The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	7735	54569	4994045	protease,transposase	Ralstonia_phage(30.0%)	45	NA	NA
AXI19886.1|7735_8572_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXI19887.1|8758_9565_+	peptidase	NA	NA	NA	NA	NA
AXI19888.1|9841_11035_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19889.1|11188_11860_+	energy transducer TonB	NA	NA	NA	NA	NA
AXI19890.1|11944_12706_+	biopolymer transporter ExbB	NA	NA	NA	NA	NA
AXI19891.1|12752_13175_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXI19892.1|13178_13592_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXI19893.1|13887_14655_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AXI19894.1|14665_14935_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19895.1|15009_16470_-	cardiolipin synthase	NA	NA	NA	NA	NA
AXI19896.1|17116_18127_-	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
AXI19897.1|18398_19601_-	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AXI19898.1|19742_21881_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
AXI23436.1|22091_22385_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19899.1|22501_23047_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19900.1|23160_24141_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
AXI19901.1|24188_25355_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AXI19902.1|25501_26068_-	protein-S-isoprenylcysteine methyltransferase	NA	NA	NA	NA	NA
AXI23437.1|27542_28751_+	trans-2-enoyl-CoA reductase	NA	NA	NA	NA	NA
AXI19903.1|29378_30401_-	sugar kinase	NA	NA	NA	NA	NA
AXI19904.1|30687_30969_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI19905.1|30981_31221_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19906.1|31223_32192_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI19907.1|32544_33816_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19908.1|33827_34520_+	hypothetical protein	NA	G3M9Y6	Bacillus_virus	24.2	4.4e-05
AXI19909.1|34707_35094_-	hypothetical protein	NA	K4I1H9	Acidithiobacillus_phage	67.3	2.8e-33
AXI19910.1|35121_36498_-|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.5	9.2e-79
AXI19911.1|39124_39457_+	dihydrolipoamide acyltransferase	NA	NA	NA	NA	NA
AXI19912.1|39510_39753_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19913.1|39694_40018_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19914.1|40148_40535_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19915.1|40483_41464_-|transposase	IS5 family transposase ISXoo7	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
AXI19916.1|41823_42075_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19917.1|42082_43372_+	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
AXI19918.1|43811_44147_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19919.1|44421_44853_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19920.1|45201_46611_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AXI19921.1|47928_48189_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19922.1|48205_48538_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19923.1|48537_48996_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19924.1|49355_50570_-|transposase	IS4/IS5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
AXI19925.1|50594_51020_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19926.1|51090_51888_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI19927.1|52693_53509_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AXI19928.1|53570_54569_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	78438	139389	4994045	transposase	Ralstonia_phage(62.5%)	55	NA	NA
AXI19943.1|78438_78885_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI19944.1|78917_79178_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19945.1|81938_82280_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19946.1|84495_86049_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19947.1|86512_87076_-	lytic transglycosylase	NA	A0A0K2QQJ4	Ralstonia_phage	38.5	4.4e-11
AXI19948.1|87451_87871_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19949.1|88333_89302_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI19950.1|89769_91587_-	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
AXI19951.1|91669_92500_-	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AXI19952.1|92496_93006_-	type III secretion protein HrpB7	NA	NA	NA	NA	NA
AXI19953.1|92998_94327_-	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
AXI19954.1|94316_95018_-	ATP-dependent helicase HrpB	NA	NA	NA	NA	NA
AXI19955.1|95002_95632_-	type III secretion protein HrpB4	NA	NA	NA	NA	NA
AXI19956.1|95639_96401_-	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
AXI19957.1|96402_96795_-	type III secretion protein HrpB2	NA	NA	NA	NA	NA
AXI19958.1|96828_97284_-	serine kinase	NA	NA	NA	NA	NA
AXI19959.1|97498_98578_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
AXI23440.1|98586_100509_+	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AXI19960.1|100508_101150_+	type III secretion protein HpaP	NA	NA	NA	NA	NA
AXI19961.1|101242_102196_+	aldolase	NA	NA	NA	NA	NA
AXI19962.1|102182_102827_+	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AXI19963.1|102831_103092_+	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AXI19964.1|103088_103916_+	4-hydroxyphenylacetate catabolism regulator HpaA	NA	NA	NA	NA	NA
AXI19965.1|103912_104851_+	serine kinase	NA	NA	NA	NA	NA
AXI19966.1|104860_105103_+	serine kinase	NA	NA	NA	NA	NA
AXI19967.1|105234_105465_+	serine kinase	NA	NA	NA	NA	NA
AXI19968.1|105519_105990_+	4-hydroxyphenylacetate 3-monooxygenase	NA	NA	NA	NA	NA
AXI19969.1|106404_108390_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19970.1|108386_108833_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19971.1|110533_111502_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI19972.1|111628_112864_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI19973.1|113034_114471_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI19974.1|114542_115526_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
AXI19975.1|115896_117132_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI19976.1|117567_119940_+	serine kinase	NA	NA	NA	NA	NA
AXI23441.1|120815_122444_+	type III secretion system effector XopAE	NA	NA	NA	NA	NA
AXI19977.1|123001_123385_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19978.1|123381_123867_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19979.1|123870_124233_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19980.1|124349_125786_-	heat-shock protein	NA	W5SAB9	Pithovirus	30.7	1.5e-10
AXI19981.1|126027_126879_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
AXI19982.1|127338_127656_-	ATP-binding protein	NA	NA	NA	NA	NA
AXI19983.1|127961_128849_-	TIGR01777 family protein	NA	NA	NA	NA	NA
AXI23442.1|129049_129529_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19984.1|129555_130506_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
AXI19985.1|130619_130805_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19986.1|130896_131169_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19987.1|131209_131491_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19988.1|131629_132688_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXI19989.1|132828_133776_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
AXI19990.1|134030_134342_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19991.1|135614_135797_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19992.1|135808_136279_+	DNA mismatch repair protein MutT	NA	NA	NA	NA	NA
AXI19993.1|137232_137631_+	host attachment protein	NA	NA	NA	NA	NA
AXI19994.1|138432_139389_+|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 3
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	147554	226822	4994045	transposase,tRNA,protease	Acidithiobacillus_phage(22.22%)	48	NA	NA
AXI20000.1|147554_147806_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI20001.1|148258_148660_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AXI20002.1|148683_148914_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AXI20003.1|148980_149643_-	hemolysin III	NA	NA	NA	NA	NA
AXI23443.1|149917_152326_+	helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	36.0	1.5e-07
AXI20004.1|152322_154149_+	exonuclease	NA	NA	NA	NA	NA
AXI20005.1|154637_156782_-	avirulence protein	NA	NA	NA	NA	NA
AXI20006.1|156972_158130_-	ROK family protein	NA	NA	NA	NA	NA
AXI20007.1|158302_160891_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI20008.1|160901_161687_+	Tat pathway signal protein	NA	NA	NA	NA	NA
AXI23444.1|162000_163140_-	saccharopine dehydrogenase	NA	NA	NA	NA	NA
AXI23445.1|163634_163802_-	amino acid transporter	NA	NA	NA	NA	NA
AXI20009.1|164290_164596_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23446.1|164583_164775_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23447.1|164918_166082_-	DNA topoisomerase	NA	A0A0U2TSJ7	Niemeyer_virus	35.2	1.7e-38
AXI20010.1|166228_166609_+	Elastase inhibitor AFLEI Flags: Precursor	NA	NA	NA	NA	NA
AXI20011.1|166810_171283_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
AXI20012.1|171477_172959_+	glutamate synthase small subunit	NA	NA	NA	NA	NA
AXI20013.1|174196_175195_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI23448.1|176597_177396_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI20014.1|177634_179017_-|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	4.7e-75
AXI20015.1|180117_180450_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20016.1|180418_181486_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AXI23449.1|181441_181639_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20017.1|182145_182457_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20018.1|182395_182620_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23450.1|182577_182838_-	metallophosphatase family protein	NA	NA	NA	NA	NA
AXI20019.1|183041_185225_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
AXI20020.1|185236_188587_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
AXI20021.1|188583_191700_-	alpha-amylase	NA	NA	NA	NA	NA
AXI20022.1|193376_193571_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20023.1|198782_200165_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI20024.1|200321_201842_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AXI20025.1|201858_202137_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23451.1|202326_202665_+	transcriptional regulator	NA	NA	NA	NA	NA
AXI20026.1|203277_205263_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AXI20027.1|206182_206995_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20028.1|207187_207799_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20029.1|208215_209073_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
AXI20030.1|209310_211197_+	arginine decarboxylase	NA	NA	NA	NA	NA
AXI20031.1|211762_213139_+|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.7e-78
AXI20032.1|213543_216267_+	type VI secretion protein	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.0	4.8e-71
AXI23452.1|216334_218488_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	28.5	2.0e-27
AXI20033.1|218484_220176_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20034.1|220172_220436_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	4.4e-06
AXI20035.1|220497_222699_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
AXI20036.1|222695_224384_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20037.1|224917_226822_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 4
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	269762	318004	4994045	transposase	Staphylococcus_prophage(25.0%)	36	NA	NA
AXI20067.1|269762_269984_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	50.8	1.6e-09
AXI20068.1|270905_271439_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20069.1|272821_272953_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20070.1|274254_275313_-	hydroxyacid dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
AXI20071.1|275298_275505_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20072.1|275620_276694_+	cellulase	NA	NA	NA	NA	NA
AXI20073.1|277456_278509_+	cellulase	NA	NA	NA	NA	NA
AXI20074.1|279156_280287_+	cellulase	NA	NA	NA	NA	NA
AXI20075.1|281610_282000_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20076.1|282207_282414_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20077.1|282645_283614_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI20078.1|283867_286030_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
AXI20079.1|287941_288544_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
AXI20080.1|288540_290445_+	phytochrome	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
AXI20081.1|298934_299270_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20082.1|299319_299580_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20083.1|299760_300576_+	formamidopyrimidine-DNA glycosylase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
AXI20084.1|300922_301984_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AXI20085.1|301989_302409_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXI23455.1|302174_302753_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20086.1|304551_305610_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20087.1|305620_305911_-	anti-sigma B factor antagonist	NA	NA	NA	NA	NA
AXI20088.1|305900_306563_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
AXI20089.1|306559_307111_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AXI20090.1|307122_307872_-	ABC transporter permease	NA	NA	NA	NA	NA
AXI20091.1|307871_308666_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
AXI20092.1|309050_309338_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20093.1|309356_309914_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXI20094.1|309931_310930_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI20095.1|311741_312698_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
AXI20096.1|312742_313189_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI23456.1|312954_313533_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20097.1|313571_314370_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI20098.1|314501_315716_+|transposase	IS4/IS5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
AXI20099.1|315775_316606_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI20100.1|316768_318004_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 5
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	323474	397376	4994045	transposase,tRNA	Acidithiobacillus_phage(16.67%)	55	NA	NA
AXI20104.1|323474_323921_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI23458.1|323686_324265_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20105.1|324317_324902_-	gluconokinase	NA	NA	NA	NA	NA
AXI20106.1|325059_326442_+	MFS transporter	NA	NA	NA	NA	NA
AXI23459.1|326444_328844_+	NdvB protein	NA	NA	NA	NA	NA
AXI20107.1|328947_331590_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20108.1|331996_332197_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23460.1|332337_335787_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AXI20109.1|335979_336564_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20110.1|337040_337817_-	transcriptional regulator	NA	NA	NA	NA	NA
AXI20111.1|337997_339299_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AXI23461.1|339295_339661_+	L-fucose mutarotase	NA	NA	NA	NA	NA
AXI20112.1|340097_341579_+|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
AXI20113.1|341738_342737_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI20114.1|343562_345725_+	type III secretion system effector protein	NA	NA	NA	NA	NA
AXI20115.1|345851_348020_-	dipeptidyl carboxypeptidase II	NA	NA	NA	NA	NA
AXI23462.1|348393_348579_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20116.1|348657_349287_-	acyltransferase	NA	NA	NA	NA	NA
AXI20117.1|349289_349721_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AXI20118.1|349813_350356_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20119.1|350451_351204_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AXI20120.1|351428_351818_-	cupin	NA	NA	NA	NA	NA
AXI20121.1|351931_353605_-	ubiquinone biosynthesis protein UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
AXI20122.1|353601_354246_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
AXI20123.1|354255_354450_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20124.1|357930_358215_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20125.1|358566_359365_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI23463.1|359424_360003_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI20126.1|359768_360215_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI20127.1|364142_365141_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI20128.1|366168_367275_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXI20129.1|368886_369069_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23464.1|369068_370007_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AXI20130.1|370125_370875_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	5.6e-54
AXI20131.1|370877_371669_-	ABC transporter permease	NA	NA	NA	NA	NA
AXI20132.1|371686_372682_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
AXI20133.1|372784_373546_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AXI20134.1|373630_374626_-	cation transporter	NA	NA	NA	NA	NA
AXI20135.1|374691_374964_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AXI23465.1|375449_376037_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20136.1|376033_376234_+	transcriptional regulator	NA	NA	NA	NA	NA
AXI20137.1|376294_377896_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXI20138.1|377927_378674_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
AXI20139.1|378670_379864_+	sodium ABC transporter permease	NA	NA	NA	NA	NA
AXI20140.1|380273_381296_-	energy transducer TonB	NA	NA	NA	NA	NA
AXI20141.1|381435_383001_-	tryptophan halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
AXI20142.1|383011_384025_-	cupin	NA	NA	NA	NA	NA
AXI20143.1|384014_384716_-	peptidase	NA	NA	NA	NA	NA
AXI23466.1|384899_387914_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI20144.1|388303_388993_+	glutathione S-transferase	NA	NA	NA	NA	NA
AXI20145.1|389417_391655_+	S9 family peptidase	NA	NA	NA	NA	NA
AXI20146.1|391824_393654_+	DUF885 domain-containing protein	NA	NA	NA	NA	NA
AXI20147.1|393753_394212_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20148.1|394876_395869_+	porphobilinogen synthase	NA	NA	NA	NA	NA
AXI20149.1|395993_397376_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	519224	576391	4994045	transposase,tRNA	Hokovirus(25.0%)	46	NA	NA
