The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	7692	78816	4900521	protease,transposase	Ralstonia_phage(30.0%)	55	NA	NA
AXM23297.1|7692_8529_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXM23298.1|8715_9522_+	M48 family peptidase	NA	NA	NA	NA	NA
AXM23299.1|9798_10992_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AXM23300.1|11145_11817_+	energy transducer TonB	NA	NA	NA	NA	NA
AXM23301.1|11901_12663_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
AXM23302.1|12709_13132_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXM23303.1|13135_13549_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXM23304.1|13844_14612_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AXM23305.1|14622_14892_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23306.1|14966_16427_-	cardiolipin synthase	NA	NA	NA	NA	NA
AXM23307.1|17073_18084_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
AXM23308.1|18355_19558_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AXM23309.1|19699_21838_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
AXM26720.1|22048_22342_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23310.1|22458_23004_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23311.1|23117_24098_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	56.2	5.3e-89
AXM23312.1|24145_25312_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AXM23313.1|25458_26025_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
AXM26721.1|27499_28708_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
AXM23314.1|29335_30358_-	sugar kinase	NA	NA	NA	NA	NA
AXM23315.1|31180_32149_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXM23316.1|33595_34477_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.5e-05
AXM23317.1|35078_36455_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
AXM23318.1|39467_39710_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23319.1|39651_39975_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23320.1|40105_40492_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23321.1|40440_41421_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
AXM23322.1|41780_42032_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23323.1|42039_43329_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
AXM23324.1|43768_44104_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23325.1|44378_44810_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23326.1|45158_46568_-	FAD-binding protein	NA	NA	NA	NA	NA
AXM23327.1|47885_48146_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23328.1|48162_48495_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23329.1|48494_48953_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23330.1|49312_50527_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
AXM23331.1|51047_51845_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23332.1|53560_54526_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM23333.1|54522_54702_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23334.1|54944_56264_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM23335.1|56381_57428_+	methylamine utilization protein	NA	NA	NA	NA	NA
AXM23336.1|58229_58862_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AXM23337.1|58878_61041_-	glycogen debranching enzyme GlgX	NA	NA	NA	NA	NA
AXM23338.1|61155_61341_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
AXM23339.1|61363_63967_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
AXM26722.1|63963_65853_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AXM23340.1|65909_67667_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
AXM23341.1|67669_69904_-	glycogen-branching enzyme	NA	NA	NA	NA	NA
AXM23342.1|69900_71484_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
AXM23343.1|71957_73586_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXM23344.1|73582_74947_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
AXM23345.1|75139_76081_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AXM23346.1|76098_76311_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23347.1|76321_78046_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
AXM23348.1|78052_78816_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	109333	135585	4900521	transposase,holin	Ralstonia_phage(50.0%)	24	NA	NA
AXM23375.1|109333_110302_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXM23376.1|110514_111834_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM23377.1|112022_113006_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
AXM23378.1|113727_116136_+	serine kinase	NA	NA	NA	NA	NA
AXM26725.1|117011_118640_+	type III secretion system effector XopAE	NA	NA	NA	NA	NA
AXM23379.1|119197_119581_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23380.1|119577_120063_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AXM23381.1|120066_120429_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23382.1|120545_121982_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
AXM23383.1|122223_123075_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
AXM23384.1|123534_123852_-	ATP-binding protein	NA	NA	NA	NA	NA
AXM23385.1|124157_125045_-	TIGR01777 family protein	NA	NA	NA	NA	NA
AXM23386.1|125751_126702_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
AXM23387.1|126815_127001_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23388.1|127092_127365_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23389.1|127405_127687_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23390.1|127825_128884_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM23391.1|129024_129972_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
AXM23392.1|130226_130538_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23393.1|131810_131993_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23394.1|132004_132475_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AXM23395.1|132644_133337_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23396.1|133428_133827_+	host attachment protein	NA	NA	NA	NA	NA
AXM23397.1|134628_135585_+|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 3
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	219996	385023	4900521	transposase,tRNA	Bacillus_phage(15.79%)	114	NA	NA
AXM23437.1|219996_221901_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AXM23438.1|222161_222341_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23439.1|222474_222942_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23440.1|223099_224059_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
AXM23441.1|224043_224661_+	YdcF family protein	NA	NA	NA	NA	NA
AXM23442.1|224703_225123_+	isopropylmalate/homocitrate/citramalate synthase	NA	NA	NA	NA	NA
AXM23443.1|225375_226281_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	39.2	4.4e-37
AXM23444.1|226529_227414_-	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
AXM23445.1|227477_228260_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXM26732.1|228304_229066_-	pimeloyl-[acyl-carrier protein] methyl ester esterase	NA	NA	NA	NA	NA
AXM23446.1|229229_229559_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23447.1|229877_230969_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
AXM23448.1|231037_232636_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AXM23449.1|232800_234045_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AXM23450.1|234496_235126_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
AXM23451.1|235332_237309_+	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
AXM23452.1|238695_239361_-	DUF480 domain-containing protein	NA	NA	NA	NA	NA
AXM23453.1|239640_240651_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
AXM23454.1|240647_241379_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AXM23455.1|241732_243262_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.0e-46
AXM23456.1|243371_246404_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23457.1|246702_249741_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23458.1|249905_250958_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AXM23459.1|251126_251372_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23460.1|251370_252336_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23461.1|252335_254996_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
AXM23462.1|256814_257033_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AXM23463.1|259592_260078_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
AXM23464.1|260109_260436_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM23465.1|260657_261302_-	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
AXM23466.1|261442_262333_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
AXM23467.1|262460_262943_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AXM23468.1|265978_266512_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23469.1|269327_270386_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
AXM23470.1|270371_270578_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23471.1|270693_271767_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
AXM23472.1|272529_273582_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
AXM23473.1|274229_275360_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
AXM26733.1|276676_277066_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23474.1|277273_277480_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23475.1|277711_278680_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM23476.1|278933_281096_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
AXM23477.1|281643_282948_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
AXM23478.1|283007_283610_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
AXM23479.1|283606_285511_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
AXM23480.1|294829_295645_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
AXM23481.1|295991_296954_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM23482.1|297058_297821_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23483.1|299620_300679_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
AXM23484.1|300689_300980_-	STAS domain-containing protein	NA	NA	NA	NA	NA
AXM23485.1|300969_301632_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
AXM23486.1|301628_302180_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AXM23487.1|302191_302941_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM23488.1|302940_303735_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
AXM23489.1|304119_304407_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23490.1|304425_304983_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXM23491.1|305000_305966_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM23492.1|306810_307767_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
AXM23493.1|308254_309223_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM23494.1|309800_310599_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23495.1|310730_311945_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
AXM23496.1|312004_312835_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23497.1|312997_314233_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXM23498.1|315631_316060_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26734.1|316079_316520_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AXM23499.1|316422_316728_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23500.1|317035_318790_-	polyvinylalcohol dehydrogenase	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
AXM23501.1|319668_320431_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23502.1|320484_321069_-	gluconokinase	NA	NA	NA	NA	NA
AXM23503.1|321226_322609_+	MFS transporter	NA	NA	NA	NA	NA
AXM26735.1|322611_325011_+	NdvB protein	NA	NA	NA	NA	NA
AXM23504.1|325114_327757_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23505.1|328163_328364_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26736.1|328504_331954_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AXM23506.1|332146_332731_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23507.1|333207_333984_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXM23508.1|334164_335466_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AXM26737.1|335462_335828_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
AXM23509.1|336264_337746_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
AXM23510.1|337938_338904_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM23511.1|339730_341893_+	type III secretion system effector protein	NA	NA	NA	NA	NA
AXM23512.1|342019_344188_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
AXM23513.1|344825_345455_-	acyltransferase	NA	NA	NA	NA	NA
AXM23514.1|345457_345889_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AXM23515.1|345981_346524_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
AXM23516.1|346619_347372_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AXM23517.1|347596_347986_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM23518.1|348099_349773_-	ubiquinone biosynthesis protein UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
AXM23519.1|349769_350414_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
AXM23520.1|350423_350618_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23521.1|354098_354383_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23522.1|354734_355533_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23523.1|355592_356356_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23524.1|360309_361275_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM23525.1|362335_363442_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23526.1|365053_365236_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23527.1|365235_366174_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AXM23528.1|366292_367042_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	5.6e-54
AXM23529.1|367044_367836_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM23530.1|367853_368849_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
AXM23531.1|368951_369713_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
AXM23532.1|369797_370799_-	cation transporter	NA	NA	NA	NA	NA
AXM23533.1|370864_371137_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AXM26738.1|371622_372210_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23534.1|372206_372407_+	transcriptional regulator	NA	NA	NA	NA	NA
AXM23535.1|372467_374069_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXM23536.1|374100_374847_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
AXM23537.1|374843_376037_+	ABC transporter permease	NA	NA	NA	NA	NA
AXM23538.1|376446_377469_-	energy transducer TonB	NA	NA	NA	NA	NA
AXM23539.1|377608_379174_-	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
AXM23540.1|379184_380198_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
AXM23541.1|380187_380889_-	peptidase	NA	NA	NA	NA	NA
AXM26739.1|381072_384087_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM23542.1|384260_385023_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	567646	617144	4900521	transposase,tRNA,integrase	Stenotrophomonas_phage(25.0%)	46	575797:575813	613932:613948
AXM23676.1|567646_568612_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM23677.1|569079_570399_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM23678.1|570928_571444_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXM23679.1|571846_574069_-	primosomal protein N'	NA	NA	NA	NA	NA
AXM23680.1|574537_575563_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23681.1|575546_576149_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
575797:575813	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
AXM23682.1|576479_577424_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23683.1|577383_577665_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23684.1|577942_579319_+	MATE family efflux transporter	NA	NA	NA	NA	NA
AXM23685.1|579403_581305_+	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
AXM23686.1|581490_581706_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23687.1|581812_582589_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXM23688.1|582750_583425_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AXM23689.1|583421_584195_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AXM23690.1|584418_584982_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AXM23691.1|584992_587485_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
AXM23692.1|587667_588942_-	RDD family protein	NA	NA	NA	NA	NA
AXM23693.1|588983_589706_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
AXM23694.1|589746_590220_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AXM23695.1|590262_591405_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AXM23696.1|591476_592613_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
AXM23697.1|592745_593258_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
AXM23698.1|593651_594575_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
AXM23699.1|594574_595888_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
AXM23700.1|595938_597660_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AXM23701.1|597824_599102_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
AXM23702.1|599299_600124_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AXM23703.1|600124_601183_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
AXM23704.1|601348_602815_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26761.1|602811_603315_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23705.1|603424_604558_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
AXM23706.1|604800_605322_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXM23707.1|605521_606436_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
AXM23708.1|606536_606977_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AXM23709.1|607085_608960_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
AXM23710.1|609152_609473_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23711.1|609624_609843_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23712.1|610101_611376_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.4e-110
