	NA	NA	NA	NA
AXH85255.1|1775202_1775712_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
AXH85256.1|1775719_1776016_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	86.5	5.4e-21
AXH85257.1|1776133_1776475_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AXH85258.1|1776542_1776776_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	97.4	1.4e-32
AXH85259.1|1776775_1777003_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AXH85260.1|1777854_1780269_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
AXH85261.1|1780422_1780611_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AXH85262.1|1780549_1780855_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
AXH85263.1|1781181_1782000_+	hypothetical protein	NA	NA	NA	NA	NA
AXH85264.1|1782001_1782748_+	hypothetical protein	NA	S5W9H2	Leptospira_phage	39.1	3.6e-05
AXH85265.1|1782799_1783831_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.2	3.8e-170
AXH85266.1|1783830_1785597_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AXH85267.1|1785739_1786573_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	8.2e-123
AXH85268.1|1786589_1787648_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
AXH85269.1|1787651_1788302_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AXH85270.1|1788396_1788861_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
AXH85271.1|1788860_1789064_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AXH85272.1|1789067_1789283_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AXH85273.1|1789263_1789779_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.4	1.6e-89
AXH85274.1|1789775_1790204_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	90.1	2.8e-58
AXH85275.1|1790133_1790337_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	73.1	2.0e-22
AXH85276.1|1790299_1790731_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	5.4e-70
AXH85277.1|1790723_1791173_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.9	1.6e-61
AXH85278.1|1791197_1791635_-	hypothetical protein	NA	NA	NA	NA	NA
AXH85279.1|1791723_1792302_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	7.2e-94
AXH85280.1|1792298_1792658_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	5.5e-52
AXH85281.1|1792644_1793553_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	5.4e-144
1793196:1793210	attR	CCTGCTGGACGTGGT	NA	NA	NA	NA
AXH85282.1|1793545_1794151_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.2e-109
AXH85283.1|1796226_1796640_+|tail	phage tail protein	tail	U5P0S4	Shigella_phage	74.3	5.3e-22
AXH85284.1|1796746_1797919_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	6.0e-204
AXH85285.1|1797928_1798444_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
AXH85286.1|1798498_1798801_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AXH85287.1|1798815_1798935_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AXH85288.1|1798927_1802005_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	68.9	0.0e+00
AXH85289.1|1802001_1802487_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	1.8e-66
AXH85290.1|1802483_1803584_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
AXH85291.1|1803674_1803893_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AXH85292.1|1804128_1805814_-	transporter	NA	NA	NA	NA	NA
AXH85293.1|1806083_1806461_+	hypothetical protein	NA	NA	NA	NA	NA
AXH85294.1|1806490_1806748_-	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
AXH85295.1|1806907_1807195_+	DUF1418 family protein	NA	NA	NA	NA	NA
AXH85296.1|1807178_1807901_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AXH85297.1|1807961_1808864_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AXH85298.1|1808951_1809428_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AXH85299.1|1809778_1810891_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AXH85300.1|1810985_1812119_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
AXH85301.1|1812128_1813082_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AXH85302.1|1813078_1813924_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AXH85303.1|1813983_1814472_+	DUF2593 family protein	NA	NA	NA	NA	NA
AXH85304.1|1814512_1815640_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
AXH85305.1|1815814_1816546_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXH85306.1|1816837_1817506_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AXH85307.1|1818226_1818958_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXH85308.1|1818975_1819704_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
AXH85309.1|1819921_1820437_-	lipoprotein	NA	NA	NA	NA	NA