AXI23477.1|519224_520436_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AXI20246.1|528062_530372_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	40.8	7.7e-46
AXI23478.1|530372_532199_-	response regulator receiver protein	NA	NA	NA	NA	NA
AXI20247.1|532381_533008_-	DUF4126 domain-containing protein	NA	NA	NA	NA	NA
AXI20248.1|533148_533886_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20249.1|533889_534117_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20250.1|534129_534339_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20251.1|534358_534805_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI23479.1|534570_535149_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI20252.1|535227_535614_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.9	1.1e-24
AXI20253.1|536540_537821_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXI20254.1|538127_539018_+	NADH pyrophosphatase	NA	NA	NA	NA	NA
AXI20255.1|539091_539982_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20256.1|540303_540711_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20257.1|540713_541094_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20258.1|541148_541436_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20259.1|541554_543477_-	MFS transporter	NA	NA	NA	NA	NA
AXI20260.1|545868_548082_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AXI20261.1|548307_548889_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20262.1|548885_550079_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AXI20263.1|550231_551521_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AXI20264.1|551541_552156_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20265.1|552155_553391_-	ATPase	NA	A0A077SLJ9	Escherichia_phage	25.9	1.3e-20
AXI20266.1|553440_555024_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.6	2.6e-61
AXI20267.1|555389_555716_+	CDP-alcohol phosphatidyltransferase	NA	NA	NA	NA	NA
AXI20268.1|555841_556243_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXI20269.1|556563_557562_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXI20270.1|557558_557957_+	phosphatase	NA	NA	NA	NA	NA
AXI20271.1|557953_558952_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI20272.1|559001_559286_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20273.1|559603_559876_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXI23480.1|559982_560828_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20274.1|561538_561916_-	transcriptional regulator	NA	NA	NA	NA	NA
AXI20275.1|562059_562575_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23481.1|562721_563663_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AXI20276.1|565530_565896_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20277.1|566034_567402_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AXI23482.1|567437_567845_-	four helix bundle protein	NA	NA	NA	NA	NA
AXI20278.1|567877_568363_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
AXI20279.1|568461_568908_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AXI20280.1|569233_569428_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20281.1|569747_572072_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AXI20282.1|572077_572410_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AXI20283.1|572593_573592_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI23483.1|574026_575454_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI20284.1|575875_576391_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 7
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	736817	849400	4994045	transposase,tRNA	Enterobacteria_phage(16.0%)	98	NA	NA
AXI20429.1|736817_737039_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXI20430.1|737035_738034_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI20431.1|738095_738674_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI20432.1|740175_740361_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AXI23494.1|740409_741681_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXI20433.1|741888_743718_+	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.5	1.3e-133
AXI20434.1|744099_744573_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20435.1|744804_745380_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20436.1|745385_745832_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI23495.1|745597_746176_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20437.1|746291_747326_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXI23496.1|747542_748067_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
AXI20438.1|748223_749330_-	copper resistance protein B	NA	NA	NA	NA	NA
AXI23497.1|749326_751153_-	copper resistance protein CopA	NA	NA	NA	NA	NA
AXI20439.1|751260_751677_-	copper homeostasis protein	NA	NA	NA	NA	NA
AXI20440.1|751812_752916_+	cysteine synthase	NA	NA	NA	NA	NA
AXI20441.1|752959_754984_+	oligopeptidase A	NA	NA	NA	NA	NA
AXI20442.1|755157_755979_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20443.1|756092_757301_-	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AXI20444.1|757300_757816_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AXI20445.1|757814_758162_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20446.1|758161_759241_+	DNA polymerase IV	NA	NA	NA	NA	NA
AXI20447.1|759382_760033_+	phosphoglycolate phosphatase, bacterial	NA	NA	NA	NA	NA
AXI20448.1|760344_760743_-	transcriptional regulator	NA	NA	NA	NA	NA
AXI20449.1|760739_761222_-	diguanylate cyclase	NA	NA	NA	NA	NA
AXI20450.1|761546_762221_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AXI23498.1|762335_762671_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20451.1|762863_763217_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AXI20452.1|763178_763358_+	GTP-binding protein	NA	NA	NA	NA	NA
AXI20453.1|763629_765012_-	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	1.4e-55
AXI20454.1|765104_765230_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AXI20455.1|765391_766381_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AXI20456.1|766424_767051_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
AXI20457.1|767389_768529_-	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AXI20458.1|768621_769005_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20459.1|769001_769892_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20460.1|770233_770452_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23499.1|770693_772064_+	cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	38.8	2.6e-49
AXI20461.1|772154_773348_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
AXI20462.1|773394_774195_+	methyltransferase	NA	H8ZJI6	Ostreococcus_tauri_virus	28.0	3.5e-06
AXI20463.1|774229_775306_+	NAD-dependent dehydratase	NA	A0A1V0SG19	Hokovirus	21.8	4.9e-11
AXI20464.1|776337_777264_+	glycosyltransferase	NA	NA	NA	NA	NA
AXI20465.1|777284_777575_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20466.1|777565_778729_+	glycosyl transferase	NA	NA	NA	NA	NA
AXI20467.1|778734_779787_+	acyltransferase	NA	A9YX16	Burkholderia_phage	33.9	1.5e-41
AXI20468.1|779786_781193_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI20469.1|783221_784535_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
AXI20470.1|784524_785343_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AXI20471.1|785565_786507_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
AXI20472.1|786506_787253_-	EtfB protein	NA	NA	NA	NA	NA
AXI20473.1|787478_788534_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
AXI20474.1|788589_789477_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
AXI20475.1|789473_790031_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
AXI20476.1|790027_790936_+	NAD(P)-dependent oxidoreductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
AXI20477.1|791052_792456_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
AXI20478.1|792501_793848_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
AXI20479.1|793981_794713_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AXI20480.1|794712_795342_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AXI20481.1|795445_796414_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI20482.1|796559_798647_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20483.1|798643_800293_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AXI20484.1|800408_801017_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
AXI20485.1|801410_801641_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20486.1|801567_802212_-	ABC transporter	NA	NA	NA	NA	NA
AXI20487.1|802208_803135_-	MCE family protein	NA	NA	NA	NA	NA
AXI20488.1|803137_803980_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	9.1e-13
AXI20489.1|804065_805178_-	ABC transporter permease	NA	NA	NA	NA	NA
AXI20490.1|805347_806595_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20491.1|806656_807118_-	DNA-binding protein	NA	NA	NA	NA	NA
AXI20492.1|807260_808955_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AXI20493.1|809066_809471_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AXI20494.1|809602_810376_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AXI20495.1|810386_810854_+	alanine acetyltransferase	NA	NA	NA	NA	NA
AXI23500.1|810859_811333_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AXI23501.1|811759_813211_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI23502.1|813314_814688_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI20496.1|814900_815869_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AXI20497.1|816018_817401_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI23503.1|817570_819616_+	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	8.2e-15
AXI20498.1|822512_823310_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI20499.1|823962_824277_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXI20500.1|824463_825565_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	1.6e-41
AXI20501.1|825464_826007_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20502.1|826191_826494_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20503.1|826501_829444_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.6	3.2e-129
AXI20504.1|829651_830077_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AXI20505.1|830117_830423_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20506.1|830422_831895_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	6.2e-49
AXI20507.1|832002_833085_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AXI23504.1|833081_834188_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AXI20508.1|834602_835070_-	RDD family protein	NA	NA	NA	NA	NA
AXI20509.1|835496_836468_+	site-specific tyrosine recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.9	6.4e-18
AXI20510.1|836921_837719_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23505.1|837958_838225_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20511.1|838117_842170_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	7.5e-121
AXI20512.1|842427_842691_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20513.1|843147_846945_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20514.1|848443_849400_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	2.4e-41
>prophage 8
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	874672	935589	4994045	transposase,protease	Ralstonia_phage(18.18%)	48	NA	NA
AXI20534.1|874672_875641_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI20535.1|877379_877670_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
AXI20536.1|877684_878719_-	subtype I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
AXI20537.1|878721_879354_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
AXI20538.1|879373_880240_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
AXI20539.1|880236_882081_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
AXI20540.1|882077_882752_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
AXI20541.1|882879_885171_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
AXI20542.1|885249_886248_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI20543.1|886638_887214_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AXI20544.1|887326_887836_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20545.1|887934_888129_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AXI20546.1|888218_889196_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
AXI20547.1|889425_889866_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
AXI20548.1|890143_891088_+	malonyl CoA-acyl carrier protein transacylase	NA	NA	NA	NA	NA
AXI20549.1|891170_891914_+	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
AXI20550.1|892118_892358_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
AXI20551.1|892499_893735_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AXI20552.1|893905_895261_+	aminodeoxychorismate synthase, component I	NA	NA	NA	NA	NA
AXI20553.1|895321_896395_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
AXI20554.1|896391_897351_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
AXI20555.1|897347_897701_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AXI23507.1|899547_899874_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20556.1|900109_901708_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
AXI20557.1|901853_902750_+	methylisocitrate lyase	NA	NA	NA	NA	NA
AXI20558.1|902825_903980_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
AXI20559.1|904174_906766_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
AXI20560.1|907309_907507_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20561.1|907498_908698_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
AXI20562.1|909197_911414_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI20563.1|911493_912492_+	nucleoside hydrolase	NA	NA	NA	NA	NA
AXI20564.1|913763_916751_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI20565.1|916925_917873_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
AXI20566.1|918371_918908_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20567.1|918867_920298_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI20568.1|920642_921605_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	2.2e-42
AXI20569.1|921738_922299_-	bacterioferritin	NA	NA	NA	NA	NA
AXI20570.1|922341_922824_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
AXI20571.1|922986_923463_+	heat-shock protein	NA	NA	NA	NA	NA
AXI20572.1|923873_924773_+	cytochrome C biogenesis protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
AXI20573.1|925012_925399_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
AXI20574.1|926028_927156_+	HflK protein	NA	NA	NA	NA	NA
AXI20575.1|927155_928019_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
AXI20576.1|928312_928498_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20577.1|928835_930128_+	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	37.5	8.4e-74
AXI20578.1|930453_933126_+	aminopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	2.6e-77
AXI20579.1|933319_934102_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23508.1|934212_935589_-|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.4	5.0e-77
>prophage 9
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	974277	1093817	4994045	transposase,integrase,protease	Ralstonia_phage(24.0%)	92	1026016:1026034	1094944:1094962
AXI20607.1|974277_975276_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI20608.1|975730_976222_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20609.1|977413_977734_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20610.1|977901_979158_-	6-phosphofructokinase	NA	NA	NA	NA	NA
AXI20611.1|979317_979881_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
AXI23510.1|980247_981606_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
AXI20612.1|981605_982202_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AXI20613.1|982348_983233_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20614.1|985214_985829_+	glutathione S-transferase	NA	NA	NA	NA	NA
AXI20615.1|985911_986898_-	malate dehydrogenase	NA	NA	NA	NA	NA
AXI20616.1|987013_987508_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
AXI20617.1|987752_989582_+	translational GTPase TypA	NA	NA	NA	NA	NA
AXI20618.1|989600_990071_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20619.1|990993_992121_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20620.1|992221_993604_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
AXI20621.1|993851_995975_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI20622.1|996503_997022_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AXI20623.1|998892_999294_+	hypothetical protein	NA	K4ICS3	Acidithiobacillus_phage	42.7	2.2e-17
AXI20624.1|999346_1000582_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI20625.1|1001195_1002086_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20626.1|1002175_1002316_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AXI20627.1|1003143_1003446_-	hypothetical protein	NA	K4I1H9	Acidithiobacillus_phage	64.3	1.0e-19
AXI20628.1|1003790_1004759_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXI20629.1|1006738_1007032_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20630.1|1007035_1008271_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI20631.1|1009253_1010705_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI23511.1|1011318_1012242_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
AXI20632.1|1013271_1014270_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI20633.1|1014571_1016149_+	chlamydia polymorphic membrane family protein	NA	NA	NA	NA	NA
AXI23512.1|1016216_1016795_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20634.1|1016560_1017007_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI20635.1|1019648_1020617_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI20636.1|1020877_1021339_-	cell wall hydrolase	NA	NA	NA	NA	NA
AXI20637.1|1021887_1022130_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
AXI23513.1|1022123_1022702_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20638.1|1022467_1022914_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI20639.1|1022919_1023651_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
AXI20640.1|1025470_1026223_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
1026016:1026034	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
AXI20641.1|1026224_1027223_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI20642.1|1027453_1028461_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
AXI20643.1|1028604_1029366_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20644.1|1029992_1030268_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20645.1|1031762_1032071_+	hypothetical protein	NA	K4I1H9	Acidithiobacillus_phage	63.1	1.4e-16
AXI20646.1|1032681_1033974_+	trigger factor	NA	NA	NA	NA	NA