AXM23713.1|611288_611552_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	71.4	7.2e-17
AXM23714.1|611509_611716_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23715.1|611712_611985_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26762.1|611981_612227_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23716.1|614162_615398_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
613932:613948	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
AXM23717.1|615466_615856_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23718.1|615852_616056_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23719.1|616178_617144_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	721759	779734	4900521	transposase	Enterobacteria_phage(25.0%)	54	NA	NA
AXM23806.1|721759_722725_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM26773.1|725133_726405_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM23807.1|726612_728442_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.5	1.3e-133
AXM23808.1|728823_729297_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23809.1|729528_730104_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23810.1|730136_730899_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM26774.1|731015_732050_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM23811.1|732266_732791_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
AXM23812.1|732963_733932_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXM23813.1|734107_735214_-	copper resistance protein B	NA	NA	NA	NA	NA
AXM23814.1|735210_737058_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
AXM23815.1|737144_737561_-	copper homeostasis protein	NA	NA	NA	NA	NA
AXM23816.1|737696_738800_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
AXM23817.1|738843_740868_+	oligopeptidase A	NA	NA	NA	NA	NA
AXM23818.1|741041_741863_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23819.1|741976_743185_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AXM23820.1|743184_743700_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AXM23821.1|743698_744046_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23822.1|744045_745125_+	DNA polymerase IV	NA	NA	NA	NA	NA
AXM23823.1|745266_745917_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AXM23824.1|746228_746627_-	transcriptional regulator	NA	NA	NA	NA	NA
AXM23825.1|746623_747106_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AXM23826.1|747430_748105_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AXM26775.1|748219_748555_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23827.1|748747_749101_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AXM23828.1|749062_749242_+	GTP-binding protein	NA	NA	NA	NA	NA
AXM23829.1|749513_750896_-	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	1.4e-55
AXM23830.1|750988_751114_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AXM23831.1|751275_752265_+	FAA hydrolase family protein	NA	NA	NA	NA	NA
AXM23832.1|752308_752935_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
AXM23833.1|753273_754413_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
AXM23834.1|754505_754889_+	DUF4398 domain-containing protein	NA	NA	NA	NA	NA
AXM23835.1|754885_755776_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23836.1|756117_756336_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AXM26776.1|756577_757948_+	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	38.8	2.6e-49
AXM23837.1|758038_759232_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AXM23838.1|759278_760079_+	FkbM family methyltransferase	NA	H8ZJI6	Ostreococcus_tauri_virus	28.0	3.5e-06
AXM23839.1|760113_761190_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SG19	Hokovirus	21.8	4.9e-11
AXM23840.1|762221_763148_+	glycosyltransferase	NA	NA	NA	NA	NA
AXM23841.1|763168_763459_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23842.1|763449_764613_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AXM23843.1|764618_765671_+	acyltransferase	NA	A9YX16	Burkholderia_phage	33.9	1.5e-41
AXM23844.1|765757_767077_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM26777.1|767392_768577_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
AXM23845.1|769106_770420_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
AXM23846.1|770409_771228_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM23847.1|771450_772392_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
AXM23848.1|772391_773138_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
AXM26778.1|773363_774419_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
AXM23849.1|774474_775362_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
AXM23850.1|775358_775916_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
AXM23851.1|775912_776821_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
AXM23852.1|776937_778341_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
AXM23853.1|778387_779734_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	1.5e-33
>prophage 6
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	791998	835301	4900521	transposase,tRNA	Ralstonia_phage(22.22%)	28	NA	NA
AXM23866.1|791998_793693_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AXM23867.1|793804_794209_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AXM23868.1|794340_795114_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AXM23869.1|795124_795592_+	alanine acetyltransferase	NA	NA	NA	NA	NA
AXM26779.1|795597_796071_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AXM23870.1|796629_797949_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM23871.1|798106_799426_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM23872.1|799638_800607_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AXM23873.1|800756_802076_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM26780.1|802308_804354_+	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	8.2e-15
AXM23874.1|804620_805661_-	pectate lyase	NA	NA	NA	NA	NA
AXM23875.1|807250_808048_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23876.1|808700_809015_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AXM23877.1|809202_810305_-|transposase	IS3-like element ISXo17 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	7.2e-42
AXM23878.1|811241_814184_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.8	6.4e-130
AXM23879.1|814391_814817_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AXM23880.1|814857_815163_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23881.1|815162_816635_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	6.2e-49
AXM23882.1|816742_817825_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AXM26781.1|817821_818928_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AXM23883.1|819102_820071_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM23884.1|820502_820970_-	RDD family protein	NA	NA	NA	NA	NA
AXM23885.1|821396_822368_+	site-specific tyrosine recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.9	6.4e-18
AXM23886.1|822822_823620_+	DsbC family protein	NA	NA	NA	NA	NA
AXM23887.1|824018_828071_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	7.5e-121
AXM23888.1|828328_828592_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23889.1|829048_832846_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23890.1|834344_835301_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	2.4e-41
>prophage 7
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	871012	922641	4900521	protease,transposase	Ralstonia_phage(18.18%)	44	NA	NA
AXM23915.1|871012_871978_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM23916.1|872368_872944_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AXM23917.1|873056_873566_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
AXM23918.1|873664_873859_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AXM23919.1|873948_874926_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
AXM23920.1|875155_875596_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
AXM23921.1|875873_876818_+	[acyl-carrier-protein] S-malonyltransferase	NA	NA	NA	NA	NA
AXM23922.1|876900_877644_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
AXM23923.1|877848_878088_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
AXM23924.1|878229_879465_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AXM23925.1|879635_880991_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
AXM23926.1|881051_882125_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
AXM23927.1|882121_883081_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
AXM23928.1|883077_883431_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AXM26783.1|883954_884428_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26784.1|885448_885775_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23929.1|886010_887609_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
AXM23930.1|887754_888651_+	methylisocitrate lyase	NA	NA	NA	NA	NA
AXM23931.1|888726_889881_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
AXM23932.1|890061_892653_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
AXM23933.1|892975_893113_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXM23934.1|893196_893394_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23935.1|893385_894585_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
AXM23936.1|895034_896003_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
AXM23937.1|896244_898461_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM23938.1|898539_899538_+	nucleoside hydrolase	NA	NA	NA	NA	NA
AXM23939.1|899647_899830_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23940.1|900809_903797_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM23941.1|903971_904919_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
AXM23942.1|905423_905960_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23943.1|906030_907350_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM23944.1|907694_908657_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.7e-42
AXM23945.1|908790_909351_-	bacterioferritin	NA	NA	NA	NA	NA
AXM23946.1|909393_909876_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
AXM23947.1|910038_910515_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXM23948.1|910925_911825_+	J domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
AXM23949.1|912064_912451_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
AXM23950.1|913080_914208_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
AXM23951.1|914207_915071_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
AXM23952.1|915364_915550_+	DUF2065 family protein	NA	NA	NA	NA	NA
AXM23953.1|915887_917180_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.5	8.4e-74
AXM23954.1|917505_920178_+	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	2.6e-77
AXM23955.1|920371_921154_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM26785.1|921264_922641_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	4.3e-76
>prophage 8
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	961362	1013081	4900521	protease,transposase	Tenacibaculum_phage(16.67%)	34	NA	NA
AXM23982.1|961362_962328_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM26787.1|962324_962498_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23983.1|962782_963274_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23984.1|964953_966210_-	6-phosphofructokinase	NA	NA	NA	NA	NA
AXM23985.1|966369_966933_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
AXM26788.1|967299_968658_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
AXM23986.1|968657_969254_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AXM23987.1|969400_970285_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23988.1|972266_972881_+	glutathione S-transferase	NA	NA	NA	NA	NA
AXM23989.1|972963_973950_-	malate dehydrogenase	NA	NA	NA	NA	NA
AXM23990.1|974065_974560_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
AXM23991.1|974804_976634_+	translational GTPase TypA	NA	NA	NA	NA	NA
AXM23992.1|976652_977123_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
AXM23993.1|978045_979173_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AXM23994.1|979273_980656_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
AXM23995.1|980903_983027_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM23996.1|983555_984074_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AXM23997.1|984780_985882_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
AXM23998.1|986397_987633_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM26789.1|988246_989137_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23999.1|992926_994162_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM24000.1|995144_996464_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM26790.1|997209_998133_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
AXM24001.1|999195_1000161_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM24002.1|1000462_1002040_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24003.1|1002107_1002871_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM24004.1|1005539_1006508_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM24005.1|1006510_1006792_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24006.1|1006768_1007230_-	cell wall hydrolase	NA	NA	NA	NA	NA
AXM24007.1|1007778_1008021_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
AXM24008.1|1008014_1008778_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM24009.1|1008810_1009542_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
AXM24010.1|1011361_1012114_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM24011.1|1012115_1013081_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 9
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1019959	1083727	4900521	protease,transposase,integrase	Ralstonia_phage(29.41%)	51	1006510:1006569	1081510:1081573
1006510:1006569	attL	GATGCCTCCTCATTCCGAACAAATAGTGTCTCGCATTTGTGGTGCGTTGTTCAGAGGTTC	NA	NA	NA	NA
AXM24015.1|1019959_1020586_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
AXM24016.1|1020710_1021997_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
AXM24017.1|1022140_1024612_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
AXM24018.1|1024825_1025098_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
AXM24019.1|1025929_1027900_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXM24020.1|1028605_1029784_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AXM24021.1|1029780_1030548_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AXM24022.1|1030560_1031217_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24023.1|1031244_1031697_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
AXM24024.1|1031705_1032440_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
AXM24025.1|1032875_1033580_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
AXM24026.1|1034405_1035035_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24027.1|1035926_1036127_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24028.1|1036522_1039246_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	2.8e-71
AXM26791.1|1039313_1041464_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
AXM24029.1|1041460_1043158_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM24030.1|1043477_1045682_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
AXM24031.1|1045678_1047373_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM24032.1|1047369_1047633_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
AXM24033.1|1047694_1049902_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
AXM24034.1|1049898_1051578_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM24035.1|1051574_1051838_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
AXM24036.1|1051899_1052457_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24037.1|1052539_1053505_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM26792.1|1053603_1054290_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
AXM24038.1|1054400_1054805_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
AXM24039.1|1055015_1056065_-	lipopolysaccharide heptosyltransferase family protein	NA	NA	NA	NA	NA
AXM24040.1|1056085_1056835_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
AXM24041.1|1056834_1057584_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
AXM24042.1|1057583_1058615_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
AXM24043.1|1058632_1058992_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AXM24044.1|1059016_1059514_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AXM24045.1|1059510_1059756_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
AXM24046.1|1059752_1060199_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
AXM24047.1|1060760_1062857_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
AXM24048.1|1062863_1063184_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AXM24049.1|1063281_1063875_+	recombination protein RecR	NA	NA	NA	NA	NA
AXM24050.1|1063976_1064327_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AXM24051.1|1064446_1064980_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24052.1|1064976_1066929_-	DUF3488 domain-containing protein	NA	NA	NA	NA	NA
AXM24053.1|1066921_1067878_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
AXM24054.1|1067883_1068837_-	MoxR family ATPase	NA	NA	NA	NA	NA
AXM24055.1|1068875_1070744_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AXM24056.1|1072259_1072775_+	peptide deformylase	NA	NA	NA	NA	NA
AXM24057.1|1073291_1074050_+	cellulase	NA	NA	NA	NA	NA
AXM26793.1|1074522_1075269_+	cellulase	NA	NA	NA	NA	NA
AXM24058.1|1075885_1077487_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
AXM24059.1|1078475_1079711_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM24060.1|1080539_1081508_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM24061.1|1081975_1082326_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
1081510:1081573	attR	GATGCCTCCTCATTCCGAACAAATAGTGTCTCGCATTTGTGGTGCGTTGTTCAGAGGTTCCCTA	NA	NA	NA	NA