AXH85310.1|1820562_1820886_+	hypothetical protein	NA	NA	NA	NA	NA
AXH85311.1|1820882_1821713_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AXH88021.1|1821709_1822723_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXH85312.1|1822821_1824252_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXH85313.1|1824262_1825264_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AXH85314.1|1825300_1827019_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
AXH85315.1|1827151_1828120_-	NADH oxidoreductase	NA	NA	NA	NA	NA
AXH85316.1|1828131_1829784_-	hydroxylamine reductase	NA	NA	NA	NA	NA
AXH85317.1|1829927_1830827_-	transporter	NA	NA	NA	NA	NA
AXH85318.1|1831321_1832017_-	aquaporin	NA	NA	NA	NA	NA
AXH85319.1|1832444_1834103_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AXH85320.1|1834099_1835092_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AXH85321.1|1835206_1836322_+	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AXH85322.1|1836318_1838265_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AXH85323.1|1838337_1838562_-	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AXH85324.1|1838884_1839205_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AXH85325.1|1839235_1841512_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AXH85326.1|1842196_1842415_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXH85327.1|1842699_1843404_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 5
CP031231	Escherichia coli strain Es_ST410_NW1_NDM_09_2017 chromosome, complete genome	4800614	2110227	2119421	4800614	transposase,integrase	Enterobacteria_phage(37.5%)	9	2111502:2111525	2125746:2125769
AXH85562.1|2110227_2111478_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2111502:2111525	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
AXH88033.1|2111591_2112716_-|integrase	integrase	integrase	O21929	Phage_21	99.7	8.0e-206
AXH85563.1|2113535_2114558_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AXH85564.1|2114681_2114918_-	excisionase	NA	NA	NA	NA	NA
AXH85565.1|2115057_2115297_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
AXH85566.1|2115720_2116782_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	65.0	3.0e-130
AXH88034.1|2117556_2117715_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
AXH85567.1|2118387_2118699_-	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
AXH85568.1|2118881_2119421_+	regulator	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
2125746:2125769	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 6
CP031231	Escherichia coli strain Es_ST410_NW1_NDM_09_2017 chromosome, complete genome	4800614	2527000	2555603	4800614	tail,integrase	Enterobacteria_phage(30.0%)	33	2530747:2530761	2554525:2554539
AXH85915.1|2527000_2527126_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	1.5e-12
AXH85916.1|2527180_2528578_-	chaperone of endosialidase	NA	K7PGT9	Enterobacteria_phage	85.2	1.4e-204
AXH85917.1|2528943_2529339_-	hypothetical protein	NA	A5LH44	Enterobacteria_phage	97.4	6.1e-60
AXH85918.1|2529409_2531572_-	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
2530747:2530761	attL	CAATCCGCGACGGCG	NA	NA	NA	NA
AXH85919.1|2532317_2533139_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
AXH85920.1|2533135_2533510_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
AXH85921.1|2533522_2534572_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
AXH85922.1|2534573_2534852_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
AXH85923.1|2534918_2535170_-	hypothetical protein	NA	NA	NA	NA	NA
AXH85924.1|2535385_2535598_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
AXH85925.1|2535756_2535900_-	hypothetical protein	NA	NA	NA	NA	NA
AXH85926.1|2536269_2537250_-	hypothetical protein	NA	NA	NA	NA	NA
AXH85927.1|2537609_2538212_-|integrase	integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
AXH85928.1|2538529_2539879_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
AXH85929.1|2540426_2541371_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
AXH85930.1|2541500_2541923_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
AXH85931.1|2541963_2542983_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	1.0e-58
AXH85932.1|2542909_2543152_-	hypothetical protein	NA	NA	NA	NA	NA
AXH85933.1|2543235_2543424_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AXH85934.1|2543420_2543612_+	DUF1482 family protein	NA	NA	NA	NA	NA
AXH85935.1|2543705_2546177_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
AXH85936.1|2546249_2546501_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AXH85937.1|2546520_2547816_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	6.7e-156
