The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	7623	78747	4948537	transposase,protease	Ralstonia_phage(30.0%)	55	NA	NA
AXM19433.1|7623_8460_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXM19434.1|8646_9453_+	M48 family peptidase	NA	NA	NA	NA	NA
AXM19435.1|9729_10923_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AXM19436.1|11076_11748_+	energy transducer TonB	NA	NA	NA	NA	NA
AXM19437.1|11832_12594_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
AXM19438.1|12640_13063_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXM19439.1|13066_13480_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXM19440.1|13775_14543_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AXM19441.1|14553_14823_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19442.1|14897_16358_-	cardiolipin synthase	NA	NA	NA	NA	NA
AXM19443.1|17004_18015_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
AXM19444.1|18286_19489_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AXM19445.1|19630_21769_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
AXM22883.1|21979_22273_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19446.1|22389_22935_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19447.1|23048_24029_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	9.1e-89
AXM19448.1|24076_25243_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AXM19449.1|25389_25956_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
AXM19450.1|27430_28639_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
AXM19451.1|29266_30289_-	sugar kinase	NA	NA	NA	NA	NA
AXM19452.1|31111_32080_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXM19453.1|33526_34408_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.5e-05
AXM19454.1|35009_36386_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
AXM19455.1|39398_39641_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19456.1|39582_39906_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19457.1|40036_40423_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19458.1|40371_41352_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
AXM19459.1|41711_41963_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19460.1|41970_43260_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
AXM19461.1|43699_44035_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19462.1|44309_44741_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19463.1|45089_46499_-	FAD-binding protein	NA	NA	NA	NA	NA
AXM19464.1|47816_48077_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19465.1|48093_48426_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19466.1|48425_48884_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19467.1|49243_50458_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
AXM19468.1|50978_51776_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19469.1|53491_54457_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM19470.1|54453_54654_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19471.1|54875_56195_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM19472.1|56312_57359_+	methylamine utilization protein	NA	NA	NA	NA	NA
AXM19473.1|58160_58793_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AXM19474.1|58809_60972_-	glycogen debranching enzyme GlgX	NA	NA	NA	NA	NA
AXM19475.1|61086_61272_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
AXM19476.1|61294_63898_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
AXM22884.1|63894_65784_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AXM19477.1|65840_67598_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
AXM19478.1|67600_69835_-	glycogen-branching enzyme	NA	NA	NA	NA	NA
AXM19479.1|69831_71415_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
AXM19480.1|71888_73517_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXM19481.1|73513_74878_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
AXM19482.1|75070_76012_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AXM19483.1|76029_76242_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19484.1|76252_77977_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
AXM19485.1|77983_78747_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	109264	135480	4948537	transposase,holin	Ralstonia_phage(50.0%)	24	NA	NA
AXM19512.1|109264_110233_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXM19513.1|110445_111765_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM19514.1|111953_112937_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
AXM19515.1|113658_116031_+	serine kinase	NA	NA	NA	NA	NA
AXM22887.1|116906_118535_+	type III secretion system effector XopAE	NA	NA	NA	NA	NA
AXM19516.1|119092_119476_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19517.1|119472_119958_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AXM19518.1|119961_120324_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19519.1|120440_121877_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
AXM19520.1|122118_122970_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
AXM19521.1|123429_123747_-	ATP-binding protein	NA	NA	NA	NA	NA
AXM19522.1|124052_124940_-	TIGR01777 family protein	NA	NA	NA	NA	NA
AXM19523.1|125646_126597_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
AXM19524.1|126710_126896_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19525.1|126987_127260_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19526.1|127300_127582_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19527.1|127720_128779_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM19528.1|128919_129867_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
AXM19529.1|130121_130433_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19530.1|131705_131888_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19531.1|131899_132370_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AXM19532.1|132539_133232_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19533.1|133323_133722_+	host attachment protein	NA	NA	NA	NA	NA
AXM19534.1|134523_135480_+|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 3
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	170242	223683	4948537	transposase,tRNA,protease	Acidithiobacillus_phage(33.33%)	27	NA	NA
AXM22891.1|170242_171208_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM22892.1|172643_173442_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19553.1|173680_175063_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	4.7e-75
AXM19554.1|176464_177532_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM22893.1|177487_177685_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19555.1|177666_177762_-	xylosidase	NA	NA	NA	NA	NA
AXM19556.1|177737_178265_-	xylosidase	NA	NA	NA	NA	NA
AXM19557.1|179087_181271_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
AXM19558.1|181282_184633_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
AXM19559.1|184629_187746_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
AXM19560.1|194890_196210_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM19561.1|196366_197887_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AXM19562.1|197903_198182_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22894.1|198371_198710_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