AXM24062.1|1082407_1083727_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 10
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1122457	1164904	4900521	transposase	Leptospira_phage(25.0%)	40	NA	NA
AXM26796.1|1122457_1123559_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
AXM24091.1|1124989_1125613_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
AXM24092.1|1125636_1125876_+	rubredoxin	NA	NA	NA	NA	NA
AXM24093.1|1125925_1126807_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26797.1|1126956_1127406_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
AXM24094.1|1127556_1128204_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
AXM24095.1|1128295_1128766_-	EVE domain-containing protein	NA	NA	NA	NA	NA
AXM24096.1|1128762_1129353_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AXM24097.1|1129961_1130261_-	cell division protein ZapA	NA	NA	NA	NA	NA
AXM26799.1|1130257_1130479_-	TIGR02449 family protein	NA	NA	NA	NA	NA
AXM26798.1|1130714_1131257_+	YecA family protein	NA	NA	NA	NA	NA
AXM24098.1|1131267_1132608_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AXM24099.1|1133315_1134079_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM26800.1|1134311_1135637_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
AXM24100.1|1135835_1136183_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
AXM24101.1|1136179_1138588_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
AXM24102.1|1138766_1139924_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
AXM24103.1|1139939_1140539_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
AXM24104.1|1140535_1140931_-	glyoxalase	NA	NA	NA	NA	NA
AXM24105.1|1140927_1141653_-	ribonuclease PH	NA	NA	NA	NA	NA
AXM24106.1|1141762_1142623_+	YicC family protein	NA	NA	NA	NA	NA
AXM24107.1|1142739_1143351_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
AXM24108.1|1143531_1144329_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM24109.1|1144477_1144777_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AXM24110.1|1144905_1147077_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
AXM24111.1|1147156_1147537_+	RidA family protein	NA	NA	NA	NA	NA
AXM24112.1|1147557_1149711_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AXM24113.1|1149836_1150775_+	nucleoside hydrolase	NA	NA	NA	NA	NA
AXM24114.1|1150846_1151089_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AXM26801.1|1151302_1152592_+	citrate synthase	NA	NA	NA	NA	NA
AXM24115.1|1152969_1153620_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24116.1|1153929_1156452_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
AXM24117.1|1156574_1157633_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
AXM24118.1|1157632_1158391_+	fimbrial protein	NA	NA	NA	NA	NA
AXM24119.1|1158387_1159053_+	fimbrial protein	NA	NA	NA	NA	NA
AXM24120.1|1159049_1159583_+	fimbrial protein	NA	NA	NA	NA	NA
AXM24121.1|1159602_1161552_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
AXM24122.1|1161622_1162421_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM24123.1|1162563_1163799_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXM24124.1|1163869_1164904_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1204121	1236006	4900521	transposase	Feldmannia_irregularis_virus(16.67%)	25	NA	NA
AXM24150.1|1204121_1204884_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM24151.1|1204973_1205939_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM24152.1|1206048_1207368_-	sensor histidine kinase	NA	NA	NA	NA	NA
AXM24153.1|1207830_1208508_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
AXM26807.1|1208587_1208977_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26808.1|1209190_1210078_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
AXM24154.1|1210511_1211496_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	6.3e-98
AXM24155.1|1211670_1213758_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AXM24156.1|1213909_1214569_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AXM24157.1|1214649_1215447_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM24158.1|1215469_1215649_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24159.1|1215667_1216072_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
AXM24160.1|1216105_1216465_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
AXM24161.1|1216708_1217581_-	ion transporter	NA	NA	NA	NA	NA
AXM24162.1|1217653_1218880_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
AXM24163.1|1219124_1219742_-	hydrolase	NA	NA	NA	NA	NA
AXM24164.1|1221302_1222886_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
AXM24165.1|1222882_1223308_+	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
AXM24166.1|1223332_1223836_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24167.1|1225278_1225728_+	azurin	NA	NA	NA	NA	NA
AXM24168.1|1228974_1230264_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AXM24169.1|1232274_1233729_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24170.1|1234225_1235095_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
AXM24171.1|1235116_1235788_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
AXM24172.1|1235784_1236006_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 12
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1255226	1305221	4900521	transposase	Xanthomonas_phage(74.19%)	50	NA	NA
AXM24183.1|1255226_1256195_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM24184.1|1257001_1257187_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
AXM24185.1|1257186_1257390_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
AXM24186.1|1257525_1258599_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
AXM24187.1|1258703_1259003_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
AXM24188.1|1259129_1259351_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24189.1|1259366_1259606_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26809.1|1259712_1261197_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
AXM24190.1|1261198_1261519_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
AXM24191.1|1261515_1262700_+	zonular occludens toxin family protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	5.2e-54
AXM24192.1|1262754_1262925_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	2.5e-10
AXM24193.1|1262988_1263390_+	DUF4124 domain-containing protein	NA	A0A077JCA3	Xanthomonas_phage	64.3	3.9e-38
AXM24194.1|1263329_1263644_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.7	8.1e-15
AXM24195.1|1264033_1264294_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24196.1|1264493_1264877_+	hypothetical protein	NA	A0A1D6ZIV0	Xanthomonas_phage	99.2	4.8e-70
AXM24197.1|1265048_1265696_-	conjugal transfer protein	NA	A0A1D6ZIU7	Xanthomonas_phage	100.0	3.0e-120
AXM24198.1|1265697_1266885_-	hypothetical protein	NA	A0A1D6ZIU8	Xanthomonas_phage	100.0	2.8e-217
AXM24199.1|1266884_1267214_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
AXM24200.1|1267213_1268620_-	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	100.0	6.4e-245
AXM24201.1|1268756_1268987_-	methyltransferase	NA	A0A1D6ZIT7	Xanthomonas_phage	100.0	1.7e-30
AXM24202.1|1268998_1269202_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
AXM24203.1|1269205_1269502_-	DNA-binding protein	NA	A0A1D6ZIU6	Xanthomonas_phage	100.0	3.6e-49
AXM26810.1|1269498_1270539_-	replication initiation protein	NA	A0A1D6ZIT9	Xanthomonas_phage	100.0	8.2e-205
AXM24204.1|1270691_1270904_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	100.0	1.6e-27
AXM24205.1|1270903_1271089_-	hypothetical protein	NA	A0A1D6ZIV1	Xanthomonas_phage	100.0	1.4e-27
AXM24206.1|1271216_1271846_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	80.6	2.5e-71
AXM24207.1|1271970_1272153_-	antitoxin	NA	NA	NA	NA	NA
AXM24208.1|1272274_1272487_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24209.1|1272655_1273418_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM24210.1|1273820_1274246_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24211.1|1274676_1275639_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM24212.1|1275725_1275965_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24213.1|1275939_1276452_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24214.1|1276584_1277347_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM24215.1|1278568_1282366_+	avirulence protein	NA	NA	NA	NA	NA
AXM24216.1|1282634_1282829_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
AXM24217.1|1282832_1283132_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
AXM24218.1|1283355_1287111_+	avirulence protein	NA	NA	NA	NA	NA
AXM24219.1|1287200_1287963_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM24220.1|1288194_1288389_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
AXM24221.1|1288392_1288692_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
AXM24222.1|1288916_1292933_+	avirulence protein	NA	NA	NA	NA	NA
AXM24223.1|1293106_1293328_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AXM24224.1|1293324_1293996_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
AXM24225.1|1295250_1296207_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM24226.1|1296621_1297590_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM24227.1|1297734_1298700_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM24228.1|1298677_1302778_-	RHS repeat protein	NA	NA	NA	NA	NA
AXM26811.1|1303086_1304271_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXM24229.1|1304321_1305221_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
>prophage 13
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1459025	1507115	4900521	transposase,tRNA	Moumouvirus(16.67%)	44	NA	NA
AXM24331.1|1459025_1460420_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
AXM24332.1|1460421_1460679_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24333.1|1460675_1460981_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24334.1|1460977_1461304_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24335.1|1462030_1462693_+	carbonate dehydratase	NA	NA	NA	NA	NA
AXM26822.1|1462781_1463312_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
AXM24336.1|1465535_1466807_+	kynureninase	NA	NA	NA	NA	NA
AXM24337.1|1466978_1468346_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
AXM24338.1|1468649_1470095_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AXM24339.1|1470091_1470778_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
AXM24340.1|1470750_1471770_+	aldo/keto reductase	NA	NA	NA	NA	NA
AXM24341.1|1471811_1472372_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
AXM24342.1|1472392_1473349_-	5'-nucleotidase	NA	NA	NA	NA	NA
AXM26823.1|1473516_1474293_-	NAD(+) kinase	NA	NA	NA	NA	NA
AXM24343.1|1474776_1476912_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AXM24344.1|1476908_1477100_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24345.1|1478874_1479381_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXM24346.1|1479421_1479949_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXM24347.1|1479945_1480437_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AXM24348.1|1480460_1481036_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AXM24349.1|1481112_1482066_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
AXM24350.1|1482154_1483027_-	sulfurtransferase	NA	NA	NA	NA	NA
AXM26824.1|1483023_1483791_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
AXM24351.1|1483975_1484674_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXM24352.1|1484837_1485620_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AXM24353.1|1485628_1486009_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24354.1|1486005_1486716_+	endonuclease III	NA	NA	NA	NA	NA
AXM24355.1|1488026_1488575_-	carbonic anhydrase	NA	NA	NA	NA	NA
AXM24356.1|1488746_1489715_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXM24357.1|1490319_1491555_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM24358.1|1492118_1492439_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24359.1|1492778_1494029_+	porin	NA	NA	NA	NA	NA
AXM26825.1|1494163_1495237_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.4	5.0e-48
AXM24360.1|1495424_1496516_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
AXM24361.1|1496628_1497603_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AXM24362.1|1497602_1498472_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
AXM24363.1|1498494_1499325_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
AXM24364.1|1499453_1500164_+	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AXM24365.1|1500296_1500704_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24366.1|1500981_1501623_+	ribonuclease T	NA	NA	NA	NA	NA
AXM24367.1|1501693_1503013_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM24368.1|1503249_1504311_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM26826.1|1504361_1505546_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
AXM24369.1|1505795_1507115_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 14
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1513834	1586182	4900521	protease,transposase,tRNA	uncultured_Mediterranean_phage(33.33%)	54	NA	NA
AXM24374.1|1513834_1514980_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
AXM24375.1|1515049_1516120_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AXM24376.1|1516306_1516738_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AXM24377.1|1516861_1518358_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AXM24378.1|1518317_1518632_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24379.1|1518702_1519410_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24380.1|1522806_1523928_-	phytase	NA	NA	NA	NA	NA
AXM26827.1|1526200_1526626_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM26828.1|1526818_1527451_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AXM24381.1|1527847_1528610_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM24382.1|1528890_1529922_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM24383.1|1529928_1531722_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AXM24384.1|1531718_1532003_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
AXM26829.1|1531993_1532176_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26830.1|1532234_1532720_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24385.1|1532778_1533285_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
AXM26831.1|1533281_1533902_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AXM24386.1|1534142_1536047_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
AXM24387.1|1536134_1537192_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM24388.1|1537289_1538609_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM24389.1|1538842_1540000_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
AXM24390.1|1540276_1541242_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM24391.1|1541219_1542695_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
AXM24392.1|1544511_1545480_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM24393.1|1546394_1547363_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM24394.1|1547630_1547870_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24395.1|1549744_1550965_-	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AXM24396.1|1551279_1552677_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AXM24397.1|1552687_1553908_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AXM24398.1|1553904_1554543_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24399.1|1554613_1555474_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXM24400.1|1555470_1556259_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
AXM24401.1|1556269_1557475_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
AXM24402.1|1557493_1557919_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
AXM24403.1|1558138_1558771_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM24404.1|1558795_1561168_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
AXM24405.1|1561325_1562531_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
AXM24406.1|1562851_1564183_+	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
AXM24407.1|1564179_1564530_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24408.1|1564561_1564969_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
AXM24409.1|1564965_1565292_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26832.1|1565323_1566700_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
AXM24410.1|1566936_1571103_+	type III effector	NA	NA	NA	NA	NA
AXM26833.1|1571215_1571845_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
AXM24411.1|1571951_1573880_-	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
AXM24412.1|1574042_1576403_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
AXM24413.1|1576686_1577655_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
AXM24414.1|1577712_1578834_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXM26834.1|1580261_1581014_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXM26835.1|1581094_1581313_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXM24415.1|1581593_1583876_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
AXM24416.1|1584019_1584340_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
AXM24417.1|1584590_1585049_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AXM24418.1|1585045_1586182_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1667920	1693558	4900521	transposase	Bacillus_phage(50.0%)	17	NA	NA
AXM24486.1|1667920_1669240_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM24487.1|1669389_1670358_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXM24488.1|1672123_1672315_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24489.1|1680586_1680979_+	cytochrome c	NA	NA	NA	NA	NA
AXM24490.1|1680987_1681449_+	cytochrome c	NA	NA	NA	NA	NA