AXI20647.1|1034066_1034693_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
AXI20648.1|1034817_1036104_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
AXI20649.1|1036247_1038719_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
AXI20650.1|1038932_1039205_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
AXI20651.1|1040036_1042007_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXI20652.1|1042712_1043891_-	lytic transglycosylase	NA	NA	NA	NA	NA
AXI20653.1|1043887_1044655_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AXI20654.1|1044667_1045324_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20655.1|1045351_1045804_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
AXI20656.1|1045812_1046547_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
AXI20657.1|1046982_1047687_-	protein phosphatase	NA	NA	NA	NA	NA
AXI20658.1|1048605_1049142_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20659.1|1049623_1049935_+	DNA methyltransferase	NA	B7SYF3	Stenotrophomonas_phage	71.4	2.6e-37
AXI20660.1|1050033_1050234_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23514.1|1053419_1055570_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
AXI20661.1|1055566_1057264_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20662.1|1057583_1059788_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
AXI20663.1|1059784_1061479_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20664.1|1061475_1061739_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
AXI20665.1|1061800_1064008_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
AXI20666.1|1064004_1065684_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20667.1|1065680_1065944_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
AXI20668.1|1066005_1066563_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20669.1|1066612_1067611_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI23515.1|1067709_1068396_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
AXI20670.1|1068506_1068911_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
AXI20671.1|1069121_1070171_-	ADP-heptose--LPS heptosyltransferase	NA	NA	NA	NA	NA
AXI20672.1|1070191_1070941_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
AXI20673.1|1070940_1071690_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
AXI20674.1|1071689_1072721_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
AXI20675.1|1072738_1073098_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AXI20676.1|1073122_1073620_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AXI20677.1|1073616_1073862_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
AXI20678.1|1073858_1074305_+	molybdopterin-converting factor chain 2	NA	NA	NA	NA	NA
AXI20679.1|1074866_1076963_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
AXI20680.1|1076969_1077290_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AXI20681.1|1077387_1077981_+	recombination protein RecR	NA	NA	NA	NA	NA
AXI20682.1|1078082_1078433_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AXI20683.1|1078552_1079086_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20684.1|1079082_1081035_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20685.1|1081027_1081984_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
AXI20686.1|1081989_1082943_-	MoxR family ATPase	NA	NA	NA	NA	NA
AXI20687.1|1082981_1084850_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20688.1|1086365_1086881_+	peptide deformylase	NA	NA	NA	NA	NA
AXI23516.1|1088628_1089375_+	cellulase	NA	NA	NA	NA	NA
AXI20689.1|1089991_1091593_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
AXI20690.1|1091953_1092139_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20691.1|1092581_1093817_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
1094944:1094962	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
>prophage 10
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	1157637	1220044	4994045	transposase	Orpheovirus(25.0%)	53	NA	NA
AXI20743.1|1157637_1158435_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI20744.1|1158583_1158883_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AXI20745.1|1159011_1161183_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
AXI20746.1|1161262_1161643_+	RidA family protein	NA	NA	NA	NA	NA
AXI20747.1|1161663_1163817_+	DNA helicase RecG	NA	NA	NA	NA	NA
AXI20748.1|1163942_1164881_+	nucleoside hydrolase	NA	NA	NA	NA	NA
AXI20749.1|1164952_1165195_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AXI23524.1|1165408_1166698_+	citrate (Si)-synthase	NA	NA	NA	NA	NA
AXI20750.1|1167075_1167726_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20751.1|1168035_1170558_-	peptidase	NA	NA	NA	NA	NA
AXI20752.1|1170680_1171739_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
AXI20753.1|1171738_1172497_+	fimbrial protein	NA	NA	NA	NA	NA
AXI20754.1|1172493_1173159_+	fimbrial protein	NA	NA	NA	NA	NA
AXI20755.1|1173155_1173689_+	fimbrial protein	NA	NA	NA	NA	NA
AXI20756.1|1173708_1175658_+	type IV pilus secretin PilQ	NA	NA	NA	NA	NA
AXI20757.1|1175728_1176527_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI20758.1|1176669_1177905_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI20759.1|1178819_1179344_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20760.1|1180671_1181634_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
AXI20761.1|1181636_1182098_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
AXI20762.1|1182094_1183102_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20763.1|1183098_1184901_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20764.1|1184897_1186655_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20765.1|1186950_1187268_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20766.1|1187465_1188746_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AXI20767.1|1188965_1190966_+	transketolase	NA	NA	NA	NA	NA
AXI20768.1|1191216_1191771_+	outer membrane receptor protein	NA	NA	NA	NA	NA
AXI20769.1|1191784_1192501_-	endopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.7e-05
AXI20770.1|1192503_1193496_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
AXI20771.1|1193815_1196530_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI20772.1|1196649_1197825_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20773.1|1197959_1199918_-	acetyl-CoA hydrolase	NA	NA	NA	NA	NA
AXI23525.1|1200093_1200741_+	thermostable hemolysin	NA	NA	NA	NA	NA
AXI20774.1|1200737_1202237_+	long-chain acyl-CoA synthetase	NA	NA	NA	NA	NA
AXI20775.1|1202233_1202908_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
AXI20776.1|1202907_1203747_+	short chain dehydrogenase	NA	NA	NA	NA	NA
AXI20777.1|1203727_1203991_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20778.1|1204413_1205112_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
AXI23526.1|1205129_1206491_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AXI20779.1|1206590_1206956_+	transcriptional regulator	NA	NA	NA	NA	NA
AXI20780.1|1206945_1208262_+	energy transducer TonB	NA	NA	NA	NA	NA
AXI20781.1|1208258_1208843_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20782.1|1209185_1209800_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
AXI20783.1|1209799_1210492_-	molybdate ABC transporter permease	NA	NA	NA	NA	NA
AXI20784.1|1210502_1211279_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXI23527.1|1211349_1212180_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXI20785.1|1212193_1212967_-	endonuclease	NA	NA	NA	NA	NA
AXI20786.1|1212977_1213175_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20787.1|1216185_1216482_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23528.1|1216837_1217839_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AXI20788.1|1218199_1218646_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI23529.1|1218411_1218990_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI20789.1|1219045_1220044_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	1224622	1302694	4994045	transposase,protease	Xanthomonas_phage(46.15%)	58	NA	NA
AXI20791.1|1224622_1225606_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	2.2e-98
AXI20792.1|1225779_1227867_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20793.1|1228018_1228678_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AXI20794.1|1228758_1229556_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI20795.1|1229578_1229758_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20796.1|1229776_1230181_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20797.1|1230214_1230574_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20798.1|1230817_1231690_-	ion transporter	NA	NA	NA	NA	NA
AXI20799.1|1231762_1232989_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
AXI20800.1|1233234_1233852_-	hydrolase	NA	NA	NA	NA	NA
AXI20801.1|1235412_1236996_+	flavin monoamine oxidase	NA	NA	NA	NA	NA
AXI20802.1|1236992_1237418_+	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
AXI20803.1|1237442_1237946_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20804.1|1239388_1239838_+	azurin	NA	NA	NA	NA	NA
AXI20805.1|1243228_1244518_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AXI20806.1|1246528_1247983_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20807.1|1248479_1249349_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
AXI20808.1|1249370_1250042_-	hypothetical protein	NA	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
AXI20809.1|1250038_1250260_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AXI20810.1|1253664_1253964_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
AXI20811.1|1253967_1254162_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
AXI20812.1|1254430_1257742_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AXI20813.1|1257965_1258265_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	9.3e-45
AXI20814.1|1258268_1258463_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
AXI20815.1|1258731_1263156_-	avirulence protein	NA	NA	NA	NA	NA
AXI20816.1|1263379_1263679_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
AXI20817.1|1263682_1263877_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	94.1	3.9e-20
AXI20818.1|1264145_1267862_-	avirulence protein	NA	NA	NA	NA	NA
AXI23532.1|1268613_1268979_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20819.1|1269333_1270398_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
AXI20820.1|1270412_1270664_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23533.1|1270965_1272078_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
AXI20821.1|1272074_1272617_-	shikimate kinase	NA	NA	NA	NA	NA
AXI20822.1|1272783_1273383_+	pyridoxine/pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AXI20823.1|1273563_1273980_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20824.1|1273992_1274766_+	PspA-IM30 family protein	NA	NA	NA	NA	NA
AXI20825.1|1274791_1275874_+	potassium channel protein	NA	NA	NA	NA	NA
AXI20826.1|1275876_1276548_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20827.1|1276585_1276990_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
AXI20828.1|1277002_1277575_+	hypothetical protein	NA	A0A191ZBZ0	Erwinia_phage	27.7	1.1e-09
AXI20829.1|1277576_1278743_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.1	5.8e-74
AXI20830.1|1280033_1280243_-	MFS transporter	NA	NA	NA	NA	NA
AXI20831.1|1280722_1281169_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
AXI20832.1|1281388_1283395_+	peptidase M1	NA	NA	NA	NA	NA
AXI20833.1|1284453_1287600_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI23535.1|1287619_1287850_-	transcriptional regulator	NA	NA	NA	NA	NA
AXI23534.1|1287931_1288684_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AXI20834.1|1288694_1289741_+	cupin	NA	NA	NA	NA	NA
AXI20835.1|1289781_1291299_+	tryptophan halogenase	NA	A0A1D7SEI2	Cyanophage	32.3	8.1e-52
AXI20836.1|1291336_1292341_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXI20837.1|1292485_1292884_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20838.1|1293014_1293200_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20839.1|1293446_1294844_-|protease	serine protease	protease	NA	NA	NA	NA
AXI20840.1|1295298_1296681_-	amino acid permease	NA	NA	NA	NA	NA
AXI20841.1|1296873_1297638_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AXI20842.1|1297951_1298893_+	amino acid amidase	NA	NA	NA	NA	NA
AXI20843.1|1299648_1301037_+	amino acid transporter	NA	NA	NA	NA	NA
AXI20844.1|1301458_1302694_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 12
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	1344329	1425607	4994045	transposase,tRNA	Acinetobacter_phage(33.33%)	51	NA	NA
AXI20882.1|1344329_1345328_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI23540.1|1345629_1347006_+	signal recognition particle protein	NA	NA	NA	NA	NA
AXI20883.1|1348578_1349649_+	nitronate monooxygenase	NA	NA	NA	NA	NA
AXI20884.1|1349639_1350437_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20885.1|1350546_1350804_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AXI20886.1|1350847_1351360_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AXI20887.1|1351425_1352205_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AXI20888.1|1352328_1352736_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AXI23541.1|1353361_1354852_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AXI23542.1|1355192_1355600_+	RNA-binding protein	NA	NA	NA	NA	NA
AXI20889.1|1355734_1355995_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI20890.1|1356019_1357234_+|transposase	IS4/IS5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
AXI20891.1|1358559_1358835_-	glutathione transferase	NA	NA	NA	NA	NA
AXI20892.1|1358864_1359170_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20893.1|1359615_1362201_+	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
AXI20894.1|1362325_1363237_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20895.1|1366480_1368358_+	TonB-dependent vitamin B12 receptor	NA	A0A0P0I887	Acinetobacter_phage	29.5	4.9e-06
AXI20896.1|1370130_1370724_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23543.1|1370723_1371323_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20897.1|1371319_1371931_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AXI20898.1|1372444_1372966_+	adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase	NA	NA	NA	NA	NA
AXI20899.1|1372962_1374009_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AXI20900.1|1374005_1374596_+	fructose-2,6-bisphosphatase	NA	NA	NA	NA	NA
AXI23544.1|1374592_1375327_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AXI20901.1|1375501_1376698_-	siderophore biosynthesis PLP-dependent protein	NA	NA	NA	NA	NA
AXI20902.1|1376694_1378464_-	iron transporter	NA	NA	NA	NA	NA
AXI23545.1|1379633_1381436_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
AXI20903.1|1381432_1382659_-	siderophore biosynthesis protein PvsA	NA	NA	NA	NA	NA
AXI20904.1|1382894_1385036_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AXI20905.1|1385036_1385798_-	4-hydroxy-2-oxovalerate aldolase	NA	NA	NA	NA	NA
AXI20906.1|1387207_1388905_-	Kef family K(+) transporter	NA	NA	NA	NA	NA
AXI20907.1|1390003_1392403_-	ferric enterobactin receptor	NA	A0A0P0I887	Acinetobacter_phage	33.3	6.4e-11
AXI20908.1|1392735_1395123_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.9	9.2e-10
AXI20909.1|1395396_1395837_-	glyoxalase	NA	NA	NA	NA	NA
AXI20910.1|1396300_1398688_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.7	7.1e-10
AXI20911.1|1398863_1400780_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	30.5	1.2e-65
AXI20912.1|1401051_1401477_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20913.1|1401500_1402376_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.4	2.0e-15
AXI20914.1|1403457_1404303_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXI20915.1|1406911_1407703_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXI20916.1|1408464_1409895_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXI20917.1|1410107_1411976_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.0	9.7e-15
AXI20918.1|1412000_1414325_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20919.1|1416480_1416960_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.2	1.2e-41
AXI23546.1|1417114_1418299_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
AXI23547.1|1418390_1419743_-	glutamine synthetase	NA	NA	NA	NA	NA
AXI20920.1|1419808_1420744_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
AXI20921.1|1420810_1421410_-	LysE family translocator	NA	NA	NA	NA	NA
AXI23548.1|1421444_1422305_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
AXI23549.1|1422322_1423363_-	dihydrorhizobitoxine desaturase	NA	NA	NA	NA	NA
AXI20922.1|1424638_1425607_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 13
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	1470928	1535795	4994045	transposase	uncultured_Caudovirales_phage(44.44%)	49	NA	NA
AXI20964.1|1470928_1471927_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI20965.1|1472306_1472984_+	HAD family hydrolase	NA	NA	NA	NA	NA
AXI20966.1|1473521_1473746_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20967.1|1473745_1475818_-	carbon starvation protein A	NA	NA	NA	NA	NA
AXI20968.1|1476049_1476907_+	pirin family protein	NA	NA	NA	NA	NA
AXI23552.1|1477942_1480345_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
AXI20969.1|1480399_1481260_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20970.1|1481220_1481907_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23553.1|1481896_1483309_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20971.1|1483318_1485742_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	3.1e-37
AXI20972.1|1485738_1486686_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23554.1|1487679_1488228_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20973.1|1488508_1489180_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20974.1|1491358_1493260_+	type VI secretion protein	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.2e-30
AXI20975.1|1493314_1494175_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20976.1|1494135_1494822_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20977.1|1495285_1495519_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXI23555.1|1495739_1496306_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20978.1|1496508_1497096_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23556.1|1497403_1497883_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20979.1|1497879_1500288_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20980.1|1500632_1501094_-	hypothetical protein	NA	NA	NA	NA	NA
AXI20981.1|1501340_1502231_-	pirin family protein	NA	NA	NA	NA	NA
AXI20982.1|1502408_1502684_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23557.1|1502998_1503712_-	endonuclease V	NA	NA	NA	NA	NA