AXM19563.1|199322_201308_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AXM19564.1|202227_203040_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19565.1|203232_203844_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19566.1|204260_205118_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
AXM19567.1|205355_207242_+	arginine decarboxylase	NA	NA	NA	NA	NA
AXM19568.1|207807_209184_+|transposase	IS5-like element ISXoo4 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	7.8e-78
AXM19569.1|209745_210508_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM22895.1|213195_215349_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.5	2.0e-27
AXM19570.1|215345_217037_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM19571.1|217033_217297_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	4.4e-06
AXM19572.1|217358_219560_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
AXM19573.1|219556_221245_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM19574.1|221778_223683_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 4
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	279492	339581	4948537	transposase	Bacillus_phage(25.0%)	40	NA	NA
AXM19612.1|279492_280461_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM19613.1|280714_282877_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
AXM19614.1|283424_284729_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
AXM19615.1|284788_285391_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
AXM19616.1|285387_287292_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
AXM19617.1|296610_297426_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
AXM19618.1|297772_298735_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM19619.1|298839_299602_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19620.1|301401_302460_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
AXM19621.1|302470_302761_-	STAS domain-containing protein	NA	NA	NA	NA	NA
AXM19622.1|302750_303413_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
AXM19623.1|303409_303961_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AXM19624.1|303972_304722_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM19625.1|304721_305516_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
AXM19626.1|305900_306188_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19627.1|306206_306764_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXM19628.1|306781_307747_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM19629.1|308591_309548_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
AXM19630.1|309619_310382_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19631.1|310421_311220_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19632.1|311351_312566_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
AXM19633.1|312625_313456_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19634.1|313618_314854_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXM19635.1|316252_316681_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22898.1|316700_317141_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AXM19636.1|317043_317349_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19637.1|317656_319411_-	polyvinylalcohol dehydrogenase	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
AXM19638.1|320345_321108_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19639.1|321161_321746_-	gluconokinase	NA	NA	NA	NA	NA
AXM19640.1|321903_323286_+	MFS transporter	NA	NA	NA	NA	NA
AXM22899.1|323288_325688_+	NdvB protein	NA	NA	NA	NA	NA
AXM19641.1|325791_328434_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19642.1|328840_329041_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22900.1|329181_332631_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AXM19643.1|332823_333408_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19644.1|333884_334661_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXM19645.1|334841_336143_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AXM22901.1|336139_336505_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
AXM19646.1|336941_338423_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
AXM22902.1|338615_339581_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	346134	412276	4948537	transposase,tRNA	Bathycoccus_sp._RCC1105_virus(14.29%)	52	NA	NA
AXM19650.1|346134_346566_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AXM19651.1|346658_347201_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
AXM19652.1|347296_348049_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AXM19653.1|348273_348663_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM19654.1|348776_350450_-	ubiquinone biosynthesis protein UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
AXM19655.1|350446_351091_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
AXM19656.1|351100_351295_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19657.1|351325_352429_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AXM19658.1|354775_355060_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19659.1|355411_356210_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19660.1|356269_357033_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM22903.1|360986_361952_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM19661.1|363012_364119_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19662.1|365730_365913_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22904.1|365912_366851_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AXM19663.1|366969_367719_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	5.6e-54
AXM19664.1|367721_368513_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM19665.1|368530_369526_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
AXM19666.1|369628_370390_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
AXM19667.1|370474_371476_-	cation transporter	NA	NA	NA	NA	NA
AXM19668.1|371541_371814_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AXM22905.1|372299_372887_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19669.1|372883_373084_+	transcriptional regulator	NA	NA	NA	NA	NA
AXM19670.1|373144_374746_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXM19671.1|374777_375524_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
AXM19672.1|375520_376714_+	ABC transporter permease	NA	NA	NA	NA	NA
AXM19673.1|377123_378146_-	energy transducer TonB	NA	NA	NA	NA	NA
AXM19674.1|378285_379851_-	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
AXM19675.1|379861_380875_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
AXM19676.1|380864_381566_-	peptidase	NA	NA	NA	NA	NA
AXM22906.1|381749_384764_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM19677.1|384937_385700_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19678.1|385969_386659_+	glutathione S-transferase	NA	NA	NA	NA	NA
AXM19679.1|387083_389321_+	S9 family peptidase	NA	NA	NA	NA	NA
AXM19680.1|389529_391320_+	DUF885 domain-containing protein	NA	NA	NA	NA	NA