AXM24491.1|1681953_1682214_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24492.1|1682289_1682532_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24493.1|1682774_1682960_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24494.1|1683002_1683209_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24495.1|1683971_1684937_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM24496.1|1684943_1686242_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM24497.1|1686410_1688096_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
AXM26839.1|1688092_1689829_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
AXM24498.1|1690243_1690435_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24499.1|1690428_1691385_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
AXM24500.1|1692187_1692451_+	cytochrome D ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AXM24501.1|1692592_1693558_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 16
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1710436	1771038	4900521	protease,transposase,tRNA	Moumouvirus(10.0%)	54	NA	NA
AXM24517.1|1710436_1711867_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
AXM24518.1|1712364_1712802_+	SufE family protein	NA	NA	NA	NA	NA
AXM24519.1|1712798_1714049_+	MFS transporter	NA	NA	NA	NA	NA
AXM24520.1|1714116_1715178_-	peptidase S41	NA	NA	NA	NA	NA
AXM24521.1|1715320_1716361_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AXM24522.1|1716451_1716733_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
AXM24523.1|1716729_1718079_+	dihydroorotase	NA	NA	NA	NA	NA
AXM24524.1|1718018_1718918_+	M23 family peptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.6e-13
AXM24525.1|1719816_1720579_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM24526.1|1720605_1720869_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24527.1|1721240_1721729_-	general stress protein	NA	NA	NA	NA	NA
AXM24528.1|1721952_1723272_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM24529.1|1723408_1724377_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM24530.1|1724576_1725893_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM24531.1|1726252_1727434_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
AXM24532.1|1727501_1727741_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24533.1|1729022_1730693_+	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
AXM24534.1|1730909_1731599_-	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
AXM24535.1|1731627_1732332_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AXM24536.1|1732405_1733125_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
AXM24537.1|1733155_1734505_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
AXM26840.1|1734512_1735349_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24538.1|1735507_1736074_-	elongation factor P	NA	NA	NA	NA	NA
AXM24539.1|1736175_1737204_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
AXM24540.1|1737422_1739540_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXM26841.1|1739536_1740457_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXM24541.1|1740517_1741282_-	RNA methyltransferase	NA	NA	NA	NA	NA
AXM24542.1|1741400_1742234_+	inositol monophosphatase	NA	NA	NA	NA	NA
AXM24543.1|1742486_1743098_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
AXM24544.1|1743352_1743793_+	ribonuclease	NA	NA	NA	NA	NA
AXM24545.1|1743789_1744215_+	barnase inhibitor	NA	NA	NA	NA	NA
AXM24546.1|1744663_1746559_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.4e-48
AXM24547.1|1746648_1748025_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	2.1e-54
AXM24548.1|1748127_1748688_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	1.6e-29
AXM24549.1|1748785_1750342_-	YdiU family protein	NA	NA	NA	NA	NA
AXM24550.1|1750625_1751501_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXM24551.1|1751701_1752400_-	glutathione S-transferase	NA	NA	NA	NA	NA
AXM24552.1|1752570_1752780_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	62.3	2.8e-16
AXM24553.1|1753049_1753535_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
AXM24554.1|1753605_1754154_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24555.1|1754150_1755332_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXM24556.1|1755555_1757625_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXM24557.1|1757724_1758603_-|protease	protease HtpX	protease	NA	NA	NA	NA
AXM24558.1|1758700_1759600_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AXM24559.1|1759687_1760428_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AXM26842.1|1760587_1761163_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
AXM24560.1|1761336_1762308_-	TraB/GumN family protein	NA	NA	NA	NA	NA
AXM24561.1|1762341_1763283_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
AXM24562.1|1763282_1765160_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
AXM24563.1|1765297_1767031_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
AXM24564.1|1767083_1767584_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AXM24565.1|1767580_1769068_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AXM24566.1|1769092_1770160_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AXM24567.1|1770274_1771038_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 17
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1774233	1847257	4900521	protease,transposase,tRNA	Bacillus_phage(18.18%)	56	NA	NA
AXM24570.1|1774233_1774981_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM24571.1|1775297_1777133_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
AXM24572.1|1777404_1778496_+	ribonuclease D	NA	NA	NA	NA	NA
AXM24573.1|1778571_1778961_-	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
AXM24574.1|1778824_1779175_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24575.1|1779588_1779990_+	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AXM24576.1|1780496_1780631_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26843.1|1780853_1781033_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24577.1|1781634_1781925_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXM24578.1|1781912_1782191_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AXM26844.1|1782675_1782864_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AXM26845.1|1783636_1784821_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
AXM24579.1|1785401_1786367_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM24580.1|1790859_1791276_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
AXM24581.1|1791486_1791813_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24582.1|1791845_1792286_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
AXM24583.1|1792364_1793000_-	stringent starvation protein A	NA	NA	NA	NA	NA
AXM24584.1|1793393_1794137_-	cytochrome c1	NA	NA	NA	NA	NA
AXM24585.1|1794144_1795404_-	cytochrome b	NA	NA	NA	NA	NA
AXM24586.1|1795403_1796048_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AXM24587.1|1796577_1797564_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
AXM24588.1|1799499_1800954_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AXM24589.1|1801377_1802364_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
AXM24590.1|1802775_1803438_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24591.1|1803492_1803978_+	endoribonuclease YbeY	NA	NA	NA	NA	NA
AXM24592.1|1803977_1804496_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24593.1|1804590_1805469_+	CBS domain-containing protein	NA	NA	NA	NA	NA
AXM24594.1|1805465_1806746_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
AXM24595.1|1806761_1807763_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
AXM26846.1|1807914_1809279_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXM26847.1|1809533_1809944_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24596.1|1810099_1810930_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AXM24597.1|1810945_1811308_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
AXM24598.1|1811243_1812491_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
AXM24599.1|1812636_1814148_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24600.1|1814134_1815721_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AXM24601.1|1815717_1816920_-	HlyD family secretion protein	NA	NA	NA	NA	NA
AXM24602.1|1817426_1818815_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM24603.1|1819048_1820434_-	glutamine synthetase	NA	NA	NA	NA	NA
AXM24604.1|1821341_1822721_+	glutamine synthetase	NA	NA	NA	NA	NA
AXM24605.1|1822720_1824037_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXM24606.1|1824173_1825418_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.5e-19
AXM24607.1|1825725_1827006_-	MFS transporter	NA	NA	NA	NA	NA
AXM24608.1|1827311_1827620_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24609.1|1827579_1829928_-	CbbBc protein	NA	NA	NA	NA	NA
AXM24610.1|1829924_1830770_-	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AXM24611.1|1830776_1832501_-	MFS transporter	NA	NA	NA	NA	NA
AXM24612.1|1832643_1832826_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24613.1|1832858_1833621_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM24614.1|1833846_1835199_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AXM26848.1|1835259_1838397_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24615.1|1838563_1839418_+	plasmid replication/partition related protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
AXM24616.1|1839588_1840893_+	DUF445 family protein	NA	NA	NA	NA	NA
AXM24617.1|1841034_1845129_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.9e-55
AXM24618.1|1845162_1846149_+	two-component system response regulator	NA	W8CYM9	Bacillus_phage	26.8	2.8e-05
AXM24619.1|1846273_1847257_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.4e-97
>prophage 18
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1859144	1939058	4900521	transposase	uncultured_Caudovirales_phage(57.14%)	54	NA	NA
AXM24625.1|1859144_1860110_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM24626.1|1860816_1861812_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM24627.1|1861972_1864489_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
AXM24628.1|1864485_1865442_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
AXM24629.1|1865600_1867343_+	PTS fructose transporter subunit EIIBC	NA	NA	NA	NA	NA
AXM26849.1|1867661_1868798_+	carbohydrate porin	NA	NA	NA	NA	NA
AXM24630.1|1869464_1870433_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM24631.1|1870645_1871965_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM24632.1|1872204_1874550_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24633.1|1874567_1875296_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24634.1|1875324_1877667_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26850.1|1877691_1878435_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24635.1|1878465_1881300_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24636.1|1881296_1882226_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM24637.1|1882234_1884997_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.2	1.5e-43
AXM24638.1|1886562_1889052_-	avirulence protein	NA	NA	NA	NA	NA
AXM24639.1|1889091_1889481_-	type VI secretion protein	NA	NA	NA	NA	NA
AXM24640.1|1889635_1890595_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM24641.1|1890527_1890842_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
AXM24642.1|1891069_1892389_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM24643.1|1893493_1893910_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
AXM24644.1|1893906_1894215_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26851.1|1894156_1894534_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24645.1|1894595_1895231_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24646.1|1895730_1896699_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM26852.1|1898164_1901206_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM24647.1|1901572_1901761_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
AXM24648.1|1902255_1902708_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24649.1|1902962_1904768_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM24650.1|1904916_1905117_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24651.1|1905192_1905900_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
AXM24652.1|1906051_1906444_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM26853.1|1906466_1906982_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM24653.1|1906978_1907332_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24654.1|1907420_1908161_+	flagellar motor protein	NA	NA	NA	NA	NA
AXM24655.1|1908167_1909142_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
AXM24656.1|1909143_1909926_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
AXM24657.1|1909922_1910945_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM24658.1|1911045_1911354_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AXM24659.1|1911350_1911716_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
AXM24660.1|1911749_1913759_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
AXM26854.1|1915859_1916549_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	8.3e-12
AXM24661.1|1916864_1917626_+	transporter	NA	NA	NA	NA	NA
AXM24662.1|1917639_1919982_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	4.5e-09
AXM24663.1|1920478_1921444_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM24664.1|1921683_1923930_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	2.9e-13
AXM26855.1|1924658_1926770_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.2e-14
AXM24665.1|1927454_1929530_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
AXM24666.1|1930122_1932384_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
AXM24667.1|1932777_1935039_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
AXM24668.1|1935717_1935927_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24669.1|1935996_1936794_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AXM24670.1|1936929_1937412_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM24671.1|1938260_1939058_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	2020106	2031881	4900521	tRNA	Escherichia_phage(22.22%)	14	NA	NA
AXM24734.1|2020106_2020406_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
AXM24735.1|2020448_2020679_-	hypothetical protein	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
AXM24736.1|2020922_2021672_-	isopentenyl transferase	NA	NA	NA	NA	NA
AXM24737.1|2021676_2022372_-	DNA helicase	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
AXM24738.1|2022307_2022535_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24739.1|2022557_2022857_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26861.1|2023244_2023649_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
AXM24740.1|2024374_2024587_-	carbon storage regulator	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
AXM24741.1|2024726_2027375_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
AXM24742.1|2027476_2027965_-	recombination regulator RecX	NA	NA	NA	NA	NA
AXM24743.1|2028015_2028219_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24744.1|2028267_2029302_-	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
AXM24745.1|2029474_2030116_-	LexA repressor 2	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
AXM26862.1|2030204_2031881_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 20
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	2220525	2342311	4900521	transposase,tRNA	Ralstonia_phage(17.39%)	89	NA	NA
AXM24887.1|2220525_2221491_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM24888.1|2221511_2222315_-	amidohydrolase	NA	NA	NA	NA	NA
AXM24889.1|2222454_2223603_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AXM24890.1|2223829_2224474_+	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
AXM24891.1|2224470_2225166_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
AXM24892.1|2225260_2226013_+	heme ABC transporter permease	NA	NA	NA	NA	NA
AXM24893.1|2226009_2226180_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
AXM24894.1|2226176_2226647_+	cytochrome c biogenesis protein CcmE	NA	NA	NA	NA	NA
AXM26886.1|2226815_2228753_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
AXM24895.1|2228745_2229348_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AXM26887.1|2229365_2229776_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
AXM24896.1|2229769_2230789_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AXM24897.1|2231078_2232950_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
AXM24898.1|2232946_2233246_-	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
AXM24899.1|2233280_2234699_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXM24900.1|2234907_2236149_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
AXM24901.1|2236304_2236892_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AXM24902.1|2237028_2238510_+	amino acid permease	NA	NA	NA	NA	NA
AXM24903.1|2238586_2240017_+	amino acid permease	NA	NA	NA	NA	NA
AXM24904.1|2240105_2240783_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
AXM24905.1|2240794_2241361_+	acireductone dioxygenase	NA	NA	NA	NA	NA
AXM24906.1|2241363_2242062_+	acireductone synthase	NA	NA	NA	NA	NA
AXM24907.1|2242389_2243475_+	peptidase C13	NA	NA	NA	NA	NA
AXM24908.1|2245306_2246626_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM24909.1|2246914_2251042_+	avirulence protein	NA	NA	NA	NA	NA
AXM24910.1|2254225_2257930_+	avirulence protein	NA	NA	NA	NA	NA
AXM24911.1|2258198_2258393_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
AXM24912.1|2258396_2258696_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
AXM26888.1|2263906_2264002_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24913.1|2265202_2266216_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM24914.1|2266315_2266900_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AXM24915.1|2266963_2267932_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXM24916.1|2268144_2269464_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM24917.1|2269903_2270701_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM24918.1|2270851_2272201_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