AXH85938.1|2547835_2547946_-	transporter	NA	NA	NA	NA	NA
AXH85939.1|2548003_2549023_-	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AXH85940.1|2549034_2550249_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AXH85941.1|2550229_2550418_-	hypothetical protein	NA	NA	NA	NA	NA
AXH85942.1|2550454_2550781_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AXH85943.1|2550915_2551257_+	DUF1283 family protein	NA	NA	NA	NA	NA
AXH85944.1|2551291_2551852_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AXH88052.1|2551854_2552565_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AXH85945.1|2552672_2552978_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AXH85946.1|2553176_2555603_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
2554525:2554539	attR	CAATCCGCGACGGCG	NA	NA	NA	NA
>prophage 7
CP031231	Escherichia coli strain Es_ST410_NW1_NDM_09_2017 chromosome, complete genome	4800614	2838388	2860248	4800614	terminase	Klebsiella_phage(22.73%)	30	NA	NA
AXH86213.1|2838388_2840410_-	hypothetical protein	NA	A0A0C5Q3X6	Klebsiella_phage	47.3	6.9e-107
AXH86214.1|2842489_2843890_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	2.1e-187
AXH86215.1|2843840_2844617_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	8.4e-13
AXH86216.1|2844675_2845104_-	hypothetical protein	NA	NA	NA	NA	NA
AXH86217.1|2845273_2845540_-	hypothetical protein	NA	NA	NA	NA	NA
AXH86218.1|2845536_2845845_-	hypothetical protein	NA	Q5QF73	Pseudomonas_virus	55.1	4.2e-16
AXH86219.1|2845942_2846140_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	88.1	6.6e-23
AXH86220.1|2846090_2846366_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	38.2	2.1e-06
AXH86221.1|2846362_2846710_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	71.3	1.2e-35
AXH86222.1|2847112_2847373_-	hypothetical protein	NA	K7PM48	Enterobacteria_phage	88.2	5.3e-20
AXH86223.1|2848083_2848305_-	transcriptional regulator	NA	NA	NA	NA	NA
AXH86224.1|2848344_2848563_-	XRE family transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.4e-13
AXH86225.1|2848671_2849331_+	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	62.4	8.3e-70
AXH88067.1|2849391_2849511_+	hypothetical protein	NA	NA	NA	NA	NA
AXH86226.1|2849772_2850138_+	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	49.1	1.3e-19
AXH86227.1|2850503_2850707_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	68.7	2.5e-17
AXH86228.1|2851143_2851251_+	glutathione S-transferase	NA	NA	NA	NA	NA
AXH86229.1|2852285_2853068_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AXH86230.1|2853161_2853311_+	hypothetical protein	NA	A0A0M4S6W3	Salmonella_phage	95.9	3.9e-20
AXH86231.1|2853392_2853677_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
AXH86232.1|2853692_2854538_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.5e-68
AXH86233.1|2854534_2854696_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	88.6	8.3e-16
AXH86234.1|2855896_2856121_+	hypothetical protein	NA	NA	NA	NA	NA
AXH86235.1|2856117_2856318_+	hypothetical protein	NA	NA	NA	NA	NA
AXH86236.1|2856314_2856533_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	56.6	7.8e-09
AXH86237.1|2856692_2856938_+	excisionase	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
AXH86238.1|2856980_2858240_+	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	90.6	2.7e-226
AXH86239.1|2858236_2859016_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	2.3e-71
AXH86240.1|2859068_2859464_+	hypothetical protein	NA	NA	NA	NA	NA
AXH86241.1|2859504_2860248_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
>prophage 8
CP031231	Escherichia coli strain Es_ST410_NW1_NDM_09_2017 chromosome, complete genome	4800614	3150415	3159857	4800614		Enterobacteria_phage(85.71%)	10	NA	NA
AXH86464.1|3150415_3151552_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
AXH86465.1|3151548_3153549_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
AXH86466.1|3153673_3154135_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AXH86467.1|3154175_3154646_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AXH86468.1|3154692_3155412_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXH86469.1|3155408_3157094_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AXH86470.1|3157315_3158047_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AXH86471.1|3158106_3158214_+	hypothetical protein	NA	NA	NA	NA	NA
AXH86472.1|3158194_3158926_-	ABC transporter permease	NA	NA	NA	NA	NA
AXH86473.1|3158930_3159857_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
>prophage 9