AXM19681.1|391419_391878_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19682.1|392542_393535_+	porphobilinogen synthase	NA	NA	NA	NA	NA
AXM19683.1|394807_395722_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM19684.1|395849_396602_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.9	5.6e-22
AXM19685.1|396835_399370_+	iron-uptake factor	NA	NA	NA	NA	NA
AXM19686.1|400026_400908_-	TolB-like protein	NA	NA	NA	NA	NA
AXM19687.1|400960_401812_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AXM22907.1|401813_402200_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19688.1|402661_404794_+	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
AXM19689.1|405067_405334_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22908.1|405416_406382_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM19690.1|406394_406583_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19691.1|406544_407015_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM19692.1|407705_409229_+	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.2e-97
AXM19693.1|409287_409863_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AXM22909.1|410613_410808_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19694.1|411271_412276_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 6
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	567196	616683	4948537	transposase,tRNA,integrase	Stenotrophomonas_phage(25.0%)	43	575344:575360	613471:613487
AXM19811.1|567196_568162_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM19812.1|568629_569949_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM19813.1|570478_570994_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXM19814.1|571396_573619_-	primosomal protein N'	NA	NA	NA	NA	NA
AXM19815.1|574084_575110_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19816.1|575093_575696_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
575344:575360	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
AXM19817.1|576026_576971_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19818.1|577494_578871_+	MATE family efflux transporter	NA	NA	NA	NA	NA
AXM19819.1|578955_580857_+	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
AXM19820.1|581042_581258_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19821.1|581364_582141_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXM19822.1|582302_582977_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AXM19823.1|582973_583747_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AXM19824.1|583970_584534_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AXM19825.1|584544_587037_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
AXM19826.1|587219_588494_-	RDD family protein	NA	NA	NA	NA	NA
AXM19827.1|589285_589759_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AXM19828.1|589801_590944_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AXM19829.1|591015_592152_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
AXM19830.1|592284_592797_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
AXM19831.1|593190_594114_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
AXM19832.1|594113_595427_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
AXM19833.1|595477_597199_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AXM19834.1|597363_598641_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
AXM19835.1|598838_599663_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AXM19836.1|599663_600722_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
AXM19837.1|600887_602354_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22928.1|602350_602854_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19838.1|602963_604097_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
AXM19839.1|604339_604861_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXM19840.1|605060_605975_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
AXM19841.1|606075_606516_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AXM19842.1|606624_608499_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
AXM19843.1|608691_609012_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19844.1|609640_610915_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.4e-110
AXM19845.1|610827_611091_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	71.4	7.2e-17
AXM19846.1|611048_611255_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19847.1|611251_611524_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22929.1|611520_611766_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19848.1|613701_614937_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
613471:613487	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
AXM19849.1|615005_615395_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19850.1|615391_615595_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22930.1|615717_616683_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 7
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	764127	800446	4948537	transposase,tRNA	Enterobacteria_phage(36.36%)	33	NA	NA
AXM19977.1|764127_765447_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM22942.1|765762_766947_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
AXM19978.1|767476_768790_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
AXM19979.1|768779_769598_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM19980.1|769820_770762_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
AXM19981.1|770761_771508_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
AXM22943.1|771733_772789_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
AXM19982.1|772844_773732_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
AXM19983.1|773728_774286_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
AXM19984.1|774282_775191_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
AXM19985.1|775307_776711_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
AXM19986.1|776757_778104_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
AXM19987.1|778237_778969_+	CoA transferase subunit A	NA	NA	NA	NA	NA
AXM19988.1|778968_779598_+	CoA transferase subunit B	NA	NA	NA	NA	NA
AXM19989.1|779655_781743_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22944.1|781739_783389_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AXM19990.1|783504_784113_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
AXM19991.1|784506_784737_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19992.1|784663_785308_-	ABC transporter	NA	NA	NA	NA	NA
AXM19993.1|785304_786231_-	MCE family protein	NA	NA	NA	NA	NA
AXM19994.1|786233_787076_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	9.1e-13
AXM19995.1|787161_788274_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM19996.1|788443_789703_+	threonine/serine exporter	NA	NA	NA	NA	NA
AXM19997.1|789764_790226_-	DNA-binding protein	NA	NA	NA	NA	NA
AXM19998.1|790368_792063_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AXM19999.1|792174_792579_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AXM20000.1|792710_793484_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AXM20001.1|793494_793962_+	alanine acetyltransferase	NA	NA	NA	NA	NA