AXM24919.1|2272207_2272972_+	energy transducer TonB	NA	NA	NA	NA	NA
AXM26889.1|2273332_2273800_+	energy transducer TonB	NA	NA	NA	NA	NA
AXM26890.1|2273986_2275088_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
AXM24920.1|2276265_2277234_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXM24921.1|2277425_2278394_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM24922.1|2279254_2280454_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AXM24923.1|2280602_2280785_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
AXM24924.1|2281106_2282582_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
AXM26891.1|2282636_2283821_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXM24925.1|2284265_2285231_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM24926.1|2286583_2287552_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM24927.1|2287710_2288058_-	hypothetical protein	NA	NA	NA	NA	NA
AXM24928.1|2288059_2288827_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AXM24929.1|2289897_2290695_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM24930.1|2290906_2293435_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
AXM24931.1|2294001_2295447_-	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
AXM26892.1|2295400_2295625_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24932.1|2295818_2295959_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXM26893.1|2295958_2297107_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXM24933.1|2297228_2298224_+	methyltransferase domain-containing protein	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
AXM24934.1|2298220_2299360_+	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
AXM24935.1|2299502_2302256_+	methionine synthase	NA	NA	NA	NA	NA
AXM24936.1|2302642_2303848_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
AXM24937.1|2303844_2304903_-	carbohydrate kinase	NA	NA	NA	NA	NA
AXM24938.1|2304827_2306138_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AXM26894.1|2306151_2307327_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM24939.1|2307467_2308313_-	transporter	NA	NA	NA	NA	NA
AXM24940.1|2308646_2309399_-	DUF2058 family protein	NA	NA	NA	NA	NA
AXM24941.1|2309399_2309636_-	protein SlyX	NA	NA	NA	NA	NA
AXM24942.1|2309628_2310978_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
AXM26895.1|2311003_2311969_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXM24943.1|2312060_2312618_-	glutathione peroxidase	NA	NA	NA	NA	NA
AXM24944.1|2312753_2313002_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24945.1|2313004_2313367_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXM24946.1|2313363_2314239_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
AXM24947.1|2314235_2315222_+	ABC transporter permease	NA	NA	NA	NA	NA
AXM24948.1|2315231_2316068_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24949.1|2316700_2317123_+	hypothetical protein	NA	NA	NA	NA	NA
AXM24950.1|2317245_2318649_-	class II fumarate hydratase	NA	NA	NA	NA	NA
AXM24951.1|2320100_2320864_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM24952.1|2323887_2325255_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
AXM24953.1|2325496_2325997_+	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
AXM26896.1|2326276_2326540_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
AXM24954.1|2326877_2328377_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM24955.1|2328373_2329306_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM24956.1|2329486_2332315_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
AXM24957.1|2332357_2333560_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AXM24958.1|2333801_2335238_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
AXM24959.1|2335436_2336030_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
AXM26897.1|2336297_2336891_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
AXM24960.1|2336887_2338657_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
AXM24961.1|2338995_2339601_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM24962.1|2339730_2340657_+	multidrug transporter	NA	NA	NA	NA	NA
AXM24963.1|2340991_2342311_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 21
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	2397196	2469442	4900521	protease,transposase,coat,tRNA	Emiliania_huxleyi_virus(20.0%)	58	NA	NA
AXM25000.1|2397196_2398231_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AXM25001.1|2398277_2398610_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25002.1|2398612_2399338_+	molecular chaperone	NA	NA	NA	NA	NA
AXM25003.1|2399713_2400517_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
AXM25004.1|2400686_2401565_+	elongation factor Ts	NA	NA	NA	NA	NA
AXM25005.1|2401692_2402070_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
AXM25006.1|2402126_2402849_+	UMP kinase	NA	NA	NA	NA	NA
AXM25007.1|2403029_2403587_+	ribosome recycling factor	NA	NA	NA	NA	NA
AXM25008.1|2403604_2404366_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
AXM25009.1|2404362_2405190_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AXM25010.1|2405192_2406383_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AXM25011.1|2406409_2407756_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AXM25012.1|2407752_2410206_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AXM25013.1|2410605_2411619_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AXM25014.1|2411615_2412077_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AXM25015.1|2412100_2412892_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AXM26902.1|2412930_2414187_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AXM25016.1|2414183_2414924_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
AXM25017.1|2415381_2418972_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
AXM25018.1|2419147_2420107_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
AXM25019.1|2420946_2423127_+	ligand-gated channel	NA	NA	NA	NA	NA
AXM25020.1|2423126_2423864_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
AXM25021.1|2423860_2425273_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
AXM25022.1|2425209_2426553_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
AXM25023.1|2427374_2427641_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26903.1|2427718_2428165_-	CopD family protein	NA	NA	NA	NA	NA
AXM25024.1|2428238_2428841_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM26904.1|2429008_2430325_+	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
AXM25025.1|2430797_2431361_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26905.1|2435055_2435226_+	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
AXM25026.1|2436454_2437936_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.7	3.7e-102
AXM25027.1|2437978_2438374_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
AXM26906.1|2438413_2439790_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
AXM26907.1|2441420_2442095_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
AXM25028.1|2442099_2442876_+	VUT family protein	NA	R4TNY5	Halovirus	27.2	1.9e-09
AXM25029.1|2443296_2445234_+	DUF885 family protein	NA	NA	NA	NA	NA
AXM25030.1|2445415_2446393_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AXM25031.1|2446389_2447787_-	S-methylmethionine permease	NA	NA	NA	NA	NA
AXM25032.1|2448057_2449116_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM25033.1|2449879_2450329_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
AXM25034.1|2450553_2452638_+|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
AXM25035.1|2452845_2453442_+	HAD family hydrolase	NA	NA	NA	NA	NA
AXM25036.1|2453443_2453872_+	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
AXM25037.1|2454084_2454267_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25038.1|2454490_2455273_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25039.1|2455358_2455727_+	DUF4345 domain-containing protein	NA	NA	NA	NA	NA
AXM25040.1|2455785_2456349_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXM25041.1|2456333_2457179_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26908.1|2457404_2458403_+	acyl-CoA desaturase	NA	G4YAW5	Emiliania_huxleyi_virus	30.6	2.3e-18
AXM25042.1|2458399_2459650_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXM25043.1|2459574_2460534_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
AXM25044.1|2460530_2461826_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	3.9e-39
AXM25045.1|2461822_2462368_+	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
AXM25046.1|2462364_2463147_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
AXM25047.1|2463164_2464235_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM25048.1|2464396_2464744_-	RidA family protein	NA	NA	NA	NA	NA
AXM25049.1|2465724_2468289_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
AXM25050.1|2468680_2469442_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 22
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	2622066	2702017	4900521	transposase,tRNA	Bacillus_phage(18.18%)	57	NA	NA
AXM25160.1|2622066_2623035_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM25161.1|2623045_2623246_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25162.1|2623324_2623540_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25163.1|2623940_2625185_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM25164.1|2625181_2625460_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25165.1|2625537_2625939_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25166.1|2625992_2626220_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25167.1|2626221_2626593_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
AXM25168.1|2626589_2626886_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25169.1|2627596_2629060_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
AXM25170.1|2629195_2631538_+	alpha-mannosidase	NA	NA	NA	NA	NA
AXM25171.1|2631817_2633659_+	beta-galactosidase	NA	NA	NA	NA	NA
AXM26915.1|2633708_2636240_-	type III secretion system effector protein XopK	NA	NA	NA	NA	NA
AXM25172.1|2636321_2636657_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25173.1|2636857_2637058_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25174.1|2637400_2638636_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM25175.1|2639135_2640239_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
AXM25176.1|2640380_2642339_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25177.1|2642363_2643095_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AXM25178.1|2643091_2644156_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
AXM26916.1|2648777_2649860_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM25179.1|2649871_2650495_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM25180.1|2650745_2651222_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM25181.1|2651255_2652458_-	chemotaxis protein	NA	NA	NA	NA	NA
AXM25182.1|2652465_2659407_-	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
AXM25183.1|2659520_2661557_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
AXM25184.1|2661596_2662127_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM25185.1|2662126_2662489_-	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
AXM26917.1|2662506_2662908_-	response regulator	NA	NA	NA	NA	NA
AXM25186.1|2663157_2664108_+	glutathione synthase	NA	NA	NA	NA	NA
AXM25187.1|2664104_2664980_+	energy transducer TonB	NA	NA	NA	NA	NA
AXM25188.1|2665274_2666189_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.5	1.2e-63
AXM25189.1|2666185_2666905_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AXM25190.1|2666918_2668946_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
AXM25191.1|2669145_2669670_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25192.1|2669683_2672128_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
AXM25193.1|2672369_2674472_+	glycosyltransferase	NA	NA	NA	NA	NA
AXM26918.1|2674804_2676247_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25194.1|2676571_2678758_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
AXM25195.1|2679047_2679128_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
AXM25196.1|2679211_2680111_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
AXM25197.1|2680107_2680860_+	pyrroloquinoline-quinone synthase	NA	NA	NA	NA	NA
AXM25198.1|2680856_2681135_+	pyrroloquinoline quinone biosynthesis protein PqqD	NA	NA	NA	NA	NA
AXM25199.1|2681131_2682250_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
AXM25200.1|2682312_2682825_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25201.1|2683135_2683899_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM25202.1|2684069_2685584_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
AXM25203.1|2687025_2689668_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM25204.1|2689888_2694010_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
AXM25205.1|2694111_2694657_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
AXM25206.1|2694872_2695100_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25207.1|2695212_2697009_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
AXM25208.1|2697147_2697645_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25209.1|2697723_2698128_+	response regulator	NA	NA	NA	NA	NA
AXM25210.1|2698758_2699433_-	7-cyano-7-deazaguanine synthase	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
AXM25211.1|2699811_2701188_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
AXM25212.1|2701254_2702017_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 23
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	2764589	2911688	4900521	transposase,tRNA	Ralstonia_phage(19.23%)	115	NA	NA
AXM25251.1|2764589_2767421_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
AXM25252.1|2767427_2768444_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AXM25253.1|2768642_2770247_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
AXM25254.1|2770363_2770633_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AXM25255.1|2770724_2771777_-	GTPase ObgE	NA	NA	NA	NA	NA
AXM25256.1|2772009_2772270_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AXM25257.1|2772282_2772603_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AXM25258.1|2772895_2775862_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.8	3.3e-307
AXM25259.1|2775858_2776266_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AXM25260.1|2776379_2776844_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
AXM25261.1|2776867_2777638_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
AXM25262.1|2777708_2778614_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
AXM25263.1|2778841_2779345_+	pathogenicity-like protein	NA	NA	NA	NA	NA
AXM25264.1|2779456_2780200_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXM26920.1|2780454_2780910_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25265.1|2781054_2781853_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM25266.1|2781895_2782477_-	calcium-binding protein	NA	NA	NA	NA	NA
AXM25267.1|2782537_2783452_+	arginyltransferase	NA	NA	NA	NA	NA
AXM25268.1|2783405_2784737_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AXM25269.1|2785041_2786643_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25270.1|2787088_2788165_+	DUF4432 family protein	NA	NA	NA	NA	NA
AXM25271.1|2788260_2788734_-	DUF3574 domain-containing protein	NA	NA	NA	NA	NA
AXM25272.1|2788969_2791405_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	22.5	2.6e-12
AXM26921.1|2791953_2792502_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25273.1|2792727_2793486_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AXM25274.1|2793530_2795309_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
AXM25275.1|2795305_2796673_+	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
AXM25276.1|2796922_2797303_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
AXM26922.1|2797277_2797784_-	DUF4166 domain-containing protein	NA	NA	NA	NA	NA
AXM25277.1|2797804_2798611_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AXM25278.1|2798618_2799614_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AXM25279.1|2799734_2800616_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AXM25280.1|2800773_2802432_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.0	1.2e-93
AXM25281.1|2802860_2803157_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25282.1|2803476_2804352_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
AXM25283.1|2804376_2805546_-	succinyl-CoA ligase subunit beta	NA	NA	NA	NA	NA
AXM25284.1|2805779_2807393_+	sensor histidine kinase	NA	NA	NA	NA	NA
AXM25285.1|2807723_2809115_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXM25286.1|2809187_2809394_+	DUF2559 family protein	NA	NA	NA	NA	NA
AXM25287.1|2809973_2811707_-	type IV-A pilus assembly ATPase PilB	NA	NA	NA	NA	NA
AXM25288.1|2811741_2813268_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25289.1|2813237_2813897_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25290.1|2813877_2815467_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25291.1|2815601_2816027_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AXM26923.1|2816381_2817641_+	type II secretion system F family protein	NA	NA	NA	NA	NA
AXM25292.1|2817647_2818511_+	prepilin peptidase	NA	NA	NA	NA	NA
AXM25293.1|2818524_2819133_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
AXM25294.1|2819203_2820523_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM25295.1|2821083_2821491_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25296.1|2821369_2822326_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	1.1e-41
AXM25297.1|2823017_2823986_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM25298.1|2824155_2824524_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25299.1|2826813_2827782_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXM25300.1|2828321_2832812_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AXM25301.1|2834109_2835429_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM25302.1|2835471_2836234_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM25303.1|2836310_2838143_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