CP031231	Escherichia coli strain Es_ST410_NW1_NDM_09_2017 chromosome, complete genome	4800614	3363516	3418764	4800614	tail,portal,holin,transposase,integrase,terminase,capsid,plate,tRNA	Enterobacteria_phage(77.78%)	67	3371853:3371876	3415322:3415345
AXH86641.1|3363516_3364407_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	44.2	4.0e-67
AXH86642.1|3364603_3365377_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
AXH86643.1|3365384_3366101_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
AXH86644.1|3366097_3366784_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
AXH86645.1|3366873_3367656_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
AXH86646.1|3367876_3368659_-	lysine/arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXH86647.1|3368924_3369494_-	3-octaprenyl-4-hydroxybenzoate carboxy-lyase partner protein	NA	NA	NA	NA	NA
AXH86648.1|3369588_3371106_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
AXH86649.1|3371142_3371631_-	colicin V production protein	NA	NA	NA	NA	NA
3371853:3371876	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
AXH86650.1|3371889_3372552_-	protein DedD	NA	NA	NA	NA	NA
AXH86651.1|3372541_3373810_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AXH86652.1|3373879_3374794_-	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AXH86653.1|3374949_3375609_-	DedA family protein	NA	NA	NA	NA	NA
AXH86654.1|3375691_3376504_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AXH86655.1|3376503_3377517_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXH86656.1|3377582_3378740_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	6.0e-23
AXH86657.1|3378898_3379903_-|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
AXH88082.1|3379999_3380320_-	XRE family transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.1e-14
AXH86658.1|3380433_3380721_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
AXH86659.1|3380727_3380934_+	hypothetical protein	NA	NA	NA	NA	NA
AXH86660.1|3381186_3381528_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
AXH86661.1|3381538_3381826_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
AXH86662.1|3381837_3382080_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AXH86663.1|3382275_3382479_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
AXH86664.1|3382475_3382721_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
AXH86665.1|3382717_3383017_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.8	2.8e-41
AXH86666.1|3383067_3383283_-	hypothetical protein	NA	NA	NA	NA	NA
AXH86667.1|3383339_3383570_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	96.1	2.6e-31
AXH86668.1|3383642_3384008_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
AXH88083.1|3384152_3386837_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.3	0.0e+00
AXH86669.1|3386913_3387873_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	2.4e-179
AXH86670.1|3387877_3388189_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
AXH86671.1|3388553_3388823_+	hypothetical protein	NA	NA	NA	NA	NA
AXH86672.1|3389310_3390357_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.6e-206
AXH86673.1|3390356_3392108_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.6	0.0e+00
AXH86674.1|3392262_3393099_+|capsid	capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	3.3e-148
AXH86675.1|3393122_3394175_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	7.8e-195
AXH86676.1|3394220_3395021_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.3	1.4e-124
AXH86677.1|3395122_3395617_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
AXH86678.1|3395616_3395817_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AXH86679.1|3395819_3396143_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AXH86680.1|3396139_3396532_+	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AXH86681.1|3396528_3396936_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.8	1.2e-63
AXH88084.1|3396907_3397087_+	hypothetical protein	NA	NA	NA	NA	NA
AXH86682.1|3397073_3397541_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
AXH86683.1|3397533_3398169_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	1.5e-113
AXH86684.1|3398165_3398747_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.4	2.3e-100
AXH86685.1|3398743_3399094_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AXH86686.1|3399097_3399994_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	3.0e-155
AXH86687.1|3399986_3400595_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	75.9	2.4e-87
AXH86688.1|3400591_3402871_+|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	53.4	2.3e-82
AXH86689.1|3402870_3403281_+|tail	phage tail protein	tail	U5P0S4	Shigella_phage	78.9	2.5e-24