AXM22945.1|793967_794441_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AXM20002.1|794999_796319_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM20003.1|796476_797796_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM20004.1|798008_798977_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AXM20005.1|799126_800446_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	864933	908991	4948537	transposase,protease	Ralstonia_phage(25.0%)	40	NA	NA
AXM20046.1|864933_865899_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM20047.1|866289_866865_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AXM20048.1|866977_867487_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
AXM20049.1|867585_867780_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AXM20050.1|867869_868847_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
AXM20051.1|869076_869517_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
AXM20052.1|869794_870739_+	[acyl-carrier-protein] S-malonyltransferase	NA	NA	NA	NA	NA
AXM20053.1|870821_871565_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
AXM20054.1|871769_872009_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
AXM20055.1|872150_873386_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AXM20056.1|873556_874912_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
AXM20057.1|874972_876046_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
AXM20058.1|876042_877002_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
AXM20059.1|876998_877352_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AXM22949.1|877875_878349_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22950.1|879369_879696_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20060.1|879931_881530_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
AXM20061.1|881675_882572_+	methylisocitrate lyase	NA	NA	NA	NA	NA
AXM20062.1|882647_883802_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
AXM20063.1|883982_886574_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
AXM20064.1|886896_887034_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXM20065.1|887117_887315_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20066.1|887306_888506_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
AXM20067.1|888955_889924_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
AXM20068.1|890165_892382_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM20069.1|892460_893459_+	nucleoside hydrolase	NA	NA	NA	NA	NA
AXM20070.1|893568_893751_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20071.1|894730_897718_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM20072.1|897892_898840_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
AXM20073.1|899165_899387_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20074.1|899343_899880_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20075.1|899950_901270_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM20076.1|901614_902577_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.7e-42
AXM20077.1|902710_903271_-	bacterioferritin	NA	NA	NA	NA	NA
AXM20078.1|903313_903796_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
AXM20079.1|903958_904435_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXM20080.1|904845_905745_+	J domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
AXM20081.1|905984_906371_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
AXM22951.1|907000_908128_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
AXM20082.1|908127_908991_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 9
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	914291	1077646	4948537	transposase,integrase,protease	Ralstonia_phage(22.22%)	115	1005825:1005843	1074757:1074775
AXM20086.1|914291_915074_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM22952.1|915184_916561_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.7e-77
AXM20087.1|916804_917440_+	transcriptional regulator	NA	NA	NA	NA	NA
AXM20088.1|918066_918600_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20089.1|918725_918923_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AXM20090.1|918932_920045_+	glycosyltransferase	NA	NA	NA	NA	NA
AXM20091.1|920025_921360_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
AXM20092.1|921593_922514_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
AXM20093.1|922590_923907_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AXM20094.1|924179_925559_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20095.1|925579_926236_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
AXM20096.1|926364_927018_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM20097.1|927288_927750_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22953.1|928809_929694_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM20098.1|929814_931263_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AXM20099.1|931330_931978_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AXM20100.1|932794_933868_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AXM20101.1|934198_935761_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
AXM20102.1|935757_936882_-	threonine dehydratase	NA	NA	NA	NA	NA
AXM20103.1|936957_937215_-	acetolactate synthase	NA	NA	NA	NA	NA
AXM20104.1|937198_938920_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
AXM20105.1|938963_939965_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AXM20106.1|941241_943119_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
AXM20107.1|943544_945896_+	biopolymer transporter Tol	NA	NA	NA	NA	NA
AXM20108.1|946006_946900_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXM20109.1|946945_949915_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
AXM20110.1|950529_951645_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
AXM20111.1|951791_952328_-	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
AXM20112.1|952524_953007_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20113.1|955282_956248_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM22954.1|956244_956418_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20114.1|956702_957194_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20115.1|958873_960130_-	6-phosphofructokinase	NA	NA	NA	NA	NA
AXM20116.1|960289_960853_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
AXM22955.1|961219_962578_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
AXM20117.1|962577_963174_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AXM20118.1|963320_964205_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20119.1|966186_966801_+	glutathione S-transferase	NA	NA	NA	NA	NA
AXM20120.1|966883_967870_-	malate dehydrogenase	NA	NA	NA	NA	NA
AXM20121.1|967985_968480_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
AXM20122.1|968724_970554_+	translational GTPase TypA	NA	NA	NA	NA	NA
AXM20123.1|970572_971043_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
AXM20124.1|971965_973093_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AXM20125.1|973193_974576_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
