The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031321	Escherichia coli strain Es_ST2350_SE1_NDM_03_2018 chromosome, complete genome	4733230	149196	213141	4733230	protease,holin,tail,capsid,tRNA,integrase,plate,lysis,portal,terminase,head	Escherichia_phage(45.45%)	69	154254:154281	185872:185899
AXK26820.1|149196_150600_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
AXK26821.1|150596_151319_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
AXK26822.1|151509_151842_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AXK26823.1|152050_152347_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AXK26824.1|152348_152645_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXK26825.1|152747_154109_+|protease	protease	protease	Q6DW11	Phage_TP	100.0	1.1e-217
154254:154281	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
AXK30928.1|154381_154636_-	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AXK26826.1|154681_155845_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	6.3e-206
AXK26827.1|155844_156324_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	98.1	9.6e-84
AXK26828.1|156338_158786_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	94.8	0.0e+00
AXK30929.1|158778_158898_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
AXK26829.1|158930_159206_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AXK26830.1|159262_159781_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AXK26831.1|159793_160984_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
AXK26832.1|162200_162728_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	95.4	1.4e-91
AXK26833.1|162731_165050_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.8	2.4e-212
AXK26834.1|165060_165591_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	100.0	1.0e-102
AXK26835.1|165583_166492_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
AXK26836.1|166496_166844_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	6.5e-58
AXK26837.1|166840_167476_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	7.2e-111
AXK26838.1|167542_167995_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	6.9e-76
AXK26839.1|167987_168455_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	5.1e-82
AXK26840.1|168417_168591_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	1.5e-23
AXK26841.1|168562_168988_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	97.2	7.2e-67
AXK26842.1|168975_169401_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	94.3	1.4e-57
AXK26843.1|169415_169913_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AXK26844.1|169912_170194_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AXK26845.1|170197_170401_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AXK26846.1|170400_170910_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AXK26847.1|171009_171753_-|terminase	terminase	terminase	Q94MK1	Enterobacteria_phage	100.0	2.1e-122
AXK26848.1|171756_172830_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.4	1.1e-199
AXK26849.1|173915_175688_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AXK26850.1|175687_176716_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	6.2e-197
AXK26851.1|176774_177347_-	hypothetical protein	NA	NA	NA	NA	NA
AXK26852.1|177339_178773_-	ABC transporter	NA	A0A2I7RNF1	Vibrio_phage	30.1	3.9e-40
AXK26853.1|178969_179164_-	hypothetical protein	NA	NA	NA	NA	NA
AXK26854.1|179937_182214_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
AXK26855.1|182203_182479_-	hypothetical protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
AXK26856.1|182475_182700_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AXK26857.1|182699_183002_-	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	8.5e-46
AXK26858.1|183001_183226_-	DUF2732 family protein	NA	A0A0F7LBR4	Escherichia_phage	97.3	5.2e-32
AXK26859.1|183289_183790_-	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AXK26860.1|183967_184243_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
AXK26861.1|184364_184664_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
AXK26862.1|184778_185792_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
AXK26863.1|185919_186069_-	hypothetical protein	NA	NA	NA	NA	NA
185872:185899	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
AXK26864.1|186056_186374_-	hypothetical protein	NA	NA	NA	NA	NA
AXK26865.1|186779_187679_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
AXK26866.1|187760_188540_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AXK26867.1|188639_189680_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AXK26868.1|189727_191083_-	galactitol permease IIC component	NA	NA	NA	NA	NA
AXK26869.1|191086_191371_-	galactitol-specific phosphotransferase enzyme IIB component	NA	NA	NA	NA	NA
AXK26870.1|191401_191854_-	galactitol-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AXK26871.1|191863_193126_-	tagatose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AXK26872.1|194317_195370_-	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AXK26873.1|195626_196904_+	MFS transporter	NA	NA	NA	NA	NA