AXH86690.1|3403401_3403896_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	2.5e-87
AXH86691.1|3403902_3406710_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.8	0.0e+00
AXH86692.1|3406696_3406933_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.9e-22
AXH86693.1|3406860_3407226_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
AXH86694.1|3407280_3407793_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	9.2e-93
AXH86695.1|3407792_3408977_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.5	2.5e-226
AXH86696.1|3409134_3410244_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	2.4e-194
AXH86697.1|3411580_3411841_+	hypothetical protein	NA	NA	NA	NA	NA
AXH86698.1|3412031_3412172_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
AXH86699.1|3412307_3412604_+	NINE protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
AXH86700.1|3412924_3413920_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AXH86701.1|3413916_3415095_-	arabinose transporter	NA	NA	NA	NA	NA
AXH86702.1|3415036_3415258_+	hypothetical protein	NA	NA	NA	NA	NA
AXH86703.1|3415378_3416599_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
3415322:3415345	attR	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
AXH86704.1|3416757_3418764_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 10
CP031231	Escherichia coli strain Es_ST410_NW1_NDM_09_2017 chromosome, complete genome	4800614	3440362	3450615	4800614	plate	Enterobacteria_phage(42.86%)	10	NA	NA
AXH86727.1|3440362_3441295_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
AXH86728.1|3441606_3442767_+	DUF4102 domain-containing protein	NA	G8EYJ8	Enterobacteria_phage	99.0	9.4e-218
AXH86729.1|3442771_3443803_-	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	37.9	5.6e-12
AXH86730.1|3443814_3444132_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	5.3e-22
AXH88085.1|3444131_3444371_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	49.4	5.2e-14
AXH86731.1|3444751_3445510_-	hypothetical protein	NA	NA	NA	NA	NA
AXH86732.1|3445512_3447660_-	GDSL family lipase	NA	A0A2H4N7A3	Pectobacterium_phage	48.0	1.1e-41
AXH86733.1|3447755_3448448_-	hypothetical protein	NA	NA	NA	NA	NA
AXH86734.1|3448481_3449195_-	hypothetical protein	NA	NA	NA	NA	NA
AXH86735.1|3449196_3450615_-|plate	baseplate J-like family protein	plate	A0A0U2RJZ0	Escherichia_phage	43.4	1.1e-47
>prophage 11
CP031231	Escherichia coli strain Es_ST410_NW1_NDM_09_2017 chromosome, complete genome	4800614	3453672	3489931	4800614	holin,terminase,lysis	Escherichia_phage(32.35%)	47	NA	NA
AXH88086.1|3453672_3455490_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	40.4	4.4e-20
AXH86741.1|3455613_3456186_-	hypothetical protein	NA	NA	NA	NA	NA
AXH86742.1|3456189_3456627_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	38.9	1.1e-25
AXH86743.1|3456630_3458025_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	37.1	7.1e-71
AXH86744.1|3458029_3458968_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.9	8.5e-52
AXH86745.1|3458951_3459386_-	hypothetical protein	NA	NA	NA	NA	NA
AXH86746.1|3459382_3459811_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	38.6	1.2e-21
AXH86747.1|3459807_3460290_-	hypothetical protein	NA	NA	NA	NA	NA
AXH86748.1|3460362_3461394_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	46.1	3.9e-74
AXH86749.1|3461407_3462268_-	hypothetical protein	NA	NA	NA	NA	NA
AXH86750.1|3462283_3463897_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AXH86751.1|3463909_3464731_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	41.2	8.8e-53
AXH86752.1|3464727_3466143_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	36.7	4.2e-87
AXH86753.1|3466154_3467486_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	59.7	3.5e-152
AXH86754.1|3467489_3468230_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	35.4	1.2e-16
AXH86755.1|3468290_3468815_-	hypothetical protein	NA	NA	NA	NA	NA
AXH86756.1|3468966_3469434_-|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	89.7	1.1e-68
AXH86757.1|3469430_3469910_-	lysozyme	NA	A5VW81	Enterobacteria_phage	86.2	1.8e-74
AXH86758.1|3469893_3470217_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	80.4	2.7e-42
AXH86759.1|3470925_3471615_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-59
AXH86760.1|3471611_3471752_-	YlcG family protein	NA	NA	NA	NA	NA
AXH86761.1|3471748_3471979_-	hypothetical protein	NA	NA	NA	NA	NA
AXH86762.1|3471975_3472557_-	recombination protein NinG	NA	E7C9S3	Salmonella_phage	50.2	6.5e-42
AXH86763.1|3472549_3473218_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	73.3	4.3e-98
AXH86764.1|3473214_3473382_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	3.5e-09