AXM20126.1|974823_976947_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM20127.1|977475_977994_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AXM20128.1|978700_979802_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
AXM20129.1|980317_981553_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM22956.1|982166_983057_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20130.1|986846_988082_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM20131.1|989064_990384_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM22957.1|993113_994079_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM20132.1|994380_995958_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20133.1|996025_996789_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM20134.1|999457_1000426_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM20135.1|1000428_1000710_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20136.1|1000686_1001148_-	cell wall hydrolase	NA	NA	NA	NA	NA
AXM20137.1|1001696_1001939_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
AXM20138.1|1001932_1002696_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM20139.1|1002728_1003460_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
AXM20140.1|1005279_1006032_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1005825:1005843	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
AXM20141.1|1006033_1006999_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM20142.1|1007262_1008270_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
AXM20143.1|1008413_1009175_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20144.1|1012492_1013785_+	trigger factor	NA	NA	NA	NA	NA
AXM20145.1|1013877_1014504_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
AXM20146.1|1014628_1015915_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
AXM20147.1|1016058_1018530_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
AXM20148.1|1018743_1019016_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
AXM20149.1|1019847_1021818_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXM20150.1|1022523_1023702_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AXM20151.1|1023698_1024466_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AXM20152.1|1024478_1025135_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20153.1|1025162_1025615_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
AXM20154.1|1025623_1026358_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
AXM20155.1|1026793_1027498_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
AXM20156.1|1028323_1028953_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20157.1|1029845_1030046_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20158.1|1030441_1033165_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.3	9.7e-72
AXM22958.1|1033232_1035383_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
AXM20159.1|1035379_1037077_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM20160.1|1037396_1039601_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
AXM20161.1|1039597_1041292_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM20162.1|1041288_1041552_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
AXM20163.1|1041613_1043821_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
AXM20164.1|1043817_1045497_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM20165.1|1045493_1045757_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
AXM20166.1|1045818_1046376_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22959.1|1046458_1047424_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM22960.1|1047522_1048209_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
AXM20167.1|1048319_1048724_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
AXM20168.1|1048934_1049984_-	lipopolysaccharide heptosyltransferase family protein	NA	NA	NA	NA	NA
AXM20169.1|1050004_1050754_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
AXM20170.1|1050753_1051503_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
AXM20171.1|1051502_1052534_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
AXM20172.1|1052551_1052911_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AXM20173.1|1052935_1053433_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AXM20174.1|1053429_1053675_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
AXM20175.1|1053671_1054118_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
AXM20176.1|1054679_1056776_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
AXM20177.1|1056782_1057103_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AXM20178.1|1057200_1057794_+	recombination protein RecR	NA	NA	NA	NA	NA
AXM20179.1|1057895_1058246_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AXM20180.1|1058365_1058899_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20181.1|1058895_1060848_-	DUF3488 domain-containing protein	NA	NA	NA	NA	NA
AXM20182.1|1060840_1061797_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
AXM20183.1|1061802_1062756_-	MoxR family ATPase	NA	NA	NA	NA	NA
AXM20184.1|1062794_1064663_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AXM20185.1|1066178_1066694_+	peptide deformylase	NA	NA	NA	NA	NA
AXM22961.1|1068441_1069188_+	cellulase	NA	NA	NA	NA	NA
AXM20186.1|1069804_1071406_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
AXM20187.1|1072394_1073630_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM20188.1|1074458_1075427_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
1074757:1074775	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
AXM20189.1|1075894_1076245_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
AXM20190.1|1076326_1077646_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 10
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	1116376	1158823	4948537	transposase	Leptospira_phage(25.0%)	40	NA	NA
AXM22964.1|1116376_1117478_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
AXM20219.1|1118908_1119532_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
AXM20220.1|1119555_1119795_+	rubredoxin	NA	NA	NA	NA	NA
AXM20221.1|1119844_1120726_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22965.1|1120875_1121325_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
AXM20222.1|1121475_1122123_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
AXM20223.1|1122214_1122685_-	EVE domain-containing protein	NA	NA	NA	NA	NA
AXM20224.1|1122681_1123272_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AXM20225.1|1123880_1124180_-	cell division protein ZapA	NA	NA	NA	NA	NA
AXM22967.1|1124176_1124398_-	TIGR02449 family protein	NA	NA	NA	NA	NA
AXM22966.1|1124633_1125176_+	YecA family protein	NA	NA	NA	NA	NA
AXM20226.1|1125186_1126527_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AXM20227.1|1127234_1127998_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM22968.1|1128230_1129556_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
AXM20228.1|1129754_1130102_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
AXM20229.1|1130098_1132507_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
AXM20230.1|1132685_1133843_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
AXM20231.1|1133858_1134458_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