AXI20983.1|1503815_1504565_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AXI20984.1|1504925_1505177_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20985.1|1505509_1507567_+	peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.2e-79
AXI20986.1|1508272_1509346_+	cardiolipin synthase	NA	NA	NA	NA	NA
AXI23558.1|1509514_1510636_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AXI20987.1|1510650_1511478_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXI20988.1|1511461_1512745_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AXI20989.1|1512771_1513287_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXI20990.1|1513297_1515454_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
AXI20991.1|1515521_1517519_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AXI20992.1|1517537_1517867_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
AXI20993.1|1518356_1521821_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AXI20994.1|1522223_1522766_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXI23559.1|1523177_1524086_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AXI20995.1|1524431_1525230_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI20996.1|1525373_1526093_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AXI20997.1|1527303_1528116_-	peptidase C1	NA	NA	NA	NA	NA
AXI20998.1|1528851_1529235_+	hypothetical protein	NA	NA	NA	NA	NA
AXI20999.1|1529393_1530563_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
AXI21000.1|1530557_1531616_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
AXI23560.1|1531676_1532489_-	peptidase C1	NA	NA	NA	NA	NA
AXI21001.1|1533004_1533388_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21002.1|1533573_1534737_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
AXI21003.1|1534826_1535795_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 14
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	1555612	1635528	4994045	transposase	Bacillus_virus(13.33%)	55	NA	NA
AXI21021.1|1555612_1557553_+	asparagine synthetase B	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
AXI21022.1|1557769_1558324_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
AXI21023.1|1558545_1559976_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
AXI21024.1|1560042_1561497_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	5.7e-47
AXI23563.1|1561724_1561904_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21025.1|1561913_1562639_+	OmpA family lipoprotein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
AXI21026.1|1562815_1563148_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AXI21027.1|1563199_1564156_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
AXI21028.1|1564399_1566781_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI21029.1|1567171_1569007_-	ligand-gated channel	NA	NA	NA	NA	NA
AXI23564.1|1568987_1569173_-	outer membrane hemin receptor	NA	NA	NA	NA	NA
AXI23565.1|1569434_1569845_+	MerC domain-containing protein	NA	NA	NA	NA	NA
AXI21030.1|1570144_1570327_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
AXI21031.1|1570459_1571500_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AXI21032.1|1571572_1573018_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
AXI21033.1|1574548_1575517_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI21034.1|1575729_1577166_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI21035.1|1577344_1577890_-	cysteine methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
AXI21036.1|1577886_1579350_-	DNA methylase	NA	NA	NA	NA	NA
AXI21037.1|1579572_1580418_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23566.1|1580428_1580734_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21038.1|1580810_1581065_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21039.1|1581467_1582001_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21040.1|1582026_1582428_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21041.1|1582776_1583019_-	RNA-binding protein	NA	NA	NA	NA	NA
AXI21042.1|1583734_1584031_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXI23567.1|1592589_1593087_+	ribonuclease activity regulator protein RraA	NA	NA	NA	NA	NA
AXI21043.1|1594841_1595492_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21044.1|1595612_1595810_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21045.1|1603171_1603717_-	cysteine methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
AXI21046.1|1603713_1605177_-	DNA methylase	NA	NA	NA	NA	NA
AXI21047.1|1605399_1606245_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23568.1|1606255_1606561_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21048.1|1606636_1606891_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21049.1|1607293_1607827_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21050.1|1607852_1608254_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21051.1|1608602_1608845_-	RNA-binding protein	NA	NA	NA	NA	NA
AXI21052.1|1609560_1609857_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXI21053.1|1610206_1612111_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
AXI21054.1|1612374_1614771_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
AXI21055.1|1614920_1615643_+	23S rRNA pseudouridine synthase F	NA	NA	NA	NA	NA
AXI21056.1|1618562_1619063_+	ribonuclease activity regulator protein RraA	NA	NA	NA	NA	NA
AXI21057.1|1619004_1620681_+	serine hydrolase	NA	NA	NA	NA	NA
AXI21058.1|1620827_1622093_+	cation/H(+) antiporter	NA	NA	NA	NA	NA
AXI21059.1|1622151_1623345_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.3	4.0e-22
AXI21060.1|1623341_1624031_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
AXI21061.1|1624136_1625606_+	outer membrane channel protein	NA	NA	NA	NA	NA
AXI21062.1|1625625_1626462_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
AXI21063.1|1626487_1627591_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXI21064.1|1627587_1630644_+	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AXI21065.1|1630709_1631300_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AXI21066.1|1631431_1633264_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
AXI23569.1|1633339_1633918_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI21067.1|1633683_1634130_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI21068.1|1634145_1635528_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 15
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	1641792	1704983	4994045	transposase,tRNA	Ralstonia_phage(28.57%)	53	NA	NA
AXI21070.1|1641792_1642761_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI21071.1|1645050_1645419_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21072.1|1645588_1646557_-|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI21073.1|1646652_1646913_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI21074.1|1646988_1647174_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21075.1|1647248_1648205_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	1.1e-41
AXI21076.1|1648083_1648491_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21077.1|1649051_1650464_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI21078.1|1650441_1651050_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
AXI21079.1|1651063_1651927_-	prepilin peptidase	NA	NA	NA	NA	NA
AXI23570.1|1651933_1653193_-	type II secretory pathway protein	NA	NA	NA	NA	NA
AXI21080.1|1653547_1653973_+	pilin	NA	NA	NA	NA	NA
AXI21081.1|1654107_1655697_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21082.1|1655677_1656337_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21083.1|1657866_1659600_+	type IV-A pilus assembly ATPase PilB	NA	NA	NA	NA	NA
AXI21084.1|1659608_1659944_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
AXI21085.1|1660179_1660386_-	DUF2559 domain-containing protein	NA	NA	NA	NA	NA
AXI21086.1|1660458_1661850_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXI21087.1|1662180_1663794_-	sensor histidine kinase	NA	NA	NA	NA	NA
AXI21088.1|1664027_1665197_+	succinyl-CoA ligase subunit beta	NA	NA	NA	NA	NA
AXI21089.1|1665221_1666097_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
AXI21090.1|1666416_1666713_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21091.1|1667141_1668800_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.0	1.2e-93
AXI21092.1|1668957_1669839_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AXI21093.1|1669959_1670955_+	23S rRNA pseudouridine(1911/1915/1917) synthase	NA	NA	NA	NA	NA
AXI21094.1|1670962_1671769_+	multi-copper polyphenol oxidoreductase	NA	NA	NA	NA	NA
AXI23571.1|1671789_1672296_+	DUF4166 domain-containing protein	NA	NA	NA	NA	NA
AXI21095.1|1672900_1674268_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AXI21096.1|1674264_1676043_-	glucoamylase	NA	NA	NA	NA	NA
AXI21097.1|1676087_1676846_-	trehalose-phosphatase	NA	NA	NA	NA	NA
AXI21098.1|1678167_1680603_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	22.5	2.6e-12
AXI21099.1|1680838_1681312_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21100.1|1681407_1682484_-	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
AXI21101.1|1682929_1684531_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21102.1|1684527_1684728_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21103.1|1684835_1686167_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AXI21104.1|1686120_1687035_-	arginyltransferase	NA	NA	NA	NA	NA
AXI21105.1|1687095_1687677_+	calcium-binding protein	NA	NA	NA	NA	NA
AXI21106.1|1687719_1688517_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI23572.1|1688662_1689118_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21107.1|1690227_1690731_-	pathogenicity-like protein	NA	NA	NA	NA	NA
AXI21108.1|1690958_1691864_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
AXI21109.1|1691934_1692705_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
AXI21110.1|1692728_1693193_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21111.1|1693306_1693714_-	thioesterase	NA	NA	NA	NA	NA
AXI21112.1|1693710_1696677_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.8	3.3e-307
AXI21113.1|1696969_1697290_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
AXI21114.1|1697302_1697563_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
AXI21115.1|1697795_1698848_+	GTPase ObgE	NA	NA	NA	NA	NA
AXI21116.1|1698939_1699209_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AXI21117.1|1699325_1700930_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
AXI21118.1|1701128_1702145_+	bifunctional riboflavin kinase/FMN adenylyltransferase	NA	NA	NA	NA	NA
AXI21119.1|1702151_1704983_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
>prophage 16
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	1724398	1794336	4994045	transposase,tRNA	Hokovirus(11.11%)	49	NA	NA
AXI21129.1|1724398_1724680_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI21130.1|1729991_1730588_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21131.1|1735046_1735250_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21132.1|1735327_1737949_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.7	6.7e-30
AXI21133.1|1740853_1742248_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AXI21134.1|1743633_1745190_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23574.1|1745453_1746380_-	phospholipase	NA	NA	NA	NA	NA
AXI21135.1|1746370_1746922_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21136.1|1746940_1747603_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21137.1|1747773_1749012_-	MFS transporter	NA	NA	NA	NA	NA
AXI21138.1|1749452_1749746_+	transcriptional regulator	NA	NA	NA	NA	NA
AXI21139.1|1750243_1751020_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21140.1|1751177_1752944_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AXI21141.1|1753455_1753983_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXI21142.1|1754082_1754760_+	cobalamin adenosyltransferase	NA	NA	NA	NA	NA
AXI21143.1|1754849_1755578_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXI21144.1|1755692_1756217_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
AXI21145.1|1756374_1756959_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AXI21146.1|1757158_1759066_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.1	3.4e-79
AXI21147.1|1759194_1760232_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
AXI21148.1|1760284_1760743_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
AXI21149.1|1760754_1761534_+	protein TolQ	NA	NA	NA	NA	NA
AXI21150.1|1761690_1762140_+	protein TolR	NA	NA	NA	NA	NA
AXI21151.1|1762129_1763170_+	protein TolA	NA	NA	NA	NA	NA
AXI21152.1|1763429_1764749_+	protein TolB	NA	NA	NA	NA	NA
AXI21153.1|1764806_1765325_+	peptidoglycan-associated lipoprotein	NA	NA	NA	NA	NA
AXI21154.1|1765331_1766150_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
AXI21155.1|1766192_1766876_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.5	1.5e-37
AXI21156.1|1767709_1767820_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21157.1|1768109_1768820_-	RNA-binding protein	NA	NA	NA	NA	NA
AXI21158.1|1769054_1769261_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21159.1|1771054_1771633_-	amino acid transporter	NA	NA	NA	NA	NA
AXI21160.1|1774168_1775404_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI23575.1|1775454_1776033_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI21161.1|1775798_1776245_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI21162.1|1776284_1777661_-|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
AXI21163.1|1778039_1778714_+	7-cyano-7-deazaguanine synthase	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
AXI21164.1|1779344_1779749_-	response regulator	NA	NA	NA	NA	NA
AXI21165.1|1779827_1780325_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21166.1|1780463_1782260_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
AXI21167.1|1782372_1782600_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21168.1|1782814_1783360_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
AXI21169.1|1783461_1787583_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
AXI21170.1|1787803_1790446_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI23576.1|1790547_1790772_-	glucose kinase	NA	NA	NA	NA	NA
AXI21171.1|1790815_1791088_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21172.1|1791887_1793402_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
AXI21173.1|1793545_1793992_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI23577.1|1793757_1794336_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 17
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	2135482	2265758	4994045	transposase,tRNA,protease	Ralstonia_phage(21.74%)	101	NA	NA
AXI21410.1|2135482_2136877_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI21411.1|2137136_2138063_-	multidrug transporter	NA	NA	NA	NA	NA
AXI21412.1|2138192_2138798_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXI21413.1|2139136_2140906_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	3.0e-58
AXI23602.1|2140902_2141496_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
AXI21414.1|2141763_2142357_-	Rossman fold protein, TIGR00730 family	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
AXI21415.1|2142555_2143992_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
AXI21416.1|2144233_2145436_-	dihydrolipoamide succinyltransferase	NA	NA	NA	NA	NA
AXI21417.1|2145478_2148307_-	2-oxoglutarate dehydrogenase subunit E1	NA	NA	NA	NA	NA
AXI21418.1|2148487_2149420_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXI21419.1|2149416_2150916_-	transcriptional regulator	NA	NA	NA	NA	NA
AXI23603.1|2151253_2151517_+|protease	serine protease	protease	NA	NA	NA	NA
AXI21420.1|2151796_2152297_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21421.1|2152538_2153906_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
AXI21422.1|2156911_2157349_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXI23604.1|2157114_2157693_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23605.1|2159144_2160548_+	class II fumarate hydratase	NA	NA	NA	NA	NA
AXI21423.1|2160670_2161093_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21424.1|2161478_2161772_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21425.1|2161725_2162562_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21426.1|2162571_2163558_-	ABC transporter permease	NA	NA	NA	NA	NA
AXI21427.1|2163554_2164430_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
AXI21428.1|2164426_2164789_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXI21429.1|2164791_2165040_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21430.1|2165175_2165733_+	glutathione peroxidase	NA	NA	NA	NA	NA
AXI21431.1|2165824_2166790_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXI21432.1|2166815_2168165_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
AXI21433.1|2168157_2168394_+	protein SlyX	NA	NA	NA	NA	NA
AXI21434.1|2168394_2169147_+	nucleoprotein/polynucleotide-associated enzyme	NA	NA	NA	NA	NA
AXI21435.1|2169480_2170326_+	transporter	NA	NA	NA	NA	NA
AXI23606.1|2170466_2171642_+	transcriptional regulator	NA	NA	NA	NA	NA
AXI21436.1|2171655_2172966_+	MFS transporter	NA	NA	NA	NA	NA
AXI21437.1|2172890_2173949_+	carbohydrate kinase	NA	NA	NA	NA	NA
AXI21438.1|2173945_2175151_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
AXI21439.1|2175537_2178291_-	methionine synthase	NA	NA	NA	NA	NA
AXI21440.1|2178433_2179573_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
AXI21441.1|2179569_2180565_-	ArsR family transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
AXI23607.1|2180686_2181835_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXI21442.1|2181834_2181975_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXI23608.1|2182168_2182393_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21443.1|2182346_2183792_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
AXI21444.1|2184358_2186887_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
AXI21445.1|2187097_2187896_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI23609.1|2188304_2188634_+	aldehyde-activating protein	NA	NA	NA	NA	NA
AXI21446.1|2188966_2189728_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AXI21447.1|2189733_2190180_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI23610.1|2189945_2190524_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21448.1|2190551_2190899_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21449.1|2191057_2192026_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
AXI21450.1|2193378_2194377_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI21451.1|2194426_2194678_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23611.1|2194788_2195973_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXI21452.1|2196027_2197503_-|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