AXK26874.1|196900_197905_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
AXK26875.1|199637_200456_-	hydrolase	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
AXK26876.1|200520_201321_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AXK26877.1|201317_202106_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AXK26878.1|202328_202601_-	transcriptional regulator	NA	NA	NA	NA	NA
AXK26879.1|202721_203546_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AXK26880.1|203764_204103_+	nickel/cobalt homeostasis protein RcnB	NA	NA	NA	NA	NA
AXK26881.1|205236_207717_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AXK26882.1|207732_208407_-	fimbrial assembly protein	NA	NA	NA	NA	NA
AXK26883.1|208487_209030_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AXK26884.1|209322_209604_-	DUF2574 family protein	NA	NA	NA	NA	NA
AXK26885.1|209866_210976_-	protein mrp	NA	NA	NA	NA	NA
AXK26886.1|211107_213141_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 2
CP031321	Escherichia coli strain Es_ST2350_SE1_NDM_03_2018 chromosome, complete genome	4733230	225652	235093	4733230		Enterobacteria_phage(85.71%)	10	NA	NA
AXK26890.1|225652_226789_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
AXK26891.1|226785_228786_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
AXK26892.1|228910_229372_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AXK26893.1|229411_229882_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AXK26894.1|229928_230648_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXK26895.1|230644_232330_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AXK26896.1|232551_233283_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AXK26897.1|233342_233450_+	hypothetical protein	NA	NA	NA	NA	NA
AXK26898.1|233430_234162_-	ABC transporter permease	NA	NA	NA	NA	NA
AXK26899.1|234166_235093_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.7e-24
>prophage 3
CP031321	Escherichia coli strain Es_ST2350_SE1_NDM_03_2018 chromosome, complete genome	4733230	815099	822239	4733230		Escherichia_phage(83.33%)	6	NA	NA
AXK27394.1|815099_817661_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
AXK27395.1|817766_818423_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
AXK27396.1|818473_819241_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AXK27397.1|819436_820345_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AXK27398.1|820341_821604_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AXK27399.1|821600_822239_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 4
CP031321	Escherichia coli strain Es_ST2350_SE1_NDM_03_2018 chromosome, complete genome	4733230	1850934	1861327	4733230		Enterobacteria_phage(100.0%)	12	NA	NA
AXK28331.1|1850934_1852116_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	92.7	4.3e-210
AXK28332.1|1852251_1853688_+	ATP-binding protein	NA	NA	NA	NA	NA
AXK28333.1|1853696_1854623_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
AXK28334.1|1854826_1855399_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	98.9	3.1e-97
AXK28335.1|1855413_1855659_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	98.8	3.9e-41
AXK28336.1|1856737_1856929_+	hypothetical protein	NA	NA	NA	NA	NA
AXK28337.1|1856941_1857208_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AXK28338.1|1857204_1857795_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	98.5	8.2e-69
AXK28339.1|1857787_1858075_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	98.9	5.1e-48
AXK28340.1|1858067_1858523_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
AXK28341.1|1858658_1858979_+	hypothetical protein	NA	NA	NA	NA	NA
AXK28342.1|1858993_1861327_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
>prophage 5
CP031321	Escherichia coli strain Es_ST2350_SE1_NDM_03_2018 chromosome, complete genome	4733230	2965947	2972726	4733230		Enterobacteria_phage(100.0%)	9	NA	NA
AXK29302.1|2965947_2967153_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	60.7	5.5e-144
AXK29303.1|2967127_2968510_+	hypothetical protein	NA	NA	NA	NA	NA
AXK31030.1|2968422_2968659_-	hypothetical protein	NA	NA	NA	NA	NA
AXK29304.1|2968711_2969284_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	2.5e-94
AXK29305.1|2969357_2969858_-	transactivation protein	NA	NA	NA	NA	NA
AXK29306.1|2969854_2970589_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	1.4e-129
AXK29307.1|2971140_2971407_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	6.3e-45
AXK29308.1|2971990_2972278_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AXK29309.1|2972270_2972726_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	97.3	5.2e-63
>prophage 6
CP031321	Escherichia coli strain Es_ST2350_SE1_NDM_03_2018 chromosome, complete genome	4733230	3243246	3303391	4733230	protease,capsid,tRNA,tail,integrase,transposase,lysis,portal,terminase,head	Enterobacteria_phage(54.55%)	69	3253408:3253454	3303815:3303861
AXK29553.1|3243246_3244632_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