AXM25304.1|2838274_2838865_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AXM25305.1|2838930_2841987_-	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AXM25306.1|2841983_2843087_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM25307.1|2843112_2843949_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
AXM26924.1|2843968_2845438_-	outer membrane channel protein	NA	NA	NA	NA	NA
AXM25308.1|2845543_2846233_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
AXM25309.1|2846229_2847423_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
AXM25310.1|2847481_2848747_-	cation:proton antiporter	NA	NA	NA	NA	NA
AXM25311.1|2848893_2850570_-	serine hydrolase	NA	NA	NA	NA	NA
AXM25312.1|2850511_2851012_-	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
AXM25313.1|2853931_2854654_-	pseudouridine synthase	NA	NA	NA	NA	NA
AXM25314.1|2854803_2857200_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
AXM25315.1|2857463_2859368_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
AXM26925.1|2860044_2860707_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25316.1|2860735_2860978_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
AXM25317.1|2861323_2861725_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25318.1|2861750_2862284_-	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
AXM25319.1|2862686_2862941_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25320.1|2864401_2865865_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
AXM25321.1|2865861_2866407_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
AXM25322.1|2866757_2867726_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM25323.1|2869256_2870702_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
AXM25324.1|2870774_2871815_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AXM25325.1|2871947_2872130_-	30S ribosomal protein THX	NA	NA	NA	NA	NA
AXM26926.1|2872429_2872840_-	MerC domain-containing protein	NA	NA	NA	NA	NA
AXM25326.1|2878113_2879070_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
AXM25327.1|2879121_2879532_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXM25328.1|2879630_2880356_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
AXM26927.1|2880365_2880545_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25329.1|2880772_2882227_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	5.7e-47
AXM25330.1|2882293_2883724_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
AXM25331.1|2883945_2884500_-	NADPH-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
AXM25332.1|2884716_2886657_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
AXM25333.1|2886832_2887471_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AXM26928.1|2889704_2890868_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXM25334.1|2891025_2891817_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AXM25335.1|2891962_2892178_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25336.1|2892177_2892945_+	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
AXM25337.1|2893006_2893837_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
AXM25338.1|2893909_2894338_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25339.1|2894469_2894949_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AXM25340.1|2895198_2895414_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
AXM25341.1|2895380_2895614_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25342.1|2895641_2896127_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
AXM25343.1|2897688_2897892_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25344.1|2898669_2899128_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM25345.1|2899533_2900040_-	transcriptional repressor	NA	NA	NA	NA	NA
AXM25346.1|2900053_2901457_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AXM25347.1|2901525_2902629_-	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
AXM26929.1|2902650_2903382_-	nitrilase	NA	NA	NA	NA	NA
AXM25348.1|2903455_2904412_+|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM25349.1|2904710_2905298_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AXM25350.1|2905528_2906341_+	peptidase C1	NA	NA	NA	NA	NA
AXM25351.1|2906371_2907535_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
AXM25352.1|2907693_2908077_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26930.1|2908592_2909405_+	peptidase C1	NA	NA	NA	NA	NA
AXM25353.1|2909465_2910524_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
AXM25354.1|2910518_2911688_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
>prophage 24
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	3137160	3290350	4900521	protease,transposase,plate	Ralstonia_phage(50.0%)	106	NA	NA
AXM25508.1|3137160_3138396_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXM25509.1|3138817_3140206_-	amino acid permease	NA	NA	NA	NA	NA
AXM25510.1|3140961_3141903_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AXM25511.1|3142216_3142981_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AXM25512.1|3143173_3144556_+	amino acid permease	NA	NA	NA	NA	NA
AXM25513.1|3145010_3146408_+|protease	serine protease	protease	NA	NA	NA	NA
AXM25514.1|3146654_3146840_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25515.1|3146970_3147369_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25516.1|3147513_3148518_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXM25517.1|3148555_3150073_-	tryptophan 7-halogenase	NA	A0A1D7SEI2	Cyanophage	32.3	8.1e-52
AXM25518.1|3150113_3151160_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
AXM26954.1|3151170_3151923_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AXM25519.1|3151998_3152235_+	transcriptional regulator	NA	NA	NA	NA	NA
AXM25520.1|3152254_3155401_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM25521.1|3156459_3158466_-	M1 family peptidase	NA	NA	NA	NA	NA
AXM25522.1|3158685_3159132_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
AXM25523.1|3161111_3162278_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.1	5.8e-74
AXM25524.1|3162279_3162852_-	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	27.7	1.1e-09
AXM25525.1|3162864_3163269_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
AXM25526.1|3163306_3163978_-	DUF2491 family protein	NA	NA	NA	NA	NA
AXM25527.1|3163980_3165063_-	potassium channel protein	NA	NA	NA	NA	NA
AXM25528.1|3165088_3165862_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
AXM25529.1|3165874_3166291_-	DUF2170 family protein	NA	NA	NA	NA	NA
AXM25530.1|3166471_3167071_-	pyridoxine/pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AXM25531.1|3167237_3167780_+	shikimate kinase	NA	NA	NA	NA	NA
AXM26955.1|3167776_3168889_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
AXM25532.1|3169190_3169442_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25533.1|3169456_3170521_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
AXM25534.1|3171992_3175709_+	avirulence protein	NA	NA	NA	NA	NA
AXM25535.1|3176176_3176476_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
AXM25536.1|3176699_3181349_+	avirulence protein	NA	NA	NA	NA	NA
AXM25537.1|3182411_3183887_-|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	5.4e-101
AXM25538.1|3183969_3186558_-	hydrophobe/amphiphile efflux-1 family RND transporter	NA	NA	NA	NA	NA
AXM25539.1|3186614_3187727_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM25540.1|3187851_3188430_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM25541.1|3189916_3192004_+	type III effector	NA	NA	NA	NA	NA
AXM25542.1|3192389_3193487_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM25543.1|3193903_3196984_+	histidine kinase	NA	NA	NA	NA	NA
AXM26956.1|3200019_3200727_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXM25544.1|3200723_3201716_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AXM25545.1|3201712_3204172_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
AXM25546.1|3204285_3205266_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM26957.1|3205274_3206303_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AXM25547.1|3206475_3206802_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25548.1|3206798_3209702_-	serine/threonine protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
AXM25549.1|3209698_3210421_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
AXM25550.1|3210417_3211065_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
AXM25551.1|3211061_3214520_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AXM25552.1|3214523_3215840_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
AXM25553.1|3215841_3217179_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXM25554.1|3217175_3218567_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AXM25555.1|3218563_3219103_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25556.1|3219111_3221049_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
AXM25557.1|3221313_3221772_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25558.1|3222719_3223217_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25559.1|3223405_3226111_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	4.3e-80
AXM25560.1|3226143_3227154_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXM25561.1|3227117_3228995_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXM25562.1|3228998_3229502_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXM25563.1|3229489_3230323_-	ImpE protein	NA	NA	NA	NA	NA
AXM25564.1|3230358_3230862_-	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
AXM25565.1|3230961_3232476_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AXM26958.1|3232468_3232975_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AXM25566.1|3234333_3235302_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM25567.1|3235437_3236754_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM25568.1|3236924_3238160_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM25569.1|3238345_3239314_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM25570.1|3239365_3241282_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25571.1|3241306_3242044_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25572.1|3242074_3244417_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26959.1|3244434_3245181_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25573.1|3245209_3248044_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25574.1|3248701_3250531_-	transmembrane repetitive protein	NA	NA	NA	NA	NA
AXM25575.1|3250544_3251144_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
AXM25576.1|3251231_3251588_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AXM25577.1|3251584_3252007_+	energy transducer TonB	NA	NA	NA	NA	NA
AXM25578.1|3252022_3252256_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AXM25579.1|3252282_3252543_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AXM25580.1|3252891_3254676_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AXM25581.1|3254708_3255695_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AXM25582.1|3256105_3259819_+	ribonuclease E/G	NA	NA	NA	NA	NA
AXM25583.1|3260344_3261108_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM25584.1|3261211_3261859_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXM25585.1|3262080_3262842_-	sulfurtransferase	NA	NA	NA	NA	NA
AXM25586.1|3262999_3263968_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM25587.1|3264101_3264467_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25588.1|3264525_3264957_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXM25589.1|3264968_3266231_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
AXM25590.1|3266214_3267507_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
AXM25591.1|3267876_3268647_+	phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AXM25592.1|3269403_3270639_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXM26960.1|3271938_3272196_-	stress-induced protein	NA	NA	NA	NA	NA
AXM25593.1|3272635_3273619_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	1.5e-99
AXM25594.1|3273934_3274903_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM25595.1|3275031_3275994_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM25596.1|3276433_3276613_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25597.1|3276977_3277943_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM25598.1|3279150_3280128_+	siroheme synthase	NA	NA	NA	NA	NA
AXM25599.1|3280936_3281131_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AXM25600.1|3282524_3282887_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25601.1|3282870_3283440_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
AXM25602.1|3283477_3284731_-	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AXM25603.1|3284936_3285314_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26961.1|3286987_3287194_-|transposase	transposase	transposase	NA	NA	NA	NA
AXM25604.1|3287242_3288478_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM26962.1|3289315_3290350_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 25
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	3431480	3491793	4900521	protease,transposase,tRNA	Burkholderia_virus(14.29%)	51	NA	NA
AXM25701.1|3431480_3432244_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM25702.1|3433267_3435634_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXM26972.1|3435630_3436305_-	methylamine utilization protein	NA	NA	NA	NA	NA
AXM25703.1|3436514_3437453_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
AXM25704.1|3437575_3438925_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AXM25705.1|3438921_3439809_-	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AXM25706.1|3440126_3440933_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AXM25707.1|3441378_3442596_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AXM25708.1|3442701_3443670_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
AXM25709.1|3444012_3444681_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AXM25710.1|3444677_3445451_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AXM26973.1|3446024_3448091_-	ferrous iron transporter B	NA	NA	NA	NA	NA
AXM25711.1|3448657_3449683_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXM25712.1|3449767_3450841_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
AXM25713.1|3450833_3451937_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
AXM25714.1|3451947_3452874_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AXM25715.1|3452954_3453605_+	SCO family protein	NA	NA	NA	NA	NA
AXM25716.1|3453601_3454450_+	phosphatidylserine decarboxylase proenzyme	NA	NA	NA	NA	NA
AXM25717.1|3455000_3456584_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
AXM26974.1|3456503_3456689_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25718.1|3458006_3459224_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXM25719.1|3459184_3459406_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26975.1|3459582_3460089_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
AXM25720.1|3460210_3461611_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AXM25721.1|3461873_3462449_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
AXM25722.1|3462445_3462880_+	HIT family protein	NA	NA	NA	NA	NA
AXM25723.1|3462907_3463075_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25724.1|3463726_3463912_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25725.1|3463946_3464516_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
AXM25726.1|3464608_3465460_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AXM25727.1|3466847_3468863_+	M13 family peptidase	NA	NA	NA	NA	NA
AXM25728.1|3469133_3469832_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXM25729.1|3469872_3470280_-	cysteine methyltransferase	NA	NA	NA	NA	NA
AXM25730.1|3470717_3471680_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM25731.1|3472963_3474214_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXM25732.1|3474221_3475466_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
AXM25733.1|3475693_3476173_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXM26976.1|3476283_3476820_+	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
AXM25734.1|3476929_3477679_+	NlpC/P60 family protein	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
AXM25735.1|3477886_3478378_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AXM25736.1|3479491_3480811_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AXM25737.1|3480954_3482661_+	alkaline phosphatase	NA	NA	NA	NA	NA
AXM25738.1|3482694_3483999_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AXM25739.1|3484030_3484291_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AXM25740.1|3484292_3485168_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
AXM26977.1|3487002_3487467_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
AXM25741.1|3487518_3487707_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25742.1|3487679_3488000_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26978.1|3487996_3489364_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AXM25743.1|3489509_3490091_+	ribosome-associated protein	NA	NA	NA	NA	NA
AXM25744.1|3490347_3491793_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 26
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	3510893	3559595	4900521	transposase,tRNA,integrase	Ralstonia_phage(33.33%)	41	3533712:3533771	3550382:3551045
AXM25757.1|3510893_3513536_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
AXM25758.1|3513608_3514220_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
AXM25759.1|3514424_3515282_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
AXM25760.1|3515537_3515987_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AXM25761.1|3516286_3517252_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM25762.1|3517376_3518139_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM25763.1|3518196_3518385_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25764.1|3518749_3519043_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25765.1|3519516_3519750_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