AXI21453.1|2197824_2198007_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21454.1|2198155_2199355_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AXI21455.1|2200215_2201184_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
AXI21456.1|2201396_2202815_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI21457.1|2202852_2203821_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXI21458.1|2203931_2204114_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI21459.1|2204100_2204899_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI21460.1|2205091_2206090_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI21461.1|2208319_2209318_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI21462.1|2210086_2210314_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21463.1|2210316_2211285_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI21464.1|2212108_2212465_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23612.1|2213750_2214218_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21465.1|2214578_2215343_-	energy transducer TonB	NA	NA	NA	NA	NA
AXI21466.1|2215349_2216699_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
AXI21467.1|2216848_2217647_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI21468.1|2218008_2219406_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI21469.1|2219618_2220587_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXI21470.1|2220650_2221235_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AXI21471.1|2221334_2222348_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXI21472.1|2227454_2227754_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
AXI21473.1|2227757_2227952_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
AXI21474.1|2235209_2239337_-	avirulence protein	NA	NA	NA	NA	NA
AXI23613.1|2239625_2241047_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI21475.1|2242776_2243862_-	peptidase C13	NA	NA	NA	NA	NA
AXI21476.1|2244189_2244888_-	acireductone synthase	NA	NA	NA	NA	NA
AXI21477.1|2244890_2245457_-	acireductone dioxygenase	NA	NA	NA	NA	NA
AXI21478.1|2245468_2246146_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
AXI21479.1|2246234_2247665_-	amino acid permease	NA	NA	NA	NA	NA
AXI21480.1|2247741_2249223_-	amino acid permease	NA	NA	NA	NA	NA
AXI21481.1|2249359_2249947_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AXI21482.1|2250102_2251344_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
AXI21483.1|2251552_2252971_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXI21484.1|2253005_2253305_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21485.1|2253301_2255173_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21486.1|2255060_2255330_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21487.1|2255462_2256482_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AXI23614.1|2256475_2256886_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AXI21488.1|2256903_2257464_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AXI23615.1|2257497_2259435_-	c-type cytochrome biogenesis protein CcmF	NA	NA	NA	NA	NA
AXI21489.1|2259603_2260074_-	cytochrome c-type biogenesis protein CcmE 2	NA	NA	NA	NA	NA
AXI21490.1|2260070_2260241_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
AXI21491.1|2260237_2260990_-	heme ABC transporter permease	NA	NA	NA	NA	NA
AXI21492.1|2261084_2261780_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
AXI21493.1|2261776_2262421_-	cytochrome c biogenesis ATP-binding export protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
AXI21494.1|2262647_2263796_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AXI21495.1|2263935_2264739_+	amidohydrolase	NA	NA	NA	NA	NA
AXI21496.1|2264759_2265758_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 18
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	2366372	2477800	4994045	transposase,tRNA	Xanthomonas_phage(63.16%)	105	NA	NA
AXI21571.1|2366372_2367785_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
AXI21572.1|2368297_2369096_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI21573.1|2369409_2369736_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXI21574.1|2369745_2370660_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
AXI21575.1|2370656_2371952_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
AXI21576.1|2371948_2373040_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AXI21577.1|2373036_2374164_+	bifunctional imidazole glycerol-phosphate dehydratase/histidinol phosphatase	NA	NA	NA	NA	NA
AXI21578.1|2374160_2374763_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AXI21579.1|2374759_2375494_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AXI21580.1|2375487_2376264_+	imidazole glycerol phosphate synthase cyclase subunit	NA	NA	NA	NA	NA
AXI21581.1|2376253_2376874_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
AXI21582.1|2376962_2377370_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21583.1|2377459_2381314_-	avirulence protein	NA	NA	NA	NA	NA
AXI21584.1|2381538_2381838_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
AXI21585.1|2381841_2382036_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
AXI21586.1|2386953_2387055_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21587.1|2387245_2387668_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21588.1|2387807_2387993_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
AXI21589.1|2387992_2388196_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
AXI21590.1|2388331_2389405_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
AXI21591.1|2389509_2389809_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
AXI21592.1|2390172_2390412_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21593.1|2390548_2392003_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	4.0e-40
AXI21594.1|2392004_2392325_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21595.1|2392321_2393506_+	zonular occludens toxin family protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	5.2e-54
AXI21596.1|2393502_2393733_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	55.6	2.0e-10
AXI21597.1|2393796_2394198_+	DUF4124 domain-containing protein	NA	A0A077JCA3	Xanthomonas_phage	64.3	3.9e-38
AXI21598.1|2394137_2394452_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.7	8.1e-15
AXI21599.1|2394878_2395103_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21600.1|2395302_2395686_+	hypothetical protein	NA	A0A1D6ZIV0	Xanthomonas_phage	100.0	1.7e-70
AXI21601.1|2395857_2396505_-	conjugal transfer protein	NA	A0A1D6ZIU7	Xanthomonas_phage	100.0	3.0e-120
AXI21602.1|2396506_2397694_-	hypothetical protein	NA	A0A1D6ZIU8	Xanthomonas_phage	100.0	2.8e-217
AXI21603.1|2397693_2398023_-	hypothetical protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
AXI21604.1|2398022_2399471_-	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	100.0	1.3e-253
AXI21605.1|2399565_2399796_-	methyltransferase	NA	A0A1D6ZIT7	Xanthomonas_phage	100.0	1.7e-30
AXI21606.1|2399807_2400011_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
AXI21607.1|2400014_2400311_-	DNA-binding protein	NA	A0A1D6ZIU6	Xanthomonas_phage	100.0	3.6e-49
AXI23623.1|2400307_2401348_-	replication initiation protein	NA	A0A1D6ZIT9	Xanthomonas_phage	100.0	8.2e-205
AXI21608.1|2401500_2401713_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	98.6	1.1e-26
AXI21609.1|2401712_2401898_-	hypothetical protein	NA	A0A1D6ZIV1	Xanthomonas_phage	100.0	1.4e-27
AXI21610.1|2402778_2402961_-	antitoxin	NA	NA	NA	NA	NA
AXI21611.1|2403082_2403295_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21612.1|2403436_2403883_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI21613.1|2403840_2404227_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI21614.1|2404559_2405528_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI21615.1|2405788_2406214_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21616.1|2406610_2406853_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21617.1|2406827_2407340_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21618.1|2407442_2407889_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI23624.1|2407654_2408233_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21619.1|2408682_2409090_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21620.1|2413518_2413713_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
AXI21621.1|2413716_2414016_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
AXI21622.1|2414239_2417995_+	avirulence protein	NA	NA	NA	NA	NA
AXI21623.1|2418057_2418504_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI21624.1|2418461_2418848_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI21625.1|2419078_2419273_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
AXI21626.1|2419276_2419576_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
AXI21627.1|2423989_2424211_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AXI21628.1|2424207_2424879_+	hypothetical protein	NA	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
AXI21629.1|2426133_2427090_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXI21630.1|2427754_2428816_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
AXI21631.1|2429664_2430663_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI21632.1|2430640_2434741_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AXI23625.1|2435049_2436234_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXI21633.1|2436284_2437184_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
AXI21634.1|2437350_2437857_+	glyoxalase	NA	NA	NA	NA	NA
AXI21635.1|2438331_2438964_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AXI21636.1|2438963_2440820_-	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AXI21637.1|2440816_2442316_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21638.1|2442258_2442723_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AXI23626.1|2442719_2443520_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AXI21639.1|2443789_2444830_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AXI21640.1|2444826_2446596_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
AXI21641.1|2446592_2447057_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXI21642.1|2447060_2447723_-	biopolymer transporter ExbB	NA	NA	NA	NA	NA
AXI21643.1|2447751_2450160_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
AXI21644.1|2450380_2451379_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI21645.1|2452589_2452772_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21646.1|2452772_2453507_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
AXI21647.1|2453499_2454741_-	lipoprotein-releasing system transmembrane subunit LolC	NA	NA	NA	NA	NA
AXI21648.1|2454764_2455217_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21649.1|2455167_2455416_-	succinate dehydrogenase assembly factor 2 family protein	NA	NA	NA	NA	NA
AXI21650.1|2455526_2456309_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AXI21651.1|2456325_2456535_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21652.1|2456538_2458329_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AXI21653.1|2458363_2458750_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
AXI21654.1|2458746_2459142_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
AXI21655.1|2459201_2459468_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
AXI21656.1|2459411_2460284_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
AXI21657.1|2460412_2461510_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
AXI21658.1|2461942_2463373_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
AXI21659.1|2464372_2465092_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AXI21660.1|2465194_2467111_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AXI21661.1|2467166_2467826_+	2-dehydro-3-deoxyphosphogluconate aldolase	NA	NA	NA	NA	NA
AXI21662.1|2468046_2469423_+|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.3e-77
AXI23627.1|2469456_2470035_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI21663.1|2469800_2470247_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI21664.1|2470262_2470466_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21665.1|2470462_2470894_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21666.1|2471481_2471862_+	response regulator	NA	NA	NA	NA	NA
AXI21667.1|2472075_2475471_+	histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
AXI21668.1|2475681_2475891_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21669.1|2477009_2477456_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI23628.1|2477221_2477800_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 19
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	2591873	2712651	4994045	transposase,tRNA	uncultured_Mediterranean_phage(27.78%)	105	NA	NA
AXI21732.1|2591873_2593268_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
AXI21733.1|2593269_2593527_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21734.1|2593523_2593829_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21735.1|2593825_2594152_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21736.1|2594878_2595541_+	carbonic anhydrase	NA	NA	NA	NA	NA
AXI23641.1|2595629_2596160_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
AXI21737.1|2598383_2599655_+	kynureninase	NA	NA	NA	NA	NA
AXI21738.1|2599826_2601194_+	kynurenine 3-monooxygenase	NA	NA	NA	NA	NA
AXI21739.1|2601497_2602943_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AXI21740.1|2602939_2603626_+	TIGR02453 family protein	NA	NA	NA	NA	NA
AXI21741.1|2603598_2604618_+	aldo/keto reductase	NA	NA	NA	NA	NA
AXI21742.1|2604659_2605220_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21743.1|2605240_2606197_-	5'-nucleotidase	NA	NA	NA	NA	NA
AXI23642.1|2606364_2607141_-	NAD(+) kinase	NA	NA	NA	NA	NA
AXI21744.1|2607624_2609760_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AXI21745.1|2609756_2609948_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21746.1|2611722_2612229_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXI21747.1|2612269_2612797_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXI21748.1|2612793_2613285_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AXI21749.1|2613308_2613884_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AXI21750.1|2613960_2614914_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21751.1|2615002_2615875_-	sulfurtransferase	NA	NA	NA	NA	NA
AXI23643.1|2615871_2616639_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
AXI21752.1|2616829_2617528_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXI21753.1|2617691_2618474_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AXI21754.1|2618482_2618863_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21755.1|2618859_2619570_+	endonuclease III	NA	NA	NA	NA	NA
AXI21756.1|2620880_2621429_-	carbonate dehydratase	NA	NA	NA	NA	NA
AXI21757.1|2621600_2622569_-|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI21758.1|2622715_2623102_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI21759.1|2623173_2624409_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI21760.1|2624412_2624826_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21761.1|2624972_2625293_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21762.1|2625632_2626883_+	porin	NA	NA	NA	NA	NA
AXI23644.1|2627017_2628091_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.4	5.0e-48
AXI21763.1|2628278_2629370_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
AXI21764.1|2629482_2630457_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AXI21765.1|2630456_2631326_+	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AXI21766.1|2631348_2632179_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
AXI21767.1|2632307_2633018_+	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AXI21768.1|2633150_2633564_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21769.1|2633841_2634483_+	ribonuclease T	NA	NA	NA	NA	NA
AXI23645.1|2634424_2635873_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI21770.1|2636109_2637171_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXI23646.1|2637221_2638406_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXI21771.1|2638601_2639975_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI21772.1|2642662_2643025_+	recombinase	NA	NA	NA	NA	NA
AXI21773.1|2643105_2644074_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.3	1.4e-28
AXI21774.1|2644168_2646013_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AXI21775.1|2646209_2646563_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AXI21776.1|2646694_2647840_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
AXI23647.1|2647909_2648980_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AXI21777.1|2649166_2649598_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AXI21778.1|2649721_2651218_+	lysine 6-aminotransferase	NA	NA	NA	NA	NA
AXI21779.1|2651177_2651492_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21780.1|2651562_2652270_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21781.1|2652660_2652948_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21782.1|2653164_2653473_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21783.1|2655603_2656725_-	phytase	NA	NA	NA	NA	NA
AXI21784.1|2656721_2658968_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI21785.1|2658997_2659465_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI23648.1|2659615_2660248_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AXI21786.1|2660617_2661064_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI21787.1|2661021_2661408_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI21788.1|2661687_2662719_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXI21789.1|2662725_2664519_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AXI21790.1|2664515_2664800_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
AXI23649.1|2664790_2664973_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23650.1|2665031_2665517_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21791.1|2665575_2666082_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
AXI21792.1|2666078_2666699_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AXI21793.1|2666939_2668844_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
AXI21794.1|2670011_2671406_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI21795.1|2671639_2672797_+	molybdopterin biosynthesis protein MoeB	NA	NA	NA	NA	NA
