The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024848	Oceanobacillus sp. 160 chromosome, complete genome	4103611	606722	671364	4103611	protease,coat,tRNA,bacteriocin	Bacillus_phage(22.22%)	49	NA	NA
AXI08035.1|606722_607487_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXI08036.1|607700_608066_+	holo-ACP synthase	NA	NA	NA	NA	NA
AXI08037.1|608442_609477_+	DUF4367 domain-containing protein	NA	NA	NA	NA	NA
AXI08038.1|609918_610203_+	antitoxin	NA	NA	NA	NA	NA
AXI08039.1|610207_610570_+	PemK family transcriptional regulator	NA	A0A2P0ZKX3	Lactobacillus_phage	36.0	2.7e-14
AXI08040.1|610757_611627_+	RsbR protein	NA	NA	NA	NA	NA
AXI08041.1|611632_611989_+	RsbT antagonist protein RsbS	NA	NA	NA	NA	NA
AXI08042.1|611991_612393_+	ATP-binding protein	NA	NA	NA	NA	NA
AXI08043.1|612488_613502_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
AXI08044.1|613605_613950_+	anti-anti-sigma factor	NA	NA	NA	NA	NA
AXI08045.1|613936_614413_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
AXI08046.1|614384_615176_+	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	34.5	5.7e-25
AXI08047.1|615172_615769_+	indirect negative regulator of sigma-B activity	NA	NA	NA	NA	NA
AXI11081.1|615995_618140_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AXI08048.1|618202_619684_-	catalase	NA	A0A2K9L0T1	Tupanvirus	44.7	3.9e-91
AXI08049.1|620213_620672_+	SprT family protein	NA	U5J9G1	Bacillus_phage	30.3	6.3e-08
AXI08050.1|628119_628578_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AXI08051.1|628589_629297_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AXI08052.1|629289_629736_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AXI08053.1|629735_630746_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.5	5.0e-66
AXI08054.1|631044_632220_+	cell division protein	NA	NA	NA	NA	NA
AXI08055.1|632335_633709_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AXI08056.1|633904_635827_-	multidrug ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	30.2	7.6e-55
AXI08057.1|635971_636619_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
AXI08058.1|636714_637419_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXI08059.1|637974_638259_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	57.0	3.1e-21
AXI08060.1|638309_639941_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.0	1.3e-156
AXI08061.1|641141_641579_-	CBS domain-containing protein	NA	NA	NA	NA	NA
AXI08062.1|642460_643081_-	hypothetical protein	NA	NA	NA	NA	NA
AXI08063.1|643348_644803_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
AXI08064.1|644783_644975_+	hypothetical protein	NA	NA	NA	NA	NA
AXI08065.1|645859_646567_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AXI08066.1|647092_648982_-	squalene--hopene cyclase	NA	NA	NA	NA	NA
AXI08067.1|649189_650341_+	DUF2515 domain-containing protein	NA	NA	NA	NA	NA
AXI08068.1|650707_650914_+	hypothetical protein	NA	NA	NA	NA	NA
AXI08069.1|651063_651933_-	chitooligosaccharide deacetylase	NA	NA	NA	NA	NA
AXI08070.1|652683_653427_-	3-alpha-hydroxysteroid dehydrogenase	NA	M1NMS3	Moumouvirus	24.1	5.4e-09
AXI08071.1|653598_654048_+	hypothetical protein	NA	NA	NA	NA	NA
AXI08072.1|654855_655368_+	hypothetical protein	NA	NA	NA	NA	NA
AXI08073.1|657531_658374_-	HAD family hydrolase	NA	NA	NA	NA	NA
AXI08074.1|658768_658954_+	hypothetical protein	NA	NA	NA	NA	NA
AXI08075.1|659343_660612_+	MFS transporter	NA	NA	NA	NA	NA
AXI08076.1|661206_661482_+	hypothetical protein	NA	NA	NA	NA	NA
AXI08077.1|662477_664262_+	S9 family peptidase	NA	NA	NA	NA	NA