AXH86765.1|3473362_3473830_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	5.7e-33
AXH86766.1|3474045_3474315_-	hypothetical protein	NA	H6WRY4	Salmonella_phage	81.8	9.3e-36
AXH86767.1|3475312_3475501_-	diguanylate phosphodiesterase	NA	A0A192Y8X2	Salmonella_phage	87.1	1.4e-22
AXH86768.1|3475500_3475887_-	hypothetical protein	NA	A0A220NQV2	Salmonella_phage	40.7	3.5e-12
AXH86769.1|3476164_3476635_-	hypothetical protein	NA	H6WYJ9	Enterobacter_phage	50.8	2.1e-11
AXH86770.1|3476631_3476925_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
AXH86771.1|3476921_3477770_-	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	60.8	2.1e-89
AXH86772.1|3477766_3478627_-	replication protein	NA	K7PGT1	Enterobacteria_phage	52.9	3.9e-59
AXH86773.1|3478712_3478934_-	transcriptional regulator	NA	NA	NA	NA	NA
AXH86774.1|3478973_3479195_-	helix-turn-helix domain-containing protein	NA	Q716D6	Shigella_phage	55.1	1.8e-13
AXH86775.1|3479297_3479993_+	helix-turn-helix transcriptional regulator	NA	K7P7I4	Enterobacteria_phage	62.4	8.2e-76
AXH86776.1|3480012_3480447_+	hypothetical protein	NA	NA	NA	NA	NA
AXH86777.1|3480909_3481104_+	hypothetical protein	NA	NA	NA	NA	NA
AXH86778.1|3482170_3482455_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	81.9	5.9e-41
AXH86779.1|3482470_3483316_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	9.0e-69
AXH86780.1|3483988_3484147_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	1.9e-09
AXH86781.1|3484143_3484671_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	1.3e-57
AXH86782.1|3484909_3485089_+	hypothetical protein	NA	NA	NA	NA	NA
AXH86783.1|3485085_3485322_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.2e-08
AXH86784.1|3485318_3485519_+	excisionase	NA	K7P7V0	Enterobacteria_phage	86.4	3.7e-29
AXH86785.1|3487367_3488282_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AXH86786.1|3488497_3489931_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 12
CP031231	Escherichia coli strain Es_ST410_NW1_NDM_09_2017 chromosome, complete genome	4800614	3848691	3859152	4800614		Escherichia_phage(66.67%)	8	NA	NA
AXH87096.1|3848691_3851253_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
AXH87097.1|3851358_3852015_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
AXH87098.1|3853029_3853938_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AXH87099.1|3853934_3855197_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AXH87100.1|3855193_3855832_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AXH87101.1|3855836_3856613_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AXH87102.1|3856701_3858066_+	GntP family transporter	NA	NA	NA	NA	NA
AXH87103.1|3858159_3859152_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 1
CP031232	Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_2, complete sequence	54776	430	33110	54776	plate,tail	Escherichia_phage(63.64%)	35	NA	NA
AXH88131.1|430_649_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AXH88132.1|730_1432_-	hypothetical protein	NA	Q71TJ0	Escherichia_phage	99.6	1.0e-142
AXH88133.1|1428_2106_-	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	97.3	3.3e-130
AXH88134.1|2102_2729_-	norphogenetic protein	NA	Q71T82	Escherichia_phage	99.0	4.0e-122
AXH88135.1|2626_3289_-	norphogenetic protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
AXH88136.1|3230_3386_-	norphogenetic protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
AXH88137.1|3452_4031_-	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	99.5	4.4e-107
AXH88138.1|4033_4279_-	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
AXH88139.1|4425_4803_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
AXH88140.1|4812_6030_+|tail	phage tail protein	tail	A0A077SL53	Escherichia_phage	99.5	4.1e-224
AXH88141.1|8363_8579_+	hypothetical protein	NA	NA	NA	NA	NA
AXH88142.1|9007_9442_-	tellurite resistance protein	NA	Q1MVI3	Enterobacteria_phage	100.0	8.1e-74
AXH88189.1|9638_9830_+	hypothetical protein	NA	Q71T98	Escherichia_phage	100.0	6.0e-29
AXH88143.1|11004_14046_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	86.5	0.0e+00
AXH88144.1|14042_14948_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
AXH88145.1|14940_15225_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	97.9	2.5e-47
AXH88146.1|15498_15678_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
AXH88147.1|15686_16475_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	96.6	1.4e-116
AXH88148.1|16514_16937_+	ppfA	NA	A0A1B0VCB0	Salmonella_phage	86.4	1.1e-46
AXH88149.1|17114_17507_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