AXM25766.1|3519783_3520797_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXM25767.1|3520764_3520956_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25768.1|3521046_3522366_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM25769.1|3522453_3523668_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
AXM25770.1|3523813_3524341_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25771.1|3524337_3525303_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM25772.1|3525543_3526306_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM25773.1|3526608_3528741_+	glycogen debranching enzyme GlgX	NA	NA	NA	NA	NA
AXM25774.1|3529291_3530260_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXM25775.1|3530451_3531420_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM25776.1|3531564_3532530_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM25777.1|3532495_3532909_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AXM25778.1|3532905_3533669_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3533712:3533771	attL	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTC	NA	NA	NA	NA
AXM25779.1|3534540_3535338_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM25780.1|3535371_3535764_-	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AXM25781.1|3535854_3536247_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26979.1|3538585_3539005_+|integrase	integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
AXM25782.1|3540232_3540457_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25783.1|3540721_3542506_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
AXM25784.1|3542696_3542897_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AXM25785.1|3543432_3544227_+	thiazole synthase	NA	NA	NA	NA	NA
AXM25786.1|3544219_3544513_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25787.1|3544528_3545287_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AXM25788.1|3545362_3547225_+	SLC13 family permease	NA	NA	NA	NA	NA
AXM26980.1|3547282_3547624_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AXM25789.1|3547883_3548159_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25790.1|3551205_3551919_+	FAA hydrolase family protein	NA	NA	NA	NA	NA
3550382:3551045	attR	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTCAGCACAAGCCCAAACGCGGATGACGGCGTACAACGGCGGCCACACGCAGCTGGGTGCCGGAGGAGTTGCGGATTGTGCATCGCCCCGAAGAAGTGCAGACGCGCTTGGTCCCAGGTCATTGGGAAGGCGACTTGATCAAGGGCGCATTCAATCGTTCTTGCGTGGGCACGTTGGTGGAACGCAAGACGCGCTTTGTCGTGCTGTGCCGCATGGATGGCTGCACGGCCGCAGATGCGCTGGAAGGGTTTACCCGGCAAATGAAGAAACTGCCGGCCTCAATGCGGACAAGTCTGACCTACGATCGCGGTACCGAGCTCACGTGCTACGCCGAGCTGATGCAAGGATTGAACATCGACGTGTGGTTCGCTGATCCACATGCGCCGTGGCAGCGGGGAAGTAACGAGAACACCAACGGCCTGCTGCGCCAATTCCTGCCCAAGGGCGCCGACCTGTCCACTGTCAGCCAAGAGTATCTCAATCACATCGCACTGCTGATGAATACCCGCCCTCGTCAGACGCTCGGATGGAAGACACCAAGCGAGGCAATGGAGGAAGAAATCGCAGCACTCAAATCACGTGTTGCACTTGAATCTTGAGACTGCCC	NA	NA	NA	NA
AXM25791.1|3551979_3552402_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
AXM25792.1|3552533_3553297_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM25793.1|3556370_3557282_-	RNA methyltransferase	NA	NA	NA	NA	NA
AXM26981.1|3557797_3557935_-	acetyltransferase	NA	NA	NA	NA	NA
AXM25794.1|3558629_3559595_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 27
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	3607045	3651621	4900521	protease,transposase	Ralstonia_phage(50.0%)	34	NA	NA
AXM25823.1|3607045_3608014_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXM26984.1|3609034_3610069_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM25824.1|3610452_3611178_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXM25825.1|3611309_3611771_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25826.1|3615217_3617338_-	S9 family peptidase	NA	NA	NA	NA	NA
AXM25827.1|3617604_3618450_-	transporter	NA	NA	NA	NA	NA
AXM25828.1|3618706_3619069_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25829.1|3619441_3620410_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM25830.1|3620734_3622705_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
AXM25831.1|3623133_3624531_+|protease	serine protease	protease	NA	NA	NA	NA
AXM26985.1|3624643_3625462_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
AXM26986.1|3625772_3628970_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.0e-81
AXM26987.1|3629010_3629193_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25832.1|3629205_3630624_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
AXM26988.1|3630633_3631236_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
AXM25833.1|3631285_3631891_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
AXM25834.1|3632040_3632262_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXM25835.1|3632271_3632697_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
AXM25836.1|3633188_3633986_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM25837.1|3635063_3635843_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AXM25838.1|3636057_3636687_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM25839.1|3636747_3637503_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26989.1|3637831_3638608_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25840.1|3638604_3638847_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25841.1|3639016_3640591_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AXM26990.1|3640839_3641106_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25842.1|3641384_3644564_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	1.2e-73
AXM25843.1|3644629_3645598_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM25844.1|3645797_3647117_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM25845.1|3647200_3647875_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25846.1|3647874_3648621_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25847.1|3649276_3650245_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXM25848.1|3650359_3650650_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AXM25849.1|3650652_3651621_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 28
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	3667885	3726588	4900521	transposase,plate	Staphylococcus_prophage(20.0%)	35	NA	NA
AXM25861.1|3667885_3668842_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
AXM25862.1|3668816_3671255_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25863.1|3671166_3672198_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25864.1|3672206_3674144_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25865.1|3674055_3675075_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25866.1|3675079_3677023_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25867.1|3676934_3677957_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25868.1|3679921_3680947_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25869.1|3680950_3683818_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25870.1|3683836_3684742_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM25871.1|3684683_3687446_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	9.6e-43
AXM25872.1|3687538_3687892_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25873.1|3687922_3690652_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
AXM25874.1|3690737_3691829_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXM25875.1|3691792_3693628_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXM25876.1|3693630_3694119_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXM25877.1|3694266_3694764_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AXM25878.1|3694905_3696402_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AXM25879.1|3696405_3696906_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AXM25880.1|3696952_3697441_-	hypothetical protein	NA	NA	NA	NA	NA
AXM25881.1|3697827_3698436_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AXM25882.1|3698587_3699922_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXM26993.1|3699921_3700710_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AXM25883.1|3700720_3703438_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AXM25884.1|3703434_3704412_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25885.1|3704970_3707139_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AXM25886.1|3707163_3710058_+	calcium-binding protein	NA	A0A2D1GNI0	Pseudomonas_phage	27.5	7.5e-06
AXM25887.1|3710296_3711259_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM25888.1|3711972_3713406_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AXM25889.1|3713409_3715665_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25890.1|3718024_3718414_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
AXM25891.1|3718394_3720626_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AXM25892.1|3720625_3721222_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM25893.1|3721214_3722039_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM25894.1|3725619_3726588_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 29
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	3775977	3786808	4900521	transposase	Burkholderia_virus(28.57%)	9	NA	NA
AXM26999.1|3775977_3776781_-	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
AXM25931.1|3777211_3777394_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25932.1|3777865_3780820_+	glycine dehydrogenase (aminomethyl-transferring)	NA	M4QFZ1	Prochlorococcus_phage	49.9	5.3e-257
AXM25933.1|3780879_3781062_+	hypothetical protein	NA	NA	NA	NA	NA
AXM25934.1|3781149_3781599_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
AXM25935.1|3781595_3782291_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.2e-36
AXM25936.1|3782298_3783369_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	5.7e-60
AXM25937.1|3783365_3784451_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.9	4.0e-61
AXM25938.1|3785851_3786808_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 30
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	4094365	4189479	4900521	transposase,tRNA	Ralstonia_phage(17.65%)	66	NA	NA
AXM27026.1|4094365_4095973_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM26194.1|4096170_4096398_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
AXM26195.1|4096402_4097062_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
AXM26196.1|4097248_4098613_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AXM27027.1|4098828_4099524_+	VIT family protein	NA	NA	NA	NA	NA
AXM26197.1|4100470_4101094_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AXM27028.1|4101295_4102036_+	cytochrome c4	NA	NA	NA	NA	NA
AXM26198.1|4102129_4102780_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
AXM26199.1|4102871_4103687_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
AXM27029.1|4103736_4104474_+	EEP domain-containing protein	NA	NA	NA	NA	NA
AXM26200.1|4106402_4107398_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.0	5.4e-97
AXM26201.1|4107520_4110094_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
AXM26202.1|4110286_4111049_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM26203.1|4111122_4112091_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM26204.1|4112824_4113091_+|transposase	transposase	transposase	NA	NA	NA	NA
AXM26205.1|4114022_4114821_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM27030.1|4116467_4117700_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	K4IEX3	Salmonella_phage	41.7	2.0e-72
AXM26206.1|4117739_4118702_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM26207.1|4118877_4119834_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM26208.1|4120045_4121014_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM26209.1|4121349_4122112_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM26210.1|4125522_4126488_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM26211.1|4126949_4127180_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26212.1|4127804_4129847_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
AXM26213.1|4129848_4131747_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
AXM26214.1|4131748_4133002_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
AXM26215.1|4132998_4133604_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
AXM26216.1|4134023_4135178_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AXM26217.1|4135180_4136209_-	SIS domain-containing protein	NA	NA	NA	NA	NA
AXM26218.1|4136205_4137282_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM26219.1|4137322_4138600_-	glucose/galactose MFS transporter	NA	NA	NA	NA	NA
AXM26220.1|4138644_4139412_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXM26221.1|4139626_4140793_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
AXM26222.1|4140926_4143323_-	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AXM26223.1|4143319_4146217_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
AXM26224.1|4146367_4149058_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM26225.1|4149339_4150296_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.6e-42
AXM26226.1|4150329_4150542_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26227.1|4150786_4152022_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM26228.1|4153457_4154642_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM26229.1|4154709_4155447_+	pteridine reductase	NA	NA	NA	NA	NA
AXM26230.1|4155615_4156131_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AXM26231.1|4156222_4157725_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
AXM26232.1|4157728_4158169_-	response regulator	NA	NA	NA	NA	NA
AXM26233.1|4158165_4159977_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
AXM27031.1|4160262_4160625_-	BON domain-containing protein	NA	NA	NA	NA	NA
AXM26234.1|4160784_4161837_+	oxidoreductase	NA	NA	NA	NA	NA
AXM26235.1|4162176_4163118_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
AXM26236.1|4163138_4164476_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26237.1|4164647_4165028_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AXM26238.1|4165152_4165914_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
AXM26239.1|4168162_4169566_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	52.1	1.2e-131
AXM26240.1|4169688_4170744_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.7e-80
AXM26241.1|4170905_4171772_+	endonuclease	NA	NA	NA	NA	NA
AXM26242.1|4172063_4174247_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	31.4	1.8e-81
AXM27032.1|4174745_4175741_-	restriction endonuclease	NA	NA	NA	NA	NA
AXM26243.1|4175836_4177648_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM26244.1|4177892_4178906_-	lipoyl synthase	NA	NA	NA	NA	NA
AXM26245.1|4178920_4179619_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
AXM26246.1|4179606_4179885_-	DUF493 family protein	NA	NA	NA	NA	NA
AXM26247.1|4180950_4182156_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
AXM26248.1|4182264_4182546_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26249.1|4182656_4184072_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
AXM26250.1|4184068_4185208_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AXM26251.1|4186947_4188222_-	DUF3380 domain-containing protein	NA	B3FJ91	Pseudomonas_phage	33.7	1.2e-21
AXM26252.1|4188516_4189479_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
>prophage 31
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	4255616	4385045	4900521	transposase,tRNA	Leptospira_phage(20.0%)	103	NA	NA
AXM26295.1|4255616_4256380_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM27038.1|4257427_4258213_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
AXM26296.1|4258235_4258442_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26297.1|4258466_4260140_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
AXM26298.1|4260683_4261130_-	autotransporter	NA	NA	NA	NA	NA
AXM26299.1|4261460_4261745_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26300.1|4262339_4263251_-	magnesium transporter	NA	NA	NA	NA	NA
AXM27039.1|4263496_4264492_+	type III secretion system effector protein	NA	NA	NA	NA	NA
AXM27040.1|4264585_4265962_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
AXM26301.1|4267128_4268829_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
AXM26302.1|4269237_4271010_+	cellulase	NA	NA	NA	NA	NA
AXM27041.1|4271285_4272170_-	DMT family transporter	NA	NA	NA	NA	NA
AXM27042.1|4272358_4273237_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM26303.1|4275276_4276368_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
AXM26304.1|4278270_4280595_+	S9 family peptidase	NA	NA	NA	NA	NA
AXM26305.1|4280790_4282737_-	S9 family peptidase	NA	NA	NA	NA	NA
AXM26306.1|4283111_4283303_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26307.1|4283693_4285277_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
AXM27043.1|4285624_4286221_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26308.1|4287569_4288418_-	threonine aldolase	NA	NA	NA	NA	NA
AXM26309.1|4288452_4289928_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
AXM26310.1|4290518_4291448_-	lipid kinase YegS	NA	NA	NA	NA	NA
AXM26311.1|4291682_4292174_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM27044.1|4292170_4292842_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AXM26312.1|4293236_4293566_-	J domain-containing protein	NA	NA	NA	NA	NA
AXM26313.1|4293768_4294701_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
AXM26314.1|4295489_4296288_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM27045.1|4296435_4297470_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM26315.1|4300337_4300823_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
AXM26316.1|4301361_4304190_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
AXM26317.1|4304189_4304564_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
AXM26318.1|4304560_4306111_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
AXM26319.1|4306107_4306614_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
AXM26320.1|4306610_4306895_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