AXI21796.1|2672793_2672940_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21797.1|2673040_2674039_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI21798.1|2675527_2675887_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21799.1|2678031_2679000_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI21800.1|2679267_2679507_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21801.1|2679576_2679774_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXI21802.1|2681381_2682602_-	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AXI21803.1|2682916_2684314_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AXI21804.1|2684324_2685545_-	outer membrane assembly lipoprotein YfgL	NA	NA	NA	NA	NA
AXI21805.1|2685541_2686180_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21806.1|2686250_2687111_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21807.1|2687107_2687896_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
AXI21808.1|2687906_2689112_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
AXI21809.1|2689130_2689556_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
AXI21810.1|2689775_2690408_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXI21811.1|2690432_2692805_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXI21812.1|2692962_2694168_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AXI21813.1|2694488_2695820_+	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
AXI21814.1|2695816_2696167_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21815.1|2696198_2696606_+	fluoride ion transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
AXI21816.1|2696602_2696929_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23651.1|2696960_2698337_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.1	8.9e-74
AXI21817.1|2698573_2702740_+	type III effector	NA	NA	NA	NA	NA
AXI23652.1|2702852_2703482_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AXI21818.1|2703588_2705517_-	transglutaminase	NA	NA	NA	NA	NA
AXI21819.1|2705679_2708040_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
AXI21820.1|2708323_2709292_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
AXI21821.1|2709349_2710471_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXI21822.1|2711135_2711330_+	cinnamoyl-CoA reductase	NA	NA	NA	NA	NA
AXI21823.1|2711363_2711765_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23653.1|2711898_2712651_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 20
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	2799510	2868385	4994045	transposase,tRNA	Ralstonia_phage(46.15%)	50	NA	NA
AXI23658.1|2799510_2800884_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI21899.1|2801033_2802002_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXI21900.1|2802096_2802522_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21901.1|2802544_2803606_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AXI21902.1|2803745_2808986_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.8	1.6e-09
AXI21903.1|2809015_2809765_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21904.1|2809916_2810885_-|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI21905.1|2812948_2813917_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXI21906.1|2815682_2815874_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23659.1|2824145_2824538_+	cytochrome C	NA	NA	NA	NA	NA
AXI21907.1|2824546_2825008_+	cytochrome C biogenesis protein CcsA	NA	NA	NA	NA	NA
AXI21908.1|2825512_2825773_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21909.1|2825848_2826091_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21910.1|2826333_2826519_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23660.1|2826561_2826738_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21911.1|2827497_2828496_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI21912.1|2828502_2829648_+	DDE endonuclease	NA	NA	NA	NA	NA
AXI21913.1|2829772_2830741_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	9.6e-99
AXI23661.1|2832809_2834546_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	1.8e-15
AXI21914.1|2835062_2836019_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
AXI21915.1|2836178_2837147_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI21916.1|2837903_2838014_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
AXI21917.1|2838234_2839500_+	MFS transporter	NA	NA	NA	NA	NA
AXI21918.1|2839480_2841394_-	glutaryl-7-ACA acylase	NA	NA	NA	NA	NA
AXI21919.1|2841761_2843006_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
AXI21920.1|2843170_2844325_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
AXI21921.1|2844338_2844599_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21922.1|2844598_2844967_-	cupin	NA	NA	NA	NA	NA
AXI21923.1|2844963_2846259_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AXI21924.1|2846382_2847333_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AXI21925.1|2847945_2849289_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AXI21926.1|2849328_2850429_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
AXI21927.1|2850434_2850887_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXI21928.1|2851128_2852370_-	argininosuccinate synthase	NA	NA	NA	NA	NA
AXI21929.1|2852441_2853467_-	acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
AXI21930.1|2853779_2854274_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21931.1|2854444_2855875_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
AXI21932.1|2856372_2856810_+	Fe-S cluster assembly protein SufE	NA	NA	NA	NA	NA
AXI21933.1|2856806_2858057_+	MFS transporter	NA	NA	NA	NA	NA
AXI21934.1|2858124_2859186_-	peptidase S41	NA	NA	NA	NA	NA
AXI21935.1|2859328_2860369_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AXI21936.1|2860459_2860741_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
AXI21937.1|2860737_2862087_+	dihydroorotase	NA	NA	NA	NA	NA
AXI21938.1|2862026_2862926_+	peptidase M23	NA	A0A075BS18	Microcystis_phage	41.2	2.6e-13
AXI21939.1|2863824_2864244_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXI23662.1|2864009_2864588_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI21940.1|2864613_2864877_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21941.1|2865248_2865737_-	general stress protein	NA	NA	NA	NA	NA
AXI21942.1|2865960_2867379_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI21943.1|2867416_2868385_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
>prophage 21
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	2901732	2944961	4994045	protease,tRNA,transposase	Wolbachia_phage(14.29%)	36	NA	NA
AXI21970.1|2901732_2902611_-|protease	protease HtpX	protease	NA	NA	NA	NA
AXI21971.1|2902708_2903608_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AXI21972.1|2903695_2904436_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AXI23665.1|2904595_2905171_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
AXI21973.1|2905344_2906316_-	TraB/GumN family protein	NA	NA	NA	NA	NA
AXI21974.1|2906349_2907291_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21975.1|2907290_2909168_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
AXI21976.1|2909305_2911039_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
AXI21977.1|2911091_2911592_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AXI21978.1|2911588_2913076_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AXI21979.1|2913100_2914168_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AXI23666.1|2914282_2914861_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI21980.1|2914626_2915073_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI21981.1|2915129_2916467_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
AXI21982.1|2916762_2918025_-	virulence factor	NA	NA	NA	NA	NA
AXI21983.1|2919305_2921141_-	serine/threonine kinase	NA	A0A075BSL8	Microcystis_phage	32.9	5.6e-23
AXI21984.1|2921412_2922504_+	ribonuclease D	NA	NA	NA	NA	NA
AXI21985.1|2922579_2922969_-	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
AXI21986.1|2922832_2923183_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21987.1|2923596_2923998_+	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AXI21988.1|2924504_2924639_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI23667.1|2924861_2925041_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21989.1|2925642_2925933_-	RelE/ParE family toxin	NA	NA	NA	NA	NA
AXI21990.1|2925920_2926199_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AXI23668.1|2926683_2926872_-	plasmid mobilization protein	NA	NA	NA	NA	NA
AXI23669.1|2927644_2928829_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
AXI21991.1|2929376_2930375_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI21992.1|2934867_2935284_+	hypothetical protein	NA	NA	NA	NA	NA
AXI21993.1|2935494_2935821_-	hypothetical protein	NA	NA	NA	NA	NA
AXI21994.1|2935853_2936294_-	stringent starvation protein B	NA	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
AXI21995.1|2936372_2937008_-	stringent starvation protein A	NA	NA	NA	NA	NA
AXI21996.1|2937400_2938144_-	cytochrome c1	NA	NA	NA	NA	NA
AXI21997.1|2938151_2939411_-	cytochrome b	NA	NA	NA	NA	NA
AXI21998.1|2939410_2940055_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AXI21999.1|2940584_2941571_-	transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
AXI22000.1|2943506_2944961_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
>prophage 22
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	2989461	3048093	4994045	transposase	Ralstonia_phage(75.0%)	33	NA	NA
AXI22027.1|2989461_2990445_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	1.5e-99
AXI22028.1|2990386_2990626_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22029.1|2996194_2996854_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXI22030.1|2996868_2998173_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXI22031.1|2998185_3001356_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AXI22032.1|3002331_3003330_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI22033.1|3004003_3004999_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AXI22034.1|3005159_3007676_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
AXI22035.1|3007672_3008629_+	1-phosphofructokinase	NA	NA	NA	NA	NA
AXI22036.1|3008787_3010530_+	PTS fructose transporter subunit EIIBC	NA	NA	NA	NA	NA
AXI23673.1|3010848_3011985_+	carbohydrate porin	NA	NA	NA	NA	NA
AXI22037.1|3012651_3013620_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI22038.1|3013980_3015216_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI22039.1|3015234_3017580_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23674.1|3017597_3018329_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22040.1|3018360_3020703_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22041.1|3020727_3021456_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22042.1|3021484_3023827_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22043.1|3023851_3024604_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22044.1|3024625_3027460_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22045.1|3027456_3028386_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22046.1|3036040_3036430_-	type VI secretion protein	NA	NA	NA	NA	NA
AXI22047.1|3037956_3040446_-	avirulence protein	NA	NA	NA	NA	NA
AXI22048.1|3040485_3040875_-	type VI secretion protein	NA	NA	NA	NA	NA
AXI22049.1|3041029_3041989_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI22050.1|3041921_3042236_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI22051.1|3042364_3043783_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI22052.1|3043755_3043971_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22053.1|3044887_3045304_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22054.1|3045300_3045552_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22055.1|3045550_3045928_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22056.1|3045989_3046625_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22057.1|3047124_3048093_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
>prophage 23
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	3169623	3181398	4994045	tRNA	Escherichia_phage(22.22%)	13	NA	NA
AXI22144.1|3169623_3169923_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
AXI22145.1|3169965_3170196_-	hypothetical protein	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
AXI22146.1|3170439_3171189_-	isopentenyl transferase	NA	NA	NA	NA	NA
AXI22147.1|3171193_3171889_-	DNA helicase	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
AXI23685.1|3172074_3172374_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22148.1|3172761_3173181_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	57.4	2.1e-34
AXI22149.1|3173891_3174104_-	carbon storage regulator	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
AXI22150.1|3174243_3176892_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
AXI22151.1|3176993_3177482_-	regulatory protein RecX	NA	NA	NA	NA	NA
AXI22152.1|3177532_3177736_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22153.1|3177784_3178819_-	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
AXI22154.1|3178991_3179633_-	LexA repressor 2	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
AXI23686.1|3179721_3181398_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 24
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	3241713	3375455	4994045	protease,transposase	Ralstonia_phage(40.0%)	95	NA	NA
AXI22203.1|3241713_3243039_+|protease	serine protease	protease	A0A217EQY2	Bacillus_phage	39.2	2.4e-23
AXI22204.1|3243049_3243808_+	heme ABC transporter permease	NA	NA	NA	NA	NA
AXI22205.1|3243804_3244011_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
AXI22206.1|3244007_3244478_+	cytochrome c-type biogenesis protein CcmE 1	NA	NA	NA	NA	NA
AXI22207.1|3244541_3246530_+	c-type cytochrome biogenesis protein CcmF	NA	NA	NA	NA	NA
AXI22208.1|3246526_3247069_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AXI23697.1|3247068_3247566_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
AXI22209.1|3247565_3248270_+	C-type cytochrome biogenesis protein	NA	NA	NA	NA	NA
AXI22210.1|3252465_3252660_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
AXI22211.1|3252663_3252963_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
AXI22212.1|3253186_3257638_+	avirulence protein	NA	NA	NA	NA	NA
AXI22213.1|3257906_3258101_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
AXI22214.1|3258104_3258404_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
AXI22215.1|3263755_3264349_-	multidrug transporter	NA	NA	NA	NA	NA
AXI22216.1|3265907_3268496_-	hydrophobe/amphiphile efflux-1 family RND transporter	NA	NA	NA	NA	NA
AXI22217.1|3268552_3269665_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXI22218.1|3269789_3270368_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXI22219.1|3271116_3271482_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22220.1|3271854_3273942_+	type III effector	NA	NA	NA	NA	NA
AXI22221.1|3274327_3275425_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI22222.1|3275841_3278922_+	histidine kinase	NA	NA	NA	NA	NA
AXI23698.1|3281957_3282665_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXI22223.1|3282661_3283654_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AXI22224.1|3283650_3286110_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AXI22225.1|3286223_3287204_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXI22226.1|3287212_3288241_+	type VI secretion system protein ImpA	NA	NA	NA	NA	NA
AXI22227.1|3288407_3289205_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI22228.1|3289267_3290065_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI22229.1|3290125_3290452_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22230.1|3290448_3293352_-	serine/threonine protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
AXI22231.1|3293348_3294071_-	phosphoprotein phosphatase	NA	NA	NA	NA	NA
AXI22232.1|3294067_3294715_-	type VI secretion-associated protein	NA	NA	NA	NA	NA
AXI22233.1|3294711_3298170_-	type VI secretion protein	NA	NA	NA	NA	NA
AXI22234.1|3298173_3299490_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22235.1|3299491_3300829_-	type VI secretion system-associated protein	NA	NA	NA	NA	NA
AXI22236.1|3302212_3302752_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22237.1|3302760_3304698_-	type IV secretion protein Rhs	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
AXI22238.1|3304962_3305421_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22239.1|3306367_3306865_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22240.1|3307053_3309759_-	ClpV1 family T6SS ATPase	NA	H6X3M6	Enterobacteria_phage	29.3	4.3e-80
AXI22241.1|3309791_3310802_-	type VI secretion protein	NA	NA	NA	NA	NA
AXI22242.1|3310765_3312643_-	type VI secretion system ImpG/VasA family protein	NA	NA	NA	NA	NA
AXI22243.1|3312646_3313150_-	type VI secretion system lysozyme	NA	NA	NA	NA	NA
AXI22244.1|3313137_3313971_-	ImpE protein	NA	NA	NA	NA	NA
AXI22245.1|3314006_3314510_-	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
AXI22246.1|3314609_3316124_-	EvpB family type VI secretion protein	NA	NA	NA	NA	NA
AXI23699.1|3316116_3316623_-	type VI secretion system-associated protein	NA	NA	NA	NA	NA
AXI22247.1|3317144_3317786_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22248.1|3317836_3319246_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI22249.1|3319458_3320427_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI22250.1|3322049_3323285_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI22251.1|3323470_3324439_-|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI22252.1|3324490_3326407_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22253.1|3326431_3327169_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22254.1|3327199_3329542_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23700.1|3329559_3330306_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22255.1|3330334_3333169_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23701.1|3333165_3333369_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22256.1|3333406_3333655_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.2	5.4e-14
AXI22257.1|3333826_3335656_-	transmembrane repetitive protein	NA	NA	NA	NA	NA
AXI22258.1|3335669_3336269_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
AXI22259.1|3336356_3336713_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AXI22260.1|3336709_3337132_+	energy transducer TonB	NA	NA	NA	NA	NA
AXI22261.1|3337147_3337381_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AXI22262.1|3337407_3337668_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AXI22263.1|3339832_3340819_-	23S rRNA pseudouridine(955/2504/2580) synthase	NA	NA	NA	NA	NA
AXI22264.1|3341229_3344943_+	ribonuclease E/G	NA	NA	NA	NA	NA
AXI23702.1|3345468_3346047_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22265.1|3345812_3346259_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22266.1|3346335_3346983_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXI22267.1|3347204_3347966_-	sulfurtransferase	NA	NA	NA	NA	NA