AXH88150.1|17825_18686_+	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
AXH88151.1|19243_20440_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AXH88152.1|20456_21458_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.4	1.1e-177
AXH88153.1|21682_23389_+	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.2	6.3e-311
AXH88154.1|23449_25039_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.3	1.6e-300
AXH88155.1|25048_25864_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	2.6e-113
AXH88190.1|25976_26195_-	hypothetical protein	NA	NA	NA	NA	NA
AXH88156.1|26494_27004_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
AXH88157.1|27087_27384_+	hypothetical protein	NA	Q1MVK0	Enterobacteria_phage	100.0	9.2e-53
AXH88158.1|27550_28015_-	oxidoreductase	NA	Q1MVK1	Enterobacteria_phage	98.7	4.3e-89
AXH88159.1|28014_28719_-	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	99.6	1.3e-134
AXH88160.1|28887_29733_-	Replication protein repL	NA	Q1MVK3	Enterobacteria_phage	97.9	1.2e-150
AXH88161.1|29762_30563_-	DNA-binding protein	NA	Q1MVK4	Enterobacteria_phage	99.6	1.6e-147
AXH88162.1|31756_31978_-	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	100.0	1.3e-38
AXH88163.1|32597_33110_+	hypothetical protein	NA	A0A077SK39	Escherichia_phage	100.0	4.5e-55
>prophage 2
CP031232	Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_2, complete sequence	54776	36403	52655	54776	terminase	Escherichia_phage(57.14%)	23	NA	NA
AXH88165.1|36403_36844_+	peptide-binding protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
AXH88166.1|36840_37089_+	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AXH88167.1|37147_37657_-	hypothetical protein	NA	NA	NA	NA	NA
AXH88168.1|37656_38697_-	hypothetical protein	NA	NA	NA	NA	NA
AXH88169.1|38787_39429_-	maturation control protein	NA	A0A077SK30	Escherichia_phage	96.2	4.2e-111
AXH88170.1|39618_40179_-	recombinase	NA	Q71TG3	Escherichia_phage	96.8	3.6e-98
AXH88171.1|40425_40737_-	lysogeny establishment protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	6.3e-44
AXH88172.1|40787_41819_-	recombinase	NA	A0A077SLE7	Escherichia_phage	99.4	6.4e-194
AXH88173.1|41826_42048_-	creatininase	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
AXH88174.1|42450_42564_+	peptidase	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
AXH88175.1|42582_42678_+	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AXH88176.1|42643_42853_+	c1 repressor inactivator	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
AXH88177.1|42963_43815_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	4.0e-157
AXH88178.1|43840_45325_-|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
AXH88179.1|45324_46518_-|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	88.7	7.2e-181
AXH88180.1|46603_47056_-	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
AXH88181.1|47144_48188_-	DUF968 domain-containing protein	NA	Q1MVE3	Enterobacteria_phage	99.7	1.8e-207
AXH88182.1|48215_48395_-	PdcA protein	NA	Q71TH5	Escherichia_phage	100.0	7.1e-24
AXH88183.1|48399_48780_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
AXH88184.1|48779_49001_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AXH88185.1|49073_49463_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	100.0	8.3e-70
AXH88186.1|50799_52311_-	acyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	7.6e-42
AXH88187.1|52295_52655_-	acyltransferase	NA	W6MVL2	Pseudomonas_phage	58.2	5.4e-23
>prophage 1
CP031233	Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_3, complete sequence	98308	41546	82705	98308	integrase,transposase	Escherichia_phage(50.0%)	46	35895:35912	71045:71062
35895:35912	attL	CAGGATCACATCACCCTG	NA	NA	NA	NA
AXH88226.1|41546_42119_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
AXH88227.1|42287_43376_+	transcriptional regulator	NA	NA	NA	NA	NA
AXH88228.1|43377_45603_+	phage T7 exclusion protein	NA	NA	NA	NA	NA
AXH88229.1|45652_46552_-	hypothetical protein	NA	NA	NA	NA	NA
AXH88230.1|46541_46832_-	hypothetical protein	NA	NA	NA	NA	NA
AXH88288.1|47012_47186_+	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
AXH88231.1|47127_47358_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXH88232.1|47354_47771_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AXH88289.1|47932_49492_-	AAA family ATPase	NA	NA	NA	NA	NA
AXH88233.1|49676_49760_+	glutathione S-transferase	NA	NA	NA	NA	NA
AXH88234.1|49773_50796_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	6.6e-199
AXH88235.1|50792_51575_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	6.5e-138
AXH88236.1|52383_52641_+	hypothetical protein	NA	NA	NA	NA	NA