AXI08078.1|664914_665160_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
AXI08079.1|665330_667274_+|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
AXI08080.1|667270_669217_+|bacteriocin	bacteriocin biosynthesis protein SagD	bacteriocin	NA	NA	NA	NA
AXI08081.1|669238_670816_+	NADH oxidase	NA	NA	NA	NA	NA
AXI08082.1|671064_671364_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 2
CP024848	Oceanobacillus sp. 160 chromosome, complete genome	4103611	802380	811293	4103611		Synechococcus_phage(33.33%)	7	NA	NA
AXI08189.1|802380_803862_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.8	5.7e-42
AXI08190.1|804274_804766_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	1.3e-22
AXI08191.1|804752_805883_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AXI08192.1|805931_808157_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.8	4.0e-148
AXI08193.1|808207_809614_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.2	1.6e-46
AXI08194.1|809710_810730_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	43.4	1.2e-67
AXI08195.1|810726_811293_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.8	3.4e-27
>prophage 3
CP024848	Oceanobacillus sp. 160 chromosome, complete genome	4103611	1505489	1548944	4103611	coat,tRNA	Bacillus_phage(33.33%)	52	NA	NA
AXI08782.1|1505489_1506479_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AXI08783.1|1506931_1507873_-	auxin efflux carrier	NA	NA	NA	NA	NA
AXI08784.1|1507995_1508418_-	general stress protein	NA	NA	NA	NA	NA
AXI08785.1|1508594_1508903_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
AXI08786.1|1508956_1509130_-	asparagine synthase	NA	NA	NA	NA	NA
AXI08787.1|1509303_1509561_-	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
AXI08788.1|1510157_1511369_+	GTP-binding protein	NA	NA	NA	NA	NA
AXI08789.1|1511448_1512021_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXI08790.1|1512303_1512699_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AXI08791.1|1513227_1513896_+	adaptor protein MecA	NA	NA	NA	NA	NA
AXI08792.1|1514077_1515271_+	hypothetical protein	NA	NA	NA	NA	NA
AXI08793.1|1515403_1517215_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AXI08794.1|1518102_1518993_-	dithiol-disulfide isomerase	NA	NA	NA	NA	NA
AXI08795.1|1519011_1519398_-	globin	NA	NA	NA	NA	NA
AXI08796.1|1519487_1520057_-	adenylate cyclase	NA	NA	NA	NA	NA
AXI08797.1|1520201_1520810_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AXI08798.1|1520839_1521649_+	NAD kinase	NA	NA	NA	NA	NA
AXI08799.1|1521664_1522558_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AXI08800.1|1522550_1523291_-	hypothetical protein	NA	M4Q4T6	Vibrio_phage	26.1	1.9e-09
AXI08801.1|1523715_1525101_+	magnesium transporter	NA	NA	NA	NA	NA
AXI08802.1|1525178_1525703_+	hypothetical protein	NA	NA	NA	NA	NA
AXI08803.1|1525770_1526238_-|coat	spore coat protein	coat	NA	NA	NA	NA
AXI08804.1|1526674_1526941_+	hypothetical protein	NA	NA	NA	NA	NA
AXI08805.1|1527161_1527371_+	hypothetical protein	NA	NA	NA	NA	NA
AXI08806.1|1527472_1527712_+	hypothetical protein	NA	NA	NA	NA	NA
AXI08807.1|1527740_1528442_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AXI08808.1|1528781_1529204_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXI08809.1|1529200_1529719_-	hypothetical protein	NA	NA	NA	NA	NA
AXI08810.1|1529837_1530563_-	hypothetical protein	NA	NA	NA	NA	NA
AXI08811.1|1530617_1532453_-	multidrug ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	31.0	1.6e-17
AXI08812.1|1532442_1534173_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	1.9e-49