AXK29554.1|3244667_3245189_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AXK29555.1|3245296_3245509_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AXK29556.1|3245510_3246377_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AXK29557.1|3246857_3247400_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AXK29558.1|3247619_3248312_+	molecular chaperone FimC	NA	NA	NA	NA	NA
AXK29559.1|3250964_3251972_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AXK29560.1|3251982_3252498_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AXK29561.1|3252500_3253133_-	DNA-binding response regulator	NA	NA	NA	NA	NA
3253408:3253454	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AXK29562.1|3253467_3254631_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	4.4e-199
AXK29563.1|3254486_3254858_-	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	4.7e-46
AXK29564.1|3254829_3255108_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AXK29565.1|3255164_3255374_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	4.4e-33
AXK29566.1|3255764_3255956_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
AXK29567.1|3255928_3256111_-	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
AXK29568.1|3256783_3257569_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
AXK29569.1|3257574_3257871_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
AXK29570.1|3257946_3258153_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AXK29571.1|3258748_3259504_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AXK29572.1|3259542_3259773_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AXK29573.1|3259842_3260382_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
AXK29574.1|3260378_3261398_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
AXK29575.1|3262092_3262395_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
AXK29576.1|3262462_3262795_+	multidrug SMR transporter	NA	NA	NA	NA	NA
AXK29577.1|3265041_3265593_+	kinase inhibitor	NA	NA	NA	NA	NA
AXK29578.1|3265602_3266400_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXK29579.1|3266516_3266618_+	hypothetical protein	NA	NA	NA	NA	NA
AXK29580.1|3266614_3267070_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
AXK29581.1|3267069_3267240_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
AXK29582.1|3267232_3267523_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
AXK29583.1|3267519_3267882_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AXK29584.1|3267878_3268019_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
AXK29585.1|3268104_3268488_+	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AXK29586.1|3268676_3269759_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
AXK29587.1|3270348_3270564_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AXK29588.1|3270563_3271061_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
AXK29589.1|3271057_3271519_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	99.3	2.4e-76
AXK29590.1|3271550_3271844_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	89.7	1.3e-43
AXK29591.1|3272204_3272399_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AXK29592.1|3272788_3273334_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AXK29593.1|3273308_3275234_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AXK29594.1|3275230_3275437_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AXK29595.1|3275433_3277035_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
AXK29596.1|3277015_3278335_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	4.0e-233
AXK29597.1|3278344_3278677_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
AXK29598.1|3278732_3279758_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.1e-188
AXK29599.1|3279799_3280195_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	4.4e-58
AXK29600.1|3280206_3280560_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
AXK29601.1|3280571_3281150_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
AXK29602.1|3281146_3281542_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AXK31037.1|3281549_3282290_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.4e-129
AXK29603.1|3282305_3282728_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AXK29604.1|3282709_3283144_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AXK29605.1|3283136_3285716_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.3	0.0e+00
AXK29606.1|3285712_3286042_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
AXK29607.1|3286041_3286740_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	9.5e-133
AXK29608.1|3286786_3287488_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	2.1e-132
AXK29609.1|3287385_3288057_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
AXK29610.1|3288116_3291614_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.8	0.0e+00
AXK29611.1|3291684_3292284_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
AXK31038.1|3292348_3295375_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	7.2e-68