AXI22268.1|3348123_3349092_-|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI22269.1|3349225_3349591_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22270.1|3349649_3350081_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXI22271.1|3350092_3351355_+	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
AXI22272.1|3351338_3352631_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
AXI22273.1|3353000_3353771_+	phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AXI22274.1|3353855_3354524_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23703.1|3357043_3357301_-	stress-induced protein	NA	NA	NA	NA	NA
AXI22275.1|3357740_3358724_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
AXI22276.1|3359039_3360008_-|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI22277.1|3360010_3361099_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
AXI22278.1|3361538_3361718_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22279.1|3362082_3363081_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI22280.1|3364255_3365233_+	siroheme synthase	NA	NA	NA	NA	NA
AXI22281.1|3365442_3365832_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
AXI22282.1|3366041_3366236_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AXI22283.1|3367629_3367992_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22284.1|3367975_3368545_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
AXI22285.1|3368582_3369836_-	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AXI22286.1|3370041_3370419_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23704.1|3372092_3372299_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI22287.1|3372347_3373583_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI22288.1|3374101_3374374_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXI22289.1|3374420_3375455_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 25
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	3516907	3646316	4994045	transposase,integrase,tRNA,protease	Ralstonia_phage(13.33%)	108	3620401:3620460	3637070:3637733
AXI22389.1|3516907_3517354_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI22390.1|3518350_3520717_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXI23716.1|3520713_3521388_-	methylamine utilization protein	NA	NA	NA	NA	NA
AXI22391.1|3521597_3522536_-	flavonol synthase	NA	NA	NA	NA	NA
AXI22392.1|3522658_3524008_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AXI22393.1|3524004_3524892_-	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AXI22394.1|3525209_3526016_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AXI22395.1|3526461_3527679_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AXI22396.1|3527784_3528753_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
AXI22397.1|3529137_3529806_-	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
AXI22398.1|3529802_3530576_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AXI23717.1|3531149_3533216_-	ferrous iron transporter B	NA	NA	NA	NA	NA
AXI22399.1|3533782_3534808_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXI22400.1|3534892_3535966_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
AXI22401.1|3535958_3537062_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
AXI22402.1|3537072_3537999_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AXI22403.1|3538079_3538730_+	SCO family protein	NA	NA	NA	NA	NA
AXI22404.1|3538726_3539575_+	phosphatidylserine decarboxylase proenzyme	NA	NA	NA	NA	NA
AXI22405.1|3540125_3541709_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
AXI23718.1|3541628_3541814_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22406.1|3542003_3542351_+	hypothetical protein	NA	A0A248XCZ8	Klebsiella_phage	44.7	1.1e-12
AXI22407.1|3542419_3542887_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AXI22408.1|3543131_3544349_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXI23720.1|3544309_3544588_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23719.1|3544707_3545214_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
AXI22409.1|3545335_3546736_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AXI22410.1|3546998_3547574_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
AXI22411.1|3547570_3548005_+	HIT family protein	NA	NA	NA	NA	NA
AXI22412.1|3548032_3548200_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22413.1|3548970_3549156_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22414.1|3549190_3549760_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
AXI22415.1|3549852_3550704_-	Fe-S-binding ATPase	NA	NA	NA	NA	NA
AXI22416.1|3552091_3554107_+	peptidase M13	NA	NA	NA	NA	NA
AXI22417.1|3554377_3555076_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXI22418.1|3555116_3555524_-	cysteine methyltransferase	NA	NA	NA	NA	NA
AXI22419.1|3555764_3555932_-	glutathione reductase	NA	NA	NA	NA	NA
AXI22420.1|3555961_3556924_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI22421.1|3558207_3559458_-	amino acid dehydrogenase	NA	NA	NA	NA	NA
AXI22422.1|3559465_3560710_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22423.1|3560937_3561417_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXI23721.1|3561527_3562064_+	glycoside hydrolase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
AXI22424.1|3562173_3562923_+	hypothetical protein	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
AXI22425.1|3563130_3563622_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AXI22426.1|3566197_3567904_+	alkaline phosphatase	NA	NA	NA	NA	NA
AXI22427.1|3567937_3569242_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AXI22428.1|3569273_3569534_+	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
AXI22429.1|3569535_3570411_+	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
AXI23722.1|3572245_3572710_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
AXI23723.1|3573239_3574607_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AXI22430.1|3574752_3575334_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22431.1|3575590_3577036_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AXI22432.1|3577882_3581803_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
AXI22433.1|3581936_3583436_-	ribonuclease E/G	NA	NA	NA	NA	NA
AXI22434.1|3583435_3584008_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AXI22435.1|3584146_3584881_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
AXI22436.1|3585352_3588466_+	Oar protein	NA	NA	NA	NA	NA
AXI22437.1|3589884_3590355_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AXI22438.1|3591440_3592556_-	J domain-containing protein	NA	NA	NA	NA	NA
AXI22439.1|3592567_3592984_-	ribosome silencing factor RsfS	NA	NA	NA	NA	NA
AXI22440.1|3593040_3593940_-	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AXI22441.1|3593936_3594965_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AXI22442.1|3594987_3595623_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22443.1|3596136_3598779_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
AXI22444.1|3598851_3599463_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
AXI22445.1|3599667_3600525_+	co-chaperone YbbN	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
AXI22446.1|3600780_3601230_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AXI22447.1|3601529_3602528_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI22448.1|3602592_3603039_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI23724.1|3602804_3603383_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI22449.1|3603439_3603628_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22450.1|3603992_3604286_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23725.1|3604880_3606314_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI22451.1|3606269_3606470_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
AXI22452.1|3606503_3607517_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXI22453.1|3607484_3607676_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22454.1|3607766_3609164_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI22455.1|3609173_3610388_-|transposase	IS4/IS5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
AXI22456.1|3610533_3611061_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22457.1|3611057_3612056_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI22458.1|3612236_3612683_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI23726.1|3612448_3613027_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI22459.1|3613328_3615461_+	glycogen debranching enzyme	NA	NA	NA	NA	NA
AXI22460.1|3616011_3616980_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXI22461.1|3617140_3618109_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXI22462.1|3619184_3619598_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23727.1|3619594_3620173_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI22463.1|3619938_3620385_-|transposase	transposase	transposase	NA	NA	NA	NA
3620401:3620460	attL	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTC	NA	NA	NA	NA
AXI22464.1|3621229_3622027_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI22465.1|3622060_3622453_-	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AXI22466.1|3622543_3622936_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22467.1|3623304_3624030_+|transposase	IS5/IS1182 family transposase	transposase	K4I1H9	Acidithiobacillus_phage	64.3	8.6e-36
AXI23728.1|3625274_3625694_+|integrase	integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
AXI22468.1|3626921_3627146_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22469.1|3627410_3629195_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
AXI22470.1|3629385_3629586_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AXI22471.1|3630121_3630916_+	thiazole synthase	NA	NA	NA	NA	NA
AXI22472.1|3631216_3631975_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AXI22473.1|3632050_3633913_+	SLC13 family permease	NA	NA	NA	NA	NA
AXI23729.1|3633970_3634312_-	ferredoxin	NA	NA	NA	NA	NA
AXI22474.1|3634571_3634847_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22475.1|3637893_3638607_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
3637070:3637733	attR	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTCAGCACAAGCCCAAACGCGGATGACGGCGTACAACGGCGGCCACACGCAGCTGGGTGCCGGAGGAGTTGCGGATTGTGCATCGCCCCGAAGAAGTGCAGACGCGCTTGGTCCCAGGTCATTGGGAAGGCGACTTGATCAAGGGCGCATTCAATCGTTCTTGCGTGGGCACGTTGGTGGAACGCAAGACGCGCTTTGTCGTGCTGTGCCGCATGGATGGCTGCACGGCCGCAGATGCGCTGGAAGGGTTTACCCGGCAAATGAAGAAACTGCCGGCCTCAATGCGGACAAGTCTGACCTACGATCGCGGTACCGAGCTCACGTGCTACGCCGAGCTGATGCAAGGATTGAACATCGACGTGTGGTTCGCTGATCCACATGCGCCGTGGCAGCGGGGAAGTAACGAGAACACCAACGGCCTGCTGCGCCAATTCCTGCCCAAGGGCGCCGACCTGTCCACTGTCAGCCAAGAGTATCTCAATCACATCGCACTGCTGATGAATACCCGCCCTCGTCAGACGCTCGGATGGAAGACACCAAGCGAGGCAATGGAGGAAGAAATCGCAGCACTCAAATCACGTGTTGCACTTGAATCTTGAGACTGCCC	NA	NA	NA	NA
AXI22476.1|3638667_3639090_+	large-conductance mechanosensitive channel	NA	NA	NA	NA	NA
AXI23730.1|3639221_3639800_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI22477.1|3639565_3640012_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI22478.1|3643058_3643970_-	RNA methyltransferase	NA	NA	NA	NA	NA
AXI22479.1|3644363_3644489_-	acetyltransferase	NA	NA	NA	NA	NA
AXI22480.1|3644485_3644662_-	acetyltransferase	NA	NA	NA	NA	NA
AXI22481.1|3645317_3646316_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 26
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	4182181	4277304	4994045	transposase,tail,tRNA,protease	Ralstonia_phage(17.65%)	69	NA	NA
AXI23776.1|4182181_4183789_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI22889.1|4185064_4186429_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AXI23777.1|4186644_4187340_+	VIT family protein	NA	NA	NA	NA	NA
AXI22890.1|4188286_4188910_-	GTP-binding protein	NA	NA	NA	NA	NA
AXI23778.1|4189111_4189852_+	cytochrome c4	NA	NA	NA	NA	NA
AXI22891.1|4189945_4190596_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AXI22892.1|4190687_4191503_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AXI23779.1|4191552_4192290_+	endonuclease	NA	NA	NA	NA	NA
AXI22893.1|4194217_4195207_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
AXI22894.1|4195329_4197903_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AXI22895.1|4198068_4198515_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI23780.1|4198280_4198859_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22896.1|4198931_4199900_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI22897.1|4200633_4200900_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22898.1|4201831_4202630_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI23781.1|4204276_4205509_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	K4IEX3	Salmonella_phage	41.7	2.0e-72
AXI22899.1|4205548_4206511_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI22900.1|4206686_4207643_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXI22901.1|4207854_4208823_-|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI22902.1|4209131_4209578_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI23782.1|4209343_4209922_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI22903.1|4213298_4214297_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI22904.1|4214758_4214989_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22905.1|4215613_4217656_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
AXI22906.1|4217657_4219556_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
AXI22907.1|4219557_4220811_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
AXI22908.1|4220807_4221413_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
AXI22909.1|4221832_4222987_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AXI22910.1|4222989_4224018_-	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AXI22911.1|4224014_4225091_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AXI22912.1|4225131_4226409_-	glucose/galactose MFS transporter	NA	NA	NA	NA	NA
AXI22913.1|4226453_4227221_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXI22914.1|4227435_4228602_-	DUF5009 domain-containing protein	NA	NA	NA	NA	NA
AXI22915.1|4231145_4234043_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
AXI22916.1|4234193_4236884_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI22917.1|4237165_4238122_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.6e-42
AXI22918.1|4238155_4238368_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22919.1|4238324_4238609_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22920.1|4238612_4239848_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI22921.1|4240777_4241194_+	hypothetical protein	NA	U5P429	Shigella_phage	54.0	7.7e-13
AXI22922.1|4241283_4242468_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXI22923.1|4242535_4243273_+	pteridine reductase	NA	NA	NA	NA	NA
AXI22924.1|4243441_4243957_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AXI22925.1|4244048_4245551_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
AXI22926.1|4245554_4245995_-	response regulator	NA	NA	NA	NA	NA
AXI22927.1|4245991_4247803_-	histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
AXI23783.1|4248088_4248451_-	BON domain-containing protein	NA	NA	NA	NA	NA
AXI22928.1|4248610_4249663_+	oxidoreductase	NA	NA	NA	NA	NA
AXI22929.1|4250002_4250944_-	6-phosphogluconate dehydrogenase (decarboxylating)	NA	M4SJX8	Cyanophage	44.9	5.9e-69
AXI22930.1|4250964_4252302_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22931.1|4252473_4252854_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22932.1|4252978_4253740_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22933.1|4255988_4257392_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
AXI22934.1|4257514_4258570_-	ADP-ribose pyrophosphatase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
AXI23784.1|4258742_4259597_+	endonuclease	NA	NA	NA	NA	NA
AXI22935.1|4259888_4262072_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
AXI23785.1|4262570_4263566_-	restriction endonuclease	NA	NA	NA	NA	NA
AXI22936.1|4263661_4265473_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXI22937.1|4265717_4266731_-	lipoyl synthase	NA	NA	NA	NA	NA
AXI22938.1|4266745_4267444_-	octanoyltransferase	NA	NA	NA	NA	NA
AXI22939.1|4267431_4267710_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22940.1|4268775_4269981_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
AXI22941.1|4270089_4270371_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22942.1|4270481_4271897_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
AXI22943.1|4271893_4273033_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AXI22944.1|4273301_4273754_-	polygalacturonase	NA	NA	NA	NA	NA
AXI22945.1|4274772_4276047_-	peptigoglycan-binding protein LysM	NA	B3FJ91	Pseudomonas_phage	33.7	1.2e-21
AXI22946.1|4276046_4276265_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22947.1|4276341_4277304_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 27
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	4291367	4346249	4994045	transposase,tRNA	Erwinia_phage(22.22%)	43	NA	NA
AXI22957.1|4291367_4292336_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI22958.1|4292391_4293189_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI22959.1|4293947_4294319_-	hypothetical protein	NA	K4I1H9	Acidithiobacillus_phage	64.0	2.3e-24
AXI22960.1|4294330_4294786_-|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
AXI22961.1|4294782_4295283_-	drug:proton antiporter	NA	NA	NA	NA	NA
AXI22962.1|4296533_4297610_-	HlyD family secretion protein	NA	NA	NA	NA	NA
AXI22963.1|4299336_4300098_+	ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE	NA	NA	NA	NA	NA
AXI22964.1|4300270_4301161_+	diguanylate cyclase	NA	NA	NA	NA	NA
AXI22965.1|4301282_4303295_+	aminopeptidase	NA	NA	NA	NA	NA
AXI22966.1|4303466_4304186_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22967.1|4304494_4305109_+	HAD family hydrolase	NA	NA	NA	NA	NA
AXI22968.1|4305282_4306650_-	HslU--HslV peptidase ATPase subunit	NA	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
AXI22969.1|4306760_4307312_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AXI23787.1|4307827_4308745_-	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	27.7	2.2e-12
AXI22970.1|4308944_4309625_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22971.1|4309612_4310467_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
AXI22972.1|4310456_4310693_-	sugar transporter	NA	NA	NA	NA	NA
AXI23788.1|4310750_4311149_-	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AXI22973.1|4311492_4313628_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