AXM20232.1|1134454_1134850_-	glyoxalase	NA	NA	NA	NA	NA
AXM20233.1|1134846_1135572_-	ribonuclease PH	NA	NA	NA	NA	NA
AXM20234.1|1135681_1136542_+	YicC family protein	NA	NA	NA	NA	NA
AXM20235.1|1136658_1137270_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
AXM20236.1|1137450_1138248_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM20237.1|1138396_1138696_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AXM20238.1|1138824_1140996_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
AXM20239.1|1141075_1141456_+	RidA family protein	NA	NA	NA	NA	NA
AXM20240.1|1141476_1143630_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AXM20241.1|1143755_1144694_+	nucleoside hydrolase	NA	NA	NA	NA	NA
AXM20242.1|1144765_1145008_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AXM22969.1|1145221_1146511_+	citrate synthase	NA	NA	NA	NA	NA
AXM20243.1|1146888_1147539_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20244.1|1147848_1150371_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
AXM20245.1|1150493_1151552_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
AXM20246.1|1151551_1152310_+	fimbrial protein	NA	NA	NA	NA	NA
AXM20247.1|1152306_1152972_+	fimbrial protein	NA	NA	NA	NA	NA
AXM20248.1|1152968_1153502_+	fimbrial protein	NA	NA	NA	NA	NA
AXM20249.1|1153521_1155471_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
AXM20250.1|1155541_1156340_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM20251.1|1156482_1157718_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXM20252.1|1157788_1158823_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	1198040	1229924	4948537	transposase	Feldmannia_irregularis_virus(16.67%)	25	NA	NA
AXM20278.1|1198040_1198803_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM20279.1|1198892_1199858_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM20280.1|1199967_1201287_-	sensor histidine kinase	NA	NA	NA	NA	NA
AXM20281.1|1201749_1202427_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
AXM22975.1|1202506_1202896_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22976.1|1203109_1203997_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
AXM20282.1|1204430_1205415_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	6.3e-98
AXM20283.1|1205588_1207676_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AXM20284.1|1207827_1208487_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AXM20285.1|1208567_1209365_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM20286.1|1209387_1209567_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20287.1|1209585_1209990_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
AXM20288.1|1210023_1210383_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
AXM20289.1|1210626_1211499_-	ion transporter	NA	NA	NA	NA	NA
AXM20290.1|1211571_1212798_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
AXM20291.1|1213042_1213660_-	hydrolase	NA	NA	NA	NA	NA
AXM20292.1|1215220_1216804_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
AXM20293.1|1216800_1217226_+	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
AXM20294.1|1217250_1217754_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20295.1|1219196_1219646_+	azurin	NA	NA	NA	NA	NA
AXM20296.1|1222892_1224182_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AXM20297.1|1226192_1227647_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20298.1|1228143_1229013_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
AXM20299.1|1229034_1229706_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
AXM20300.1|1229702_1229924_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 12
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	1396926	1464385	4948537	transposase	Ralstonia_phage(25.0%)	57	NA	NA
AXM22989.1|1396926_1398111_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXM22990.1|1398202_1399555_-	glutamine synthetase	NA	NA	NA	NA	NA
AXM20413.1|1399620_1400556_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
AXM20414.1|1400622_1401222_-	LysE family translocator	NA	NA	NA	NA	NA
AXM22991.1|1401256_1402117_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
AXM22992.1|1402134_1403175_-	dihydrorhizobitoxine desaturase	NA	NA	NA	NA	NA
AXM20415.1|1403201_1404524_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
AXM20416.1|1404523_1405678_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
AXM22993.1|1406942_1407908_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM20417.1|1409843_1410173_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
AXM20418.1|1410169_1410709_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM20419.1|1410910_1412155_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.9	2.3e-92
AXM20420.1|1412151_1413414_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AXM20421.1|1413413_1414178_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.9	1.6e-11
AXM20422.1|1414435_1415893_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AXM20423.1|1415908_1416367_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
AXM20424.1|1416538_1417006_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AXM20425.1|1417110_1417329_+	peptidase	NA	NA	NA	NA	NA
AXM20426.1|1417435_1417816_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20427.1|1417933_1418530_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
AXM20428.1|1418585_1419128_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20429.1|1419185_1419527_-	DUF3861 family protein	NA	NA	NA	NA	NA
AXM20430.1|1419584_1420226_-	M23 family peptidase	NA	NA	NA	NA	NA
AXM20431.1|1420331_1420757_-	DNA-binding protein	NA	NA	NA	NA	NA
AXM20432.1|1420917_1421118_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20433.1|1421120_1422089_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXM20434.1|1423951_1424812_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AXM20435.1|1424855_1425548_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AXM20436.1|1425911_1426949_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
AXM20437.1|1427062_1428193_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
AXM22994.1|1428482_1429139_+	YitT family protein	NA	NA	NA	NA	NA
AXM20438.1|1429762_1430335_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
AXM20439.1|1431604_1432171_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
AXM20440.1|1432163_1432631_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AXM20441.1|1432644_1433592_+	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
AXM20442.1|1434038_1434473_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AXM20443.1|1434625_1435225_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AXM20444.1|1435510_1436392_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
AXM20445.1|1437489_1440099_+	bifunctional aspartate kinase/diaminopimelate decarboxylase	NA	NA	NA	NA	NA
AXM20446.1|1440082_1440541_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20447.1|1440537_1441893_+	endonuclease domain-containing protein	NA	NA	NA	NA	NA
AXM20448.1|1441873_1443280_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AXM20449.1|1443269_1443500_+	AsmA family protein	NA	NA	NA	NA	NA
AXM20450.1|1443596_1444391_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