AXK29612.1|3295371_3296091_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	73.1	4.6e-90
AXK29613.1|3296060_3297274_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
AXK29614.1|3297543_3298119_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	7.9e-101
AXK29615.1|3298216_3298807_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.3	4.7e-24
AXK29616.1|3299125_3299359_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
AXK31039.1|3299906_3300533_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXK29617.1|3301438_3302188_+	transcriptional regulator	NA	NA	NA	NA	NA
AXK29618.1|3302437_3303391_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
3303815:3303861	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 7
CP031321	Escherichia coli strain Es_ST2350_SE1_NDM_03_2018 chromosome, complete genome	4733230	4021333	4084567	4733230	protease,holin,tail,capsid,integrase,plate,portal,terminase,head	Enterobacteria_phage(34.21%)	68	4013828:4013841	4023841:4023854
4013828:4013841	attL	GCTGAAGAAGTAAA	NA	NA	NA	NA
AXK30262.1|4021333_4022464_-|integrase	integrase	integrase	O21940	Phage_21	51.1	5.7e-103
AXK30263.1|4022441_4022690_-	excisionase	NA	NA	NA	NA	NA
AXK30264.1|4022753_4025225_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	5.5e-58
4023841:4023854	attR	TTTACTTCTTCAGC	NA	NA	NA	NA
AXK30265.1|4025305_4025509_-	DUF1482 family protein	NA	NA	NA	NA	NA
AXK30266.1|4025511_4025694_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AXK30267.1|4026180_4026798_-	hypothetical protein	NA	NA	NA	NA	NA
AXK31072.1|4026757_4026913_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AXK30268.1|4027178_4027598_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
AXK30269.1|4027698_4027980_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
AXK30270.1|4027963_4028389_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AXK30271.1|4028460_4029531_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.6	1.4e-63
AXK30272.1|4029571_4029994_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	86.3	1.5e-61
AXK31073.1|4034247_4034463_+	hypothetical protein	NA	NA	NA	NA	NA
AXK30273.1|4034621_4034834_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
AXK30274.1|4035292_4035571_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	7.4e-12
AXK30275.1|4035572_4036622_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.5	5.9e-110
AXK30276.1|4036634_4037003_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	8.5e-32
AXK31074.1|4036995_4037364_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	3.9e-53
AXK30277.1|4037514_4038333_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXK30278.1|4038618_4038816_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
AXK30279.1|4038966_4040013_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	89.6	7.7e-187
AXK30280.1|4041515_4041908_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	86.2	8.2e-49
AXK31075.1|4041897_4042173_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	96.7	2.8e-43
AXK30281.1|4042175_4042553_+	M15 family peptidase	NA	Q9MBZ3	Enterobacteria_phage	99.2	3.5e-65
AXK30282.1|4042924_4043221_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	93.9	6.2e-49
AXK30283.1|4043280_4043949_+	hypothetical protein	NA	G8EY51	Synechococcus_phage	28.8	3.5e-07
AXK30284.1|4043948_4044278_+	hypothetical protein	NA	NA	NA	NA	NA
AXK30285.1|4044709_4045327_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AXK30286.1|4045280_4047260_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	45.3	4.5e-135
AXK30287.1|4047256_4047508_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AXK30288.1|4047516_4049157_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	37.5	9.2e-94
AXK30289.1|4049153_4050014_+	S49 family peptidase	NA	A0A2H4PRE9	Proteus_phage	46.4	1.4e-48
AXK30290.1|4050006_4050585_+	hypothetical protein	NA	NA	NA	NA	NA
AXK31076.1|4050671_4050986_+|head	head decoration protein	head	NA	NA	NA	NA
AXK30291.1|4051041_4052097_+|capsid	major capsid protein	capsid	A0A2D1GMR5	Marinobacter_phage	31.5	9.6e-36
AXK30292.1|4052098_4052284_+	hypothetical protein	NA	NA	NA	NA	NA
AXK30293.1|4052267_4052600_+	hypothetical protein	NA	NA	NA	NA	NA
AXK30294.1|4052599_4053160_+|tail	phage tail protein	tail	NA	NA	NA	NA
AXK30295.1|4053173_4053410_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AXK30296.1|4053406_4054909_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	43.9	2.0e-103
AXK30297.1|4054948_4055314_+|tail	phage tail protein	tail	NA	NA	NA	NA
AXK30298.1|4055316_4055595_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AXK30299.1|4055730_4057689_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	42.8	2.5e-21
AXK30300.1|4057699_4059106_+	multidrug DMT transporter permease	NA	J7FAD8	Agrobacterium_phage	33.0	4.0e-05
AXK30301.1|4059102_4060191_+	hypothetical protein	NA	Q8SBG7	Shigella_phage	31.4	2.1e-38
AXK30302.1|4060187_4060769_+|plate	baseplate assembly protein	plate	Q8SBG6	Shigella_phage	34.5	5.5e-17