AXI22974.1|4313751_4314936_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AXI23789.1|4315261_4315693_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22975.1|4315775_4317869_-	S9 family peptidase	NA	NA	NA	NA	NA
AXI22976.1|4317936_4318248_-	hypothetical protein	NA	NA	NA	NA	NA
AXI22977.1|4318634_4319204_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22978.1|4319312_4320278_-	transcriptional regulator	NA	NA	NA	NA	NA
AXI22979.1|4320836_4321637_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22980.1|4322187_4323102_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AXI22981.1|4323132_4323870_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXI22982.1|4323900_4324953_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
AXI22983.1|4324957_4325626_-	carboxylesterase	NA	NA	NA	NA	NA
AXI22984.1|4325777_4327715_-	glucan biosynthesis protein H	NA	NA	NA	NA	NA
AXI22985.1|4328414_4328861_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI22986.1|4328818_4329205_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI22987.1|4329330_4329591_+	hypothetical protein	NA	NA	NA	NA	NA
AXI22988.1|4329518_4331168_-	peptidase M20	NA	NA	NA	NA	NA
AXI22989.1|4332568_4334056_-	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	1.0e-123
AXI22990.1|4334263_4335712_+	endoglucanase	NA	H2DE45	Erwinia_phage	32.3	7.5e-47
AXI22991.1|4336946_4339571_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
AXI22992.1|4339825_4342696_+	peptidase M16	NA	NA	NA	NA	NA
AXI22993.1|4343243_4344173_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AXI22994.1|4344211_4345216_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23790.1|4345458_4346037_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI22995.1|4345802_4346249_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	4386563	4432391	4994045	protease,transposase	Ralstonia_phage(66.67%)	44	NA	NA
AXI23018.1|4386563_4387223_+|protease	zinc metalloprotease	protease	NA	NA	NA	NA
AXI23019.1|4387219_4387885_+	peptidase M4	NA	NA	NA	NA	NA
AXI23020.1|4387891_4388116_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23021.1|4388257_4388743_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23022.1|4389281_4392110_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
AXI23023.1|4392109_4392484_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
AXI23024.1|4392480_4394025_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
AXI23025.1|4394021_4394528_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
AXI23026.1|4394524_4394809_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
AXI23027.1|4394805_4395159_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
AXI23028.1|4395555_4395945_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23029.1|4396128_4397097_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI23030.1|4399217_4400288_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
AXI23031.1|4400458_4400947_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXI23032.1|4401303_4401894_-	thioredoxin family protein	NA	NA	NA	NA	NA
AXI23033.1|4401905_4403414_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.4	1.1e-61
AXI23034.1|4403856_4404750_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
AXI23035.1|4406132_4406798_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
AXI23036.1|4407397_4408396_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI23037.1|4408928_4409309_+	peptide-binding protein	NA	NA	NA	NA	NA
AXI23038.1|4409511_4410417_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23039.1|4410485_4411781_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AXI23798.1|4411871_4412435_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23040.1|4412860_4414126_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
AXI23041.1|4414122_4415100_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23042.1|4415203_4416007_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AXI23043.1|4416182_4416992_+	glycosyl transferase	NA	NA	NA	NA	NA
AXI23044.1|4416999_4417798_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI23799.1|4417840_4418488_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23800.1|4418582_4419158_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23045.1|4419306_4420689_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI23046.1|4420838_4421807_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI23047.1|4421932_4422685_-	haloacid dehalogenase	NA	NA	NA	NA	NA
AXI23048.1|4422722_4423163_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23801.1|4423369_4423711_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23049.1|4423936_4424314_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23802.1|4424524_4424722_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
AXI23050.1|4425028_4425775_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
AXI23051.1|4425867_4426674_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AXI23803.1|4426897_4428310_+	NlpC-P60 family protein	NA	NA	NA	NA	NA
AXI23052.1|4428306_4429404_+	dipeptide epimerase	NA	NA	NA	NA	NA
AXI23053.1|4429558_4430357_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI23054.1|4430410_4431209_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI23055.1|4431287_4432391_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 29
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	4436031	4502337	4994045	transposase,tRNA	Acinetobacter_phage(27.27%)	55	NA	NA
AXI23060.1|4436031_4436418_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI23061.1|4436489_4437725_+|transposase	ISL3 family transposase ISXoo13	transposase	NA	NA	NA	NA
AXI23062.1|4437728_4438142_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23063.1|4438318_4438600_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23064.1|4439160_4439598_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23065.1|4439600_4440569_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI23066.1|4440929_4442108_+	glucose dehydrogenase	NA	NA	NA	NA	NA
AXI23067.1|4443013_4444066_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
AXI23068.1|4446399_4448571_-	beta-glucosidase	NA	NA	NA	NA	NA
AXI23069.1|4448798_4449155_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AXI23070.1|4449233_4450298_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.6	4.3e-100
AXI23071.1|4450577_4450793_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXI23072.1|4451115_4451562_+|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
AXI23073.1|4453039_4454002_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
AXI23074.1|4454091_4455840_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
AXI23075.1|4457412_4457646_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23076.1|4457903_4458950_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
AXI23077.1|4459133_4460714_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AXI23078.1|4461102_4461999_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AXI23079.1|4462001_4463165_-	heme A synthase	NA	NA	NA	NA	NA
AXI23080.1|4463175_4463751_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23081.1|4463778_4464498_-	SURF1 family protein	NA	NA	NA	NA	NA
AXI23082.1|4464558_4464777_+	DUF2909 domain-containing protein	NA	NA	NA	NA	NA
AXI23083.1|4464876_4465752_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
AXI23084.1|4465790_4466387_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
AXI23085.1|4466383_4466557_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23086.1|4466537_4468142_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
AXI23087.1|4468180_4469134_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AXI23804.1|4469150_4469627_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
AXI23088.1|4469903_4473104_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXI23089.1|4474286_4475285_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI23090.1|4475297_4475768_-	bacterioferritin	NA	NA	NA	NA	NA
AXI23805.1|4476110_4476326_-	bacterioferritin	NA	NA	NA	NA	NA
AXI23091.1|4476406_4477024_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AXI23092.1|4477572_4477965_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AXI23093.1|4477968_4478397_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AXI23806.1|4478582_4479236_+	demethoxyubiquinone hydroxylase family protein	NA	NA	NA	NA	NA
AXI23094.1|4479491_4479806_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AXI23095.1|4479965_4480760_-	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AXI23096.1|4480897_4481590_+	CRP-like protein Clp	NA	NA	NA	NA	NA
AXI23097.1|4481910_4482627_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
AXI23098.1|4482619_4483417_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
AXI23099.1|4483553_4484591_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
AXI23100.1|4484708_4485338_-	Asp/Glu/hydantoin racemase	NA	NA	NA	NA	NA
AXI23101.1|4485334_4485493_-	molybdopterin biosynthesis protein	NA	NA	NA	NA	NA
AXI23102.1|4485489_4486071_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
AXI23103.1|4486776_4487454_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23104.1|4488648_4488888_-	biotin transporter BioY	NA	NA	NA	NA	NA
AXI23105.1|4489204_4491436_-	isocitrate dehydrogenase, NADP-dependent	NA	NA	NA	NA	NA
AXI23807.1|4491625_4493338_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23106.1|4493486_4494863_+|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.5	3.7e-80
AXI23107.1|4497070_4497869_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI23108.1|4498853_4499822_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXI23109.1|4499988_4500960_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
AXI23110.1|4501152_4502337_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
>prophage 30
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	4516214	4584509	4994045	transposase,integrase,tRNA	Erysipelothrix_phage(12.5%)	47	4545999:4546018	4559882:4559901
AXI23118.1|4516214_4517213_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI23119.1|4517598_4518597_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI23808.1|4519026_4519497_+	thioesterase	NA	NA	NA	NA	NA
AXI23120.1|4519525_4519948_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23121.1|4520023_4520458_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23122.1|4520567_4521083_+	protein-export protein SecB	NA	NA	NA	NA	NA
AXI23123.1|4521098_4522124_+	glycerol-3-phosphate dehydrogenase (NAD(P)(+))	NA	NA	NA	NA	NA
AXI23124.1|4522446_4523043_-	Ax21 family protein	NA	NA	NA	NA	NA
AXI23125.1|4523400_4525128_+	pyruvate oxidase	NA	NA	NA	NA	NA
AXI23126.1|4525177_4526620_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AXI23127.1|4526604_4527951_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXI23128.1|4528141_4528891_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23129.1|4528992_4529604_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23130.1|4529708_4530932_+	MFS transporter	NA	NA	NA	NA	NA
AXI23131.1|4531273_4531750_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
AXI23132.1|4531776_4532238_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23133.1|4532623_4532944_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23134.1|4533045_4534062_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
AXI23135.1|4534133_4535297_+	addiction module protein	NA	NA	NA	NA	NA
AXI23136.1|4535293_4536925_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
AXI23137.1|4536926_4539428_+	helicase SNF2	NA	NA	NA	NA	NA
AXI23138.1|4539424_4540327_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXI23139.1|4540548_4540932_-	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AXI23140.1|4541250_4542921_+	peptide synthase	NA	NA	NA	NA	NA
AXI23141.1|4543149_4544160_+	3-beta hydroxysteroid dehydrogenase	NA	A0A0E3FNQ3	Synechococcus_phage	32.6	1.5e-14
AXI23142.1|4544224_4544383_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
AXI23143.1|4544617_4545994_+|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
4545999:4546018	attL	GGTTTTTCAGGGGCGACTAT	NA	NA	NA	NA
AXI23144.1|4546004_4546538_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXI23145.1|4546966_4548226_-	phosphodiesterase	NA	NA	NA	NA	NA
AXI23146.1|4548364_4549672_-	MFS transporter	NA	NA	NA	NA	NA
AXI23147.1|4549843_4550065_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXI23148.1|4551121_4551700_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI23149.1|4551756_4552791_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXI23150.1|4553141_4553687_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AXI23809.1|4553712_4553979_-	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AXI23151.1|4554153_4555992_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AXI23152.1|4556222_4557098_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
AXI23153.1|4558583_4559819_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI23154.1|4562795_4563695_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
4559882:4559901	attR	GGTTTTTCAGGGGCGACTAT	NA	NA	NA	NA
AXI23155.1|4564641_4567443_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
AXI23156.1|4567519_4567810_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23157.1|4569372_4569963_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23158.1|4570445_4570700_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23159.1|4571198_4573886_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AXI23160.1|4576946_4577915_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.8e-97
AXI23161.1|4582373_4582574_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23162.1|4583996_4584509_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
>prophage 31
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	4682540	4740841	4994045	transposase,tRNA	Leptospira_phage(50.0%)	35	NA	NA
AXI23227.1|4682540_4683539_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI23228.1|4683606_4684032_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXI23229.1|4684047_4684494_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI23825.1|4684259_4684838_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI23230.1|4684899_4685931_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
AXI23231.1|4687291_4688548_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
AXI23232.1|4688544_4689435_+	chitin deacetylase	NA	NA	NA	NA	NA
AXI23233.1|4689431_4689827_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AXI23826.1|4689846_4690425_+	OHCU decarboxylase	NA	NA	NA	NA	NA
AXI23234.1|4693310_4693490_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23235.1|4695005_4695137_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23236.1|4697274_4699359_-	S9 family peptidase	NA	NA	NA	NA	NA
AXI23237.1|4699458_4701486_-	3-methylcrotonyl-CoA carboxylase	NA	NA	NA	NA	NA
AXI23238.1|4701728_4703339_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
AXI23239.1|4703349_4704513_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXI23240.1|4704641_4705262_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXI23241.1|4705592_4705781_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23242.1|4705823_4706159_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
AXI23243.1|4707783_4708095_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23244.1|4709213_4709732_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
AXI23245.1|4710002_4711721_+	nuclease	NA	NA	NA	NA	NA
AXI23246.1|4711811_4712198_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23247.1|4712259_4713585_+	GTP-binding protein	NA	NA	NA	NA	NA
AXI23248.1|4713699_4715013_-	type III effector protein XopR	NA	NA	NA	NA	NA
AXI23249.1|4715111_4715837_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23827.1|4716053_4716716_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXI23250.1|4716794_4717889_+	cell division protein ZapE	NA	NA	NA	NA	NA
AXI23251.1|4719007_4719196_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23252.1|4722404_4723994_-	sulfotransferase family protein	NA	NA	NA	NA	NA
AXI23253.1|4723993_4726231_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AXI23254.1|4726519_4727428_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AXI23255.1|4727517_4729332_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
AXI23828.1|4729717_4738204_-	type III secretion system effector XopAD	NA	NA	NA	NA	NA
AXI23256.1|4738641_4739439_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI23257.1|4739458_4740841_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 32
CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	4751092	4792889	4994045	transposase,tRNA	Escherichia_phage(25.0%)	29	NA	NA
AXI23270.1|4751092_4752010_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
AXI23271.1|4752100_4752610_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23272.1|4754175_4755243_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AXI23273.1|4755418_4757614_+	alpha-glucuronidase	NA	NA	NA	NA	NA
AXI23274.1|4757610_4759575_+	9-O-acetylesterase	NA	NA	NA	NA	NA
AXI23275.1|4759586_4760846_+	bifunctional D-altronate/D-mannonate dehydratase	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
AXI23830.1|4760845_4762546_+	glycoside hydrolase 43 family protein	NA	NA	NA	NA	NA
AXI23276.1|4762548_4765263_+	glucan 1,4-alpha-glucosidase	NA	NA	NA	NA	NA
AXI23277.1|4765485_4766958_+	mannitol dehydrogenase	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
AXI23278.1|4767935_4768991_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23279.1|4769218_4770637_-	uronate isomerase	NA	NA	NA	NA	NA
AXI23280.1|4770677_4771655_-	1,4-beta-xylanase	NA	NA	NA	NA	NA
AXI23281.1|4773071_4774553_-	MFS transporter	NA	NA	NA	NA	NA
AXI23831.1|4774894_4777768_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI23282.1|4777866_4779354_+	MFS transporter	NA	NA	NA	NA	NA
AXI23283.1|4779385_4780420_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AXI23284.1|4780836_4781634_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI23832.1|4782510_4782648_-	hypothetical protein	NA	NA	NA	NA	NA
AXI23285.1|4782907_4783897_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI23286.1|4784126_4784582_+	histidine kinase	NA	NA	NA	NA	NA
AXI23287.1|4784597_4785044_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI23833.1|4784809_4785388_+	hypothetical protein	NA	NA	NA	NA	NA
AXI23288.1|4785404_4786505_+	signal EAL domain protein	NA	NA	NA	NA	NA
AXI23289.1|4786570_4787692_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
AXI23290.1|4787701_4788796_-	ferredoxin reductase	NA	NA	NA	NA	NA
AXI23291.1|4788870_4789551_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXI23292.1|4789583_4790382_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI23293.1|4790423_4791830_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI23294.1|4791932_4792889_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