AXI08813.1|1535172_1536270_+	gluconolaconase	NA	NA	NA	NA	NA
AXI08814.1|1536422_1536722_-|coat	spore coat protein	coat	NA	NA	NA	NA
AXI08815.1|1536740_1536935_-	hypothetical protein	NA	NA	NA	NA	NA
AXI08816.1|1536952_1538089_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.3	2.7e-15
AXI08817.1|1538107_1538476_-|coat	spore coat protein	coat	NA	NA	NA	NA
AXI08818.1|1538492_1538738_-	spore gernimation protein GerQ	NA	NA	NA	NA	NA
AXI08819.1|1539966_1540149_+	hypothetical protein	NA	NA	NA	NA	NA
AXI11126.1|1540656_1541199_+	hypothetical protein	NA	NA	NA	NA	NA
AXI08820.1|1541943_1542300_+	hypothetical protein	NA	NA	NA	NA	NA
AXI08821.1|1542637_1543105_-|coat	spore coat protein	coat	NA	NA	NA	NA
AXI08822.1|1543128_1543371_-	hypothetical protein	NA	NA	NA	NA	NA
AXI08823.1|1543387_1543651_-	hypothetical protein	NA	NA	NA	NA	NA
AXI08824.1|1544362_1544872_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXI08825.1|1545002_1545380_+	hypothetical protein	NA	NA	NA	NA	NA
AXI08826.1|1545506_1545857_+	hypothetical protein	NA	NA	NA	NA	NA
AXI08827.1|1546119_1546518_+	hypothetical protein	NA	NA	NA	NA	NA
AXI11127.1|1546686_1546887_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	72.3	3.7e-21
AXI11128.1|1547757_1547994_-	hypothetical protein	NA	A0A1B0T6A8	Bacillus_phage	55.3	4.2e-08
AXI08828.1|1547894_1548278_+	hypothetical protein	NA	NA	NA	NA	NA
AXI08829.1|1548460_1548688_+|coat	spore coat protein CotJA	coat	NA	NA	NA	NA
AXI08830.1|1548680_1548944_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
>prophage 4
CP024848	Oceanobacillus sp. 160 chromosome, complete genome	4103611	1661745	1671070	4103611		Bacillus_phage(50.0%)	9	NA	NA
AXI08938.1|1661745_1662666_-	cation transporter	NA	A0A1V0SED0	Indivirus	34.0	5.3e-14
AXI08939.1|1662678_1662981_-	transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	35.2	3.3e-05
AXI08940.1|1663252_1663705_+	CBS domain-containing protein	NA	NA	NA	NA	NA
AXI08941.1|1663801_1664044_+	hypothetical protein	NA	NA	NA	NA	NA
AXI08942.1|1664200_1664641_+	thiol-disulfide oxidoreductase	NA	A0A127AW88	Bacillus_phage	38.9	2.1e-24
AXI08943.1|1664847_1666596_+	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.2	4.6e-59
AXI08944.1|1666615_1668445_+	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	6.5e-56
AXI08945.1|1668632_1669298_+	potassium transporter Trk	NA	NA	NA	NA	NA
AXI08946.1|1669402_1671070_-	ribonuclease J	NA	A0A0C5AJ83	Bacteriophage	27.2	3.7e-05
>prophage 5
CP024848	Oceanobacillus sp. 160 chromosome, complete genome	4103611	1964284	2003033	4103611	protease,integrase,coat,transposase	Bacillus_phage(50.0%)	44	1988278:1988298	2003155:2003175
AXI09222.1|1964284_1965644_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	72.7	4.2e-108
AXI09223.1|1965930_1966212_+	hypothetical protein	NA	NA	NA	NA	NA
AXI09224.1|1966253_1966403_-	hypothetical protein	NA	W8CYF6	Bacillus_phage	55.0	1.6e-05
AXI09225.1|1966652_1967162_+	hypothetical protein	NA	NA	NA	NA	NA
AXI09226.1|1967335_1967641_+	hypothetical protein	NA	NA	NA	NA	NA
AXI09227.1|1967912_1968173_+	hypothetical protein	NA	NA	NA	NA	NA
AXI09228.1|1968543_1968789_+	hypothetical protein	NA	NA	NA	NA	NA
AXI09229.1|1969010_1969241_+	hypothetical protein	NA	NA	NA	NA	NA
AXI09230.1|1969351_1970365_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AXI09231.1|1970714_1970936_-	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	65.3	4.6e-17
AXI09232.1|1970938_1971784_-	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	70.5	7.1e-106