AXK30303.1|4060770_4061208_+	hypothetical protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	41.6	4.3e-22
AXK30304.1|4061209_4062364_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	32.2	6.4e-33
AXK30305.1|4062360_4066704_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	32.5	3.0e-14
AXK30306.1|4066750_4067542_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	55.8	2.6e-17
AXK30307.1|4067551_4068091_+|tail	tail assembly chaperone	tail	A0A1B0VCD0	Salmonella_phage	41.3	7.3e-32
AXK30308.1|4068310_4069111_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXK30309.1|4069728_4070292_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	71.2	2.9e-47
AXK30310.1|4070936_4071443_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AXK30311.1|4071488_4071989_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AXK30312.1|4072074_4072254_-	hypothetical protein	NA	NA	NA	NA	NA
AXK30313.1|4072634_4073441_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AXK30314.1|4073440_4074634_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AXK31077.1|4074645_4076004_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
AXK30315.1|4076007_4077603_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AXK30316.1|4077602_4079165_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AXK31078.1|4079256_4079301_-	trp operon leader peptide	NA	NA	NA	NA	NA
AXK30317.1|4079438_4080320_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
AXK30318.1|4080316_4080937_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AXK30319.1|4081037_4081910_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AXK30320.1|4081949_4082540_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AXK30321.1|4082536_4083295_-	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
AXK30322.1|4083514_4084567_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 1
CP031322	Escherichia coli strain Es_ST2350_SE1_NDM_03_2018 plasmid pEsST2350_SE_NDM, complete sequence	75645	19891	53620	75645	transposase,protease,integrase	Escherichia_phage(33.33%)	39	22239:22253	54337:54351
AXK31119.1|19891_21262_-|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
AXK31120.1|21462_22146_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	1.9e-130
22239:22253	attL	GCTGAAGGATCTGGA	NA	NA	NA	NA
AXK31121.1|24833_25343_-	ROS/MUCR transcriptional regulator domain protein	NA	NA	NA	NA	NA
AXK31122.1|25390_27478_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
AXK31123.1|27490_28441_-	DsbC family protein	NA	NA	NA	NA	NA
AXK31180.1|28451_29714_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
AXK31181.1|29758_30034_-	lytic transglycosylase	NA	NA	NA	NA	NA
AXK31182.1|30258_30642_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
AXK31124.1|30721_31375_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXK31125.1|31467_31725_+	antitoxin	NA	NA	NA	NA	NA
AXK31126.1|31726_32059_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AXK31127.1|32403_32838_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	55.4	4.7e-29
AXK31128.1|32786_34091_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	50.8	1.2e-112
AXK31129.1|34113_34962_-	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	38.9	5.0e-27
AXK31130.1|34964_35285_-	chromosome segregation protein ParM	NA	NA	NA	NA	NA
AXK31183.1|35429_35681_-	hypothetical protein	NA	NA	NA	NA	NA
AXK31131.1|36136_36346_-	hypothetical protein	NA	NA	NA	NA	NA
AXK31132.1|36348_36567_-	hypothetical protein	NA	NA	NA	NA	NA
AXK31133.1|36611_37295_-	hypothetical protein	NA	NA	NA	NA	NA
AXK31134.1|37291_37564_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXK31135.1|37581_38856_-	RelB antitoxin	NA	NA	NA	NA	NA
AXK31136.1|39382_39727_+	hypothetical protein	NA	NA	NA	NA	NA
AXK31137.1|39909_40494_+	hypothetical protein	NA	NA	NA	NA	NA
AXK31138.1|40839_41523_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	4.6e-132
AXK31139.1|42256_43798_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXK31140.1|44202_45042_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXK31185.1|45035_45371_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AXK31184.1|45263_45629_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
AXK31141.1|45632_46508_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXK31142.1|47334_47994_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AXK31143.1|47998_48364_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
AXK31144.1|48367_49180_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
AXK31145.1|49488_50193_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXK31146.1|50846_51308_+	hypothetical protein	NA	NA	NA	NA	NA
AXK31147.1|51304_51553_+	XRE family transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	53.0	1.6e-10
AXK31148.1|51545_52133_+	restriction endonuclease	NA	NA	NA	NA	NA
AXK31149.1|52129_52615_+	hypothetical protein	NA	NA	NA	NA	NA
AXK31150.1|52611_52860_+	hypothetical protein	NA	NA	NA	NA	NA
AXK31151.1|52879_53620_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	9.5e-22
54337:54351	attR	GCTGAAGGATCTGGA	NA	NA	NA	NA