AXM26321.1|4306891_4307245_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
AXM27046.1|4307692_4308031_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26322.1|4308454_4309780_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
AXM26323.1|4310144_4311215_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
AXM26324.1|4311385_4311874_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXM26325.1|4312230_4312821_-	thioredoxin family protein	NA	NA	NA	NA	NA
AXM26326.1|4312832_4314341_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.6	2.9e-62
AXM26327.1|4314783_4315677_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
AXM26328.1|4317051_4317717_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
AXM26329.1|4318349_4319315_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM26330.1|4319847_4320228_+	peptide-binding protein	NA	NA	NA	NA	NA
AXM26331.1|4320430_4321336_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26332.1|4321404_4322700_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
AXM27047.1|4322790_4323354_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26333.1|4323779_4325045_-	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
AXM26334.1|4325041_4326019_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26335.1|4326122_4326926_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AXM26336.1|4327101_4327911_+	glycosyl transferase	NA	NA	NA	NA	NA
AXM26337.1|4327918_4328717_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM27048.1|4328759_4329407_-	hypothetical protein	NA	NA	NA	NA	NA
AXM27049.1|4329501_4330077_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26338.1|4330288_4331608_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM26339.1|4331757_4332726_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM26340.1|4332851_4333604_-	HAD family hydrolase	NA	NA	NA	NA	NA
AXM26341.1|4333641_4334082_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
AXM27050.1|4334288_4334630_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
AXM26342.1|4334855_4335233_-	hypothetical protein	NA	NA	NA	NA	NA
AXM27051.1|4335443_4335641_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
AXM26343.1|4335947_4336694_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
AXM26344.1|4336786_4337593_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AXM27052.1|4337816_4339229_+	NlpC-P60 family protein	NA	NA	NA	NA	NA
AXM26345.1|4339225_4340323_+	dipeptide epimerase	NA	NA	NA	NA	NA
AXM26346.1|4340477_4341276_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM26347.1|4341329_4342128_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM26348.1|4342347_4343310_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM26349.1|4343757_4344521_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM26350.1|4344802_4345579_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26351.1|4345575_4346892_+	amino acid permease	NA	NA	NA	NA	NA
AXM26352.1|4347408_4348644_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM26353.1|4349237_4349519_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26354.1|4350079_4350514_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26355.1|4350688_4351867_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
AXM26356.1|4351902_4352229_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26357.1|4352862_4353825_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM26358.1|4356158_4358330_-	beta-glucosidase	NA	NA	NA	NA	NA
AXM26359.1|4358557_4358914_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AXM26360.1|4358992_4360057_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
AXM26361.1|4360336_4360552_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXM26362.1|4360859_4361306_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
AXM26363.1|4362783_4363746_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
AXM26364.1|4363835_4365584_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
AXM26365.1|4366911_4367157_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26366.1|4367156_4367390_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26367.1|4367647_4368694_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
AXM26368.1|4368877_4370458_+	thioredoxin family protein	NA	NA	NA	NA	NA
AXM26369.1|4370846_4371743_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AXM26370.1|4371745_4372909_-	heme A synthase	NA	NA	NA	NA	NA
AXM26371.1|4372919_4373495_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26372.1|4373522_4374242_-	SURF1 family protein	NA	NA	NA	NA	NA
AXM26373.1|4374302_4374521_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
AXM26374.1|4374634_4375510_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
AXM26375.1|4375548_4376145_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
AXM26376.1|4376141_4376315_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26377.1|4376295_4377900_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
AXM26378.1|4377938_4378892_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AXM26379.1|4378908_4379385_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
AXM26380.1|4379661_4382862_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
AXM26381.1|4383021_4384000_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
AXM26382.1|4384079_4385045_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 32
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	4397284	4477747	4900521	transposase,tRNA,integrase	Leptospira_phage(21.43%)	56	4454288:4454307	4468347:4468366
AXM27055.1|4397284_4398386_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
AXM26396.1|4398990_4401222_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
AXM27056.1|4401411_4403124_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26397.1|4403272_4404649_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.4e-79
AXM26398.1|4406856_4407655_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM26399.1|4408639_4409608_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXM26400.1|4409774_4410746_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
AXM26401.1|4410938_4412123_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXM26402.1|4412590_4413406_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
AXM26403.1|4414164_4415481_-	amidohydrolase	NA	NA	NA	NA	NA
AXM26404.1|4415740_4416985_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM26405.1|4417077_4420326_+	acriflavine resistance protein B	NA	NA	NA	NA	NA
AXM26406.1|4420459_4423600_+	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AXM26407.1|4423889_4425257_-	VOC family protein	NA	NA	NA	NA	NA
AXM26408.1|4425266_4425476_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26409.1|4426001_4426967_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM26410.1|4427385_4428351_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM27057.1|4428813_4429284_+	thioesterase	NA	NA	NA	NA	NA
AXM26411.1|4429312_4429735_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26412.1|4429810_4430245_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AXM26413.1|4430354_4430870_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
AXM26414.1|4430885_4431911_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AXM26415.1|4432233_4432830_-	Ax21 family protein	NA	NA	NA	NA	NA
AXM26416.1|4433187_4434915_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AXM26417.1|4434964_4436407_+	sensor histidine kinase	NA	NA	NA	NA	NA
AXM26418.1|4436391_4437738_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXM26419.1|4437928_4438678_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26420.1|4438779_4439391_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26421.1|4439495_4440719_+	MFS transporter	NA	NA	NA	NA	NA
AXM26422.1|4441060_4441537_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AXM26423.1|4441563_4442025_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26424.1|4442410_4442731_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AXM26425.1|4442832_4443849_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
AXM26426.1|4443920_4445084_+	Fic family protein	NA	NA	NA	NA	NA
AXM26427.1|4445080_4446712_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
AXM26428.1|4446713_4449215_+	helicase SNF2	NA	NA	NA	NA	NA
AXM26429.1|4449211_4450114_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AXM26430.1|4450335_4450719_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AXM26431.1|4451037_4452708_+	peptide synthase	NA	NA	NA	NA	NA
AXM26432.1|4452936_4453947_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.6	1.5e-14
AXM26433.1|4454011_4454170_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
4454288:4454307	attL	AGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
AXM26434.1|4454404_4455781_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
AXM26435.1|4455791_4456325_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXM26436.1|4456753_4458013_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
AXM26437.1|4458151_4459459_-	MFS transporter	NA	NA	NA	NA	NA
AXM27058.1|4461543_4462578_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM26438.1|4462928_4463474_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AXM27059.1|4463499_4463766_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AXM26439.1|4463940_4465779_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AXM26440.1|4466009_4466885_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
AXM27060.1|4468707_4468971_-	xanthomonadin biosynthesis protein	NA	NA	NA	NA	NA
4468347:4468366	attR	GGGGTTTTTCAGGGGCGACT	NA	NA	NA	NA
AXM26441.1|4469002_4470145_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
AXM26442.1|4471271_4472171_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AXM26443.1|4473118_4475920_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
AXM26444.1|4475996_4476287_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
AXM26445.1|4476644_4477747_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	6.7e-40
>prophage 33
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	4631318	4697679	4900521	transposase,tRNA	Mycobacterium_phage(20.0%)	46	NA	NA
AXM26542.1|4631318_4633556_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AXM26543.1|4633844_4634753_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AXM26544.1|4634842_4636657_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
AXM27076.1|4637042_4645499_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26545.1|4645966_4646764_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM26546.1|4646678_4646909_-	hypothetical protein	NA	NA	NA	NA	NA
AXM27077.1|4646936_4647173_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26547.1|4647308_4648061_+	glutamine amidotransferase	NA	NA	NA	NA	NA
AXM26548.1|4648120_4649020_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26549.1|4649171_4649927_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
AXM26550.1|4649923_4650559_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AXM26551.1|4650574_4650802_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AXM26552.1|4650874_4651777_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26553.1|4651931_4652897_+	ferrochelatase	NA	NA	NA	NA	NA
AXM26554.1|4652994_4653750_+	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
AXM26555.1|4653830_4654289_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26556.1|4654559_4655345_-	M48 family peptidase	NA	NA	NA	NA	NA
AXM26557.1|4655370_4655598_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26558.1|4655971_4656877_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	4.1e-43
AXM26559.1|4656940_4657858_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
AXM26560.1|4657948_4658458_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26561.1|4658461_4659799_+	xylose isomerase	NA	NA	NA	NA	NA
AXM26562.1|4660024_4661092_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM26563.1|4661267_4663463_+	alpha-glucuronidase	NA	NA	NA	NA	NA
AXM26564.1|4663459_4665424_+	9-O-acetylesterase	NA	NA	NA	NA	NA
AXM26565.1|4665435_4666695_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
AXM27078.1|4666694_4668395_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
AXM26566.1|4668397_4671112_+	glucan 1,4-alpha-glucosidase	NA	NA	NA	NA	NA
AXM26567.1|4671334_4672807_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
AXM26568.1|4673784_4674840_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26569.1|4675067_4676486_-	glucuronate isomerase	NA	NA	NA	NA	NA
AXM26570.1|4676526_4677504_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
AXM26571.1|4678920_4680402_-	MFS transporter	NA	NA	NA	NA	NA
AXM27079.1|4680743_4683617_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM26572.1|4683715_4685203_+	MFS transporter	NA	NA	NA	NA	NA
AXM26573.1|4685234_4686269_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AXM26574.1|4686685_4687483_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM27080.1|4688359_4688497_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26575.1|4688789_4689746_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM26576.1|4690473_4691236_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM26577.1|4691253_4692354_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXM26578.1|4692419_4693541_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
AXM26579.1|4693550_4694645_-	ferredoxin reductase	NA	NA	NA	NA	NA
AXM26580.1|4694719_4695400_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
AXM26581.1|4695432_4696231_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM26582.1|4696359_4697679_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 34
CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	4815827	4888643	4900521	protease,transposase	Ralstonia_virus(20.0%)	56	NA	NA
AXM26664.1|4815827_4817063_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM27093.1|4817702_4817876_-	4-oxalomesaconate hydratase	NA	NA	NA	NA	NA
AXM26665.1|4817934_4818990_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
AXM26666.1|4818982_4819654_-	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
AXM26667.1|4819751_4821059_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM26668.1|4821075_4822494_+	cardiolipin synthase	NA	NA	NA	NA	NA
AXM26669.1|4823065_4824460_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AXM26670.1|4824459_4824798_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26671.1|4824807_4826994_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.7	2.2e-111
AXM26672.1|4827169_4827394_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26673.1|4827974_4828940_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM27094.1|4829115_4830531_-	amino acid permease	NA	NA	NA	NA	NA
AXM26674.1|4830747_4830957_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26675.1|4831021_4833346_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
AXM27095.1|4833751_4834114_+	hypothetical protein	NA	NA	NA	NA	NA
AXM27096.1|4834491_4835037_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
AXM26676.1|4838289_4839417_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
AXM26677.1|4840272_4841613_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26678.1|4841829_4842522_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXM27097.1|4842638_4842959_+	DUF1820 family protein	NA	NA	NA	NA	NA
AXM26679.1|4842958_4843951_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.4	8.5e-10
AXM26680.1|4844257_4845781_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.7e-25
AXM26681.1|4845885_4847121_-	peptidase M23	NA	NA	NA	NA	NA
AXM26682.1|4847281_4847938_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26683.1|4848088_4849900_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
AXM26684.1|4850047_4850398_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AXM26685.1|4850576_4851896_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM26686.1|4853308_4854490_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26687.1|4854587_4858019_-	ATP-binding protein	NA	NA	NA	NA	NA
AXM26688.1|4858166_4858865_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
AXM26689.1|4858848_4860321_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
AXM26690.1|4860317_4860905_-	DUF4276 family protein	NA	NA	NA	NA	NA
AXM26691.1|4860904_4862101_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AXM26692.1|4862174_4862804_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.9	1.2e-46
AXM26693.1|4862952_4863396_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXM26694.1|4863651_4864275_+	transporter	NA	NA	NA	NA	NA
AXM26695.1|4864271_4864838_+	FUSC family protein	NA	NA	NA	NA	NA
AXM26696.1|4865113_4866475_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.9	8.3e-32
AXM26697.1|4866588_4866909_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26698.1|4868724_4868931_+	hypothetical protein	NA	NA	NA	NA	NA
AXM26699.1|4868917_4870030_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXM26700.1|4872381_4873134_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26701.1|4873130_4873838_-	hypothetical protein	NA	A4PE25	Ralstonia_virus	34.6	2.0e-08
AXM26702.1|4873851_4874193_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26703.1|4874173_4874683_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	4.8e-09
AXM26704.1|4874679_4875081_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AXM26705.1|4875472_4876792_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM26706.1|4877903_4878161_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26707.1|4878209_4878647_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26708.1|4879021_4879315_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26709.1|4880239_4881409_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	1.3e-41
AXM27098.1|4881434_4882745_-	MFS transporter	NA	NA	NA	NA	NA
AXM26710.1|4884658_4884979_-	hypothetical protein	NA	NA	NA	NA	NA
AXM26711.1|4885097_4886264_-	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
AXM26712.1|4886526_4887483_+	TerC family protein	NA	K4F9T9	Cronobacter_phage	29.9	8.4e-31
AXM26713.1|4887857_4888643_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