AXH88237.1|52640_53231_+	hypothetical protein	NA	NA	NA	NA	NA
AXH88238.1|53493_55050_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
AXH88239.1|55240_55858_+	proQ/FINO family protein	NA	NA	NA	NA	NA
AXH88240.1|57389_57713_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXH88290.1|59522_59915_+	cysteine hydrolase	NA	NA	NA	NA	NA
AXH88241.1|60052_60937_+	EamA family transporter	NA	NA	NA	NA	NA
AXH88242.1|60968_62168_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AXH88243.1|62246_62900_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXH88291.1|62931_63168_-	relaxase	NA	NA	NA	NA	NA
AXH88244.1|63221_64058_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AXH88245.1|64057_64861_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AXH88246.1|64921_65737_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AXH88247.1|66044_66257_-	replication C family protein	NA	NA	NA	NA	NA
AXH88248.1|66281_66986_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXH88249.1|67107_68013_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AXH88250.1|68009_69248_+	MFS transporter	NA	NA	NA	NA	NA
AXH88251.1|69247_69832_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXH88252.1|69777_70134_+	hypothetical protein	NA	NA	NA	NA	NA
AXH88292.1|70324_71089_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
71045:71062	attR	CAGGATCACATCACCCTG	NA	NA	NA	NA
AXH88253.1|71117_71300_+	resolvase	NA	NA	NA	NA	NA
AXH88254.1|71315_71621_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXH88255.1|71631_72837_-	chromate transporter	NA	NA	NA	NA	NA
AXH88256.1|72993_73197_-	hypothetical protein	NA	NA	NA	NA	NA
AXH88257.1|73215_73395_+	hypothetical protein	NA	NA	NA	NA	NA
AXH88258.1|73324_74164_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	3.8e-11
AXH88259.1|74157_74505_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXH88260.1|74710_75499_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AXH88293.1|75629_76103_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
AXH88261.1|76260_76914_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	1.1e-21
AXH88262.1|77140_78673_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXH88263.1|78929_79298_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AXH88264.1|79325_80861_-	fluoroquinolone efflux MFS transporter QepA1	NA	NA	NA	NA	NA
AXH88265.1|82000_82705_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
CP031235	Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_NDM, complete sequence	85456	33559	65017	85456	protease,transposase	Escherichia_phage(28.57%)	28	NA	NA
AXH88378.1|33559_34264_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXH88379.1|34632_35445_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
AXH88380.1|35448_35814_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
AXH88381.1|35818_36457_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AXH88382.1|36467_37499_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
AXH88383.1|37503_37833_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AXH88384.1|38026_38317_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
AXH88385.1|38560_39400_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	26.9	5.5e-10
AXH88386.1|39804_41346_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXH88432.1|42744_43518_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
AXH88387.1|43498_43780_-	hypothetical protein	NA	NA	NA	NA	NA
AXH88388.1|43999_44185_-	hypothetical protein	NA	NA	NA	NA	NA
AXH88389.1|44233_45418_+|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
AXH88390.1|45816_47292_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AXH88391.1|47347_48232_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AXH88433.1|49906_50539_-	hypothetical protein	NA	NA	NA	NA	NA
AXH88392.1|50874_51417_-	DNA-binding protein	NA	NA	NA	NA	NA
AXH88393.1|52301_53006_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXH88394.1|56234_56744_-	ROS/MUCR transcriptional regulator domain protein	NA	NA	NA	NA	NA
AXH88395.1|56791_58879_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
AXH88396.1|58891_59842_-	DsbC family protein	NA	NA	NA	NA	NA
AXH88434.1|59852_61115_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
AXH88435.1|61159_61435_-	lytic transglycosylase	NA	NA	NA	NA	NA
AXH88436.1|61659_62043_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
AXH88397.1|62122_62776_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXH88398.1|62868_63126_+	antitoxin	NA	NA	NA	NA	NA
AXH88399.1|63127_63460_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AXH88400.1|63754_65017_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