AXM20451.1|1444575_1445574_-	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
AXM20452.1|1445849_1446386_+	single-stranded DNA-binding protein	NA	A0A1B1W281	Salmonella_phage	58.5	3.6e-31
AXM20453.1|1446668_1448153_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.9	1.1e-13
AXM20454.1|1450627_1451390_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM20455.1|1451479_1452445_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM20456.1|1452824_1453502_+	HAD family hydrolase	NA	NA	NA	NA	NA
AXM20457.1|1454039_1454264_-	putative selenoprotein	NA	NA	NA	NA	NA
AXM20458.1|1454263_1456336_-	carbon starvation protein A	NA	NA	NA	NA	NA
AXM20459.1|1456567_1457425_+	pirin family protein	NA	NA	NA	NA	NA
AXM22995.1|1458460_1460863_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
AXM20460.1|1460917_1461778_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM20461.1|1461738_1462425_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM20462.1|1463416_1464385_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 13
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	1469973	1530495	4948537	transposase,tRNA	uncultured_Caudovirales_phage(25.0%)	51	NA	NA
AXM20465.1|1469973_1470737_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM22997.1|1471116_1471674_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM20466.1|1471723_1473832_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AXM20467.1|1473853_1475755_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.9e-30
AXM20468.1|1475809_1476670_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM20469.1|1476630_1477317_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM20470.1|1477780_1478014_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM22998.1|1478234_1478801_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM20471.1|1479003_1479591_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM22999.1|1479898_1480378_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM20472.1|1480374_1482783_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AXM20473.1|1483127_1483589_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20474.1|1483835_1484726_-	pirin family protein	NA	NA	NA	NA	NA
AXM20475.1|1484903_1485179_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23000.1|1485493_1486207_-	endonuclease V	NA	NA	NA	NA	NA
AXM20476.1|1486310_1487060_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AXM20477.1|1487420_1487672_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20478.1|1488004_1490062_+	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.2e-79
AXM23001.1|1492009_1493131_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AXM20479.1|1493145_1493973_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AXM20480.1|1493956_1495240_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AXM20481.1|1495266_1495782_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM20482.1|1495792_1497949_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
AXM20483.1|1498016_1500014_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AXM20484.1|1500032_1500362_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
AXM20485.1|1500851_1504316_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AXM20486.1|1504718_1505261_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXM23002.1|1505672_1506581_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AXM20487.1|1506926_1507725_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM20488.1|1507868_1508588_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AXM20489.1|1508743_1509778_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM20490.1|1509798_1510611_-	peptidase C1	NA	NA	NA	NA	NA
AXM20491.1|1511346_1511730_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20492.1|1511852_1513022_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
AXM20493.1|1513016_1514075_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
AXM23003.1|1514135_1514948_-	peptidase C1	NA	NA	NA	NA	NA
AXM20494.1|1515463_1515847_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20495.1|1515969_1517133_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
AXM20496.1|1517163_1517976_-	peptidase C1	NA	NA	NA	NA	NA
AXM20497.1|1518206_1518794_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AXM20498.1|1519092_1520049_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM23004.1|1520122_1520854_+	nitrilase	NA	NA	NA	NA	NA
AXM20499.1|1522043_1523447_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AXM20500.1|1523460_1523967_+	transcriptional repressor	NA	NA	NA	NA	NA
AXM20501.1|1524372_1524831_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM20502.1|1525608_1525812_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20503.1|1527373_1527859_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
AXM20504.1|1528086_1528302_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
AXM20505.1|1528552_1529032_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AXM20506.1|1529163_1529592_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20507.1|1529664_1530495_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
>prophage 14
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	1536844	1604348	4948537	transposase	Ralstonia_phage(17.65%)	44	NA	NA
AXM20512.1|1536844_1538785_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
AXM20513.1|1539001_1539556_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
AXM20514.1|1539777_1541208_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
AXM20515.1|1541274_1542729_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	5.7e-47
AXM23006.1|1542956_1543136_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20516.1|1543145_1543871_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
AXM20517.1|1543969_1544380_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXM20518.1|1544431_1545388_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
AXM20519.1|1545631_1548013_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM23007.1|1550710_1551121_+	MerC domain-containing protein	NA	NA	NA	NA	NA
AXM20520.1|1551420_1551603_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
AXM20521.1|1551735_1552776_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AXM20522.1|1552848_1554294_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
AXM20523.1|1555824_1556793_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM20524.1|1557143_1557689_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
AXM20525.1|1557685_1559149_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
AXM20526.1|1560609_1560864_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20527.1|1561266_1561800_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
AXM20528.1|1561825_1562227_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20529.1|1562195_1562576_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20530.1|1562572_1562815_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
AXM20531.1|1564183_1566088_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
AXM20532.1|1566351_1568748_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