AXI09233.1|1972376_1973483_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
AXI09234.1|1974239_1974722_+	hypothetical protein	NA	NA	NA	NA	NA
AXI09235.1|1974834_1975044_+	hypothetical protein	NA	NA	NA	NA	NA
AXI09236.1|1975307_1975877_+	hypothetical protein	NA	NA	NA	NA	NA
AXI09237.1|1976204_1976417_+|coat	spore coat protein	coat	NA	NA	NA	NA
AXI09238.1|1976892_1977786_+	isomerase	NA	NA	NA	NA	NA
AXI09239.1|1978491_1978683_+	hypothetical protein	NA	NA	NA	NA	NA
AXI09240.1|1978868_1979198_+	hypothetical protein	NA	NA	NA	NA	NA
AXI09241.1|1979199_1979544_+	hypothetical protein	NA	NA	NA	NA	NA
AXI09242.1|1979578_1979926_-	transcriptional regulator	NA	NA	NA	NA	NA
AXI09243.1|1980045_1981107_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AXI09244.1|1981138_1982197_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AXI09245.1|1982208_1982775_+	FMN reductase	NA	NA	NA	NA	NA
AXI09246.1|1983022_1983337_+	transcriptional regulator	NA	NA	NA	NA	NA
AXI09247.1|1983662_1984436_+	glutamate racemase	NA	NA	NA	NA	NA
AXI09248.1|1984601_1985324_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
AXI09249.1|1985643_1986414_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AXI09250.1|1986528_1987287_-	3-alpha-hydroxysteroid dehydrogenase	NA	W8CYX9	Bacillus_phage	38.9	2.0e-11
AXI09251.1|1987474_1988092_+	hypothetical protein	NA	NA	NA	NA	NA
1988278:1988298	attL	AGCTAACGGGGCAGGTTAGTG	NA	NA	NA	NA
AXI11148.1|1988354_1988681_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	38.7	3.0e-12
AXI09252.1|1989191_1989746_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXI09253.1|1990405_1990537_+	Fe3+ hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXI09254.1|1990954_1991545_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXI09255.1|1991612_1992977_+	antiporter	NA	NA	NA	NA	NA
AXI09256.1|1993280_1993817_+	HXXEE domain-containing protein	NA	NA	NA	NA	NA
AXI09257.1|1993913_1994159_+	hypothetical protein	NA	NA	NA	NA	NA
AXI09258.1|1994343_1995704_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	72.7	4.2e-108
AXI09259.1|1995842_1996112_+	hypothetical protein	NA	NA	NA	NA	NA
AXI09260.1|1996108_1996399_+	hypothetical protein	NA	NA	NA	NA	NA
AXI09261.1|1996604_1997828_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXI09262.1|1999668_1999989_+	transcriptional regulator	NA	NA	NA	NA	NA
AXI09263.1|2000002_2002666_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	48.6	2.8e-180
AXI09264.1|2002775_2003033_-|integrase	integrase	integrase	NA	NA	NA	NA
2003155:2003175	attR	AGCTAACGGGGCAGGTTAGTG	NA	NA	NA	NA
>prophage 6
CP024848	Oceanobacillus sp. 160 chromosome, complete genome	4103611	2052686	2057290	4103611		uncultured_Caudovirales_phage(16.67%)	9	NA	NA
AXI09308.1|2052686_2053016_+	YolD-like family protein	NA	A0A2H4JAP8	uncultured_Caudovirales_phage	30.2	3.4e-08
AXI09309.1|2053054_2053273_-	hypothetical protein	NA	NA	NA	NA	NA
AXI09310.1|2053286_2054054_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	29.8	1.7e-18
AXI09311.1|2054144_2054306_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
AXI09312.1|2054321_2054528_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
AXI09313.1|2054660_2055152_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	45.1	1.3e-38
AXI09314.1|2055175_2056132_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	72.6	8.2e-135
AXI09315.1|2056198_2056789_-	metal-dependent phosphohydrolase	NA	S4W232	Pandoravirus	32.2	4.9e-13
AXI09316.1|2057089_2057290_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	63.1	1.7e-18