AXM20533.1|1568897_1569620_+	pseudouridine synthase	NA	NA	NA	NA	NA
AXM20534.1|1572539_1573040_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
AXM20535.1|1572981_1574658_+	serine hydrolase	NA	NA	NA	NA	NA
AXM20536.1|1574804_1576070_+	cation:proton antiporter	NA	NA	NA	NA	NA
AXM20537.1|1576128_1577322_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
AXM20538.1|1577318_1578008_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
AXM23008.1|1578113_1579583_+	outer membrane channel protein	NA	NA	NA	NA	NA
AXM20539.1|1579602_1580439_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
AXM20540.1|1580464_1581568_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM20541.1|1581564_1584621_+	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AXM20542.1|1584686_1585277_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AXM20543.1|1585408_1587241_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
AXM20544.1|1587316_1588080_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM20545.1|1588122_1589442_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM20546.1|1590739_1595230_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AXM20547.1|1595769_1596738_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXM20548.1|1599027_1599396_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20549.1|1599565_1600534_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM20550.1|1601225_1602182_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	1.1e-41
AXM20551.1|1602060_1602468_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20552.1|1603028_1604348_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 15
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	1641693	1778114	4948537	transposase,tRNA,tail,terminase,plate,holin,capsid,integrase,head,portal	Stenotrophomonas_phage(42.86%)	117	1697380:1697400	1754554:1754574
AXM20581.1|1641693_1642491_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23011.1|1642636_1643092_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20582.1|1643346_1644090_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXM20583.1|1644201_1644705_-	pathogenicity-like protein	NA	NA	NA	NA	NA
AXM20584.1|1644932_1645838_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
AXM20585.1|1645908_1646679_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
AXM20586.1|1646702_1647167_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
AXM20587.1|1647280_1647688_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AXM20588.1|1647684_1650651_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.8	3.3e-307
AXM20589.1|1650943_1651264_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
AXM20590.1|1651276_1651537_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
AXM20591.1|1651769_1652822_+	GTPase ObgE	NA	NA	NA	NA	NA
AXM20592.1|1652913_1653183_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AXM20593.1|1653299_1654904_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
AXM20594.1|1655102_1656119_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AXM20595.1|1656125_1658957_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
AXM20596.1|1659271_1659772_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
AXM20597.1|1659859_1660810_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
AXM20598.1|1661323_1662259_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AXM20599.1|1662258_1664259_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AXM23012.1|1664261_1664888_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AXM20600.1|1664887_1665223_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
AXM23013.1|1665572_1667270_+	M61 family peptidase	NA	NA	NA	NA	NA
AXM20601.1|1667494_1669741_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	4.4e-54
AXM20602.1|1669764_1671384_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20603.1|1671527_1676111_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.7	4.2e-19
AXM20604.1|1676103_1676700_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20605.1|1678435_1679537_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.2e-41
AXM20606.1|1681469_1684025_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	1.3e-30
AXM20607.1|1686994_1688389_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AXM20608.1|1689776_1691333_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20609.1|1693916_1695155_-	MFS transporter	NA	NA	NA	NA	NA
AXM20610.1|1695595_1695889_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AXM20611.1|1696386_1697163_-	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
AXM20612.1|1697320_1699087_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
1697380:1697400	attL	CGCCGGCTGGACCGACGTGGC	NA	NA	NA	NA
AXM20613.1|1699598_1700126_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM23014.1|1700225_1700903_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXM20614.1|1700992_1701721_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM20615.1|1701835_1702360_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
AXM20616.1|1702517_1703102_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AXM20617.1|1703301_1705209_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.1	3.4e-79
AXM20618.1|1705337_1706375_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
AXM20619.1|1706427_1706886_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
AXM20620.1|1706897_1707677_+	protein TolQ	NA	NA	NA	NA	NA
AXM20621.1|1707833_1708283_+	protein TolR	NA	NA	NA	NA	NA
AXM20622.1|1708272_1709313_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AXM20623.1|1709572_1710892_+	protein TolB	NA	NA	NA	NA	NA
AXM20624.1|1710949_1711468_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
AXM20625.1|1711474_1712293_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
AXM20626.1|1712335_1713019_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.5	1.5e-37
AXM20627.1|1713852_1713963_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20628.1|1714252_1714963_-	RNA-binding protein	NA	NA	NA	NA	NA
AXM20629.1|1715197_1715404_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20630.1|1717197_1717776_-	amino acid transporter	NA	NA	NA	NA	NA
AXM20631.1|1720315_1721551_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM20632.1|1721601_1722365_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM20633.1|1722431_1723808_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
AXM20634.1|1724186_1724861_+	7-cyano-7-deazaguanine synthase	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
AXM20635.1|1725105_1726290_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	57.2	2.0e-122
AXM20636.1|1726289_1726550_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	58.3	2.9e-18
AXM20637.1|1726507_1726714_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20638.1|1726710_1726983_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23015.1|1726979_1727225_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20639.1|1727221_1727497_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20640.1|1727658_1728069_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20641.1|1728294_1728573_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23016.1|1728569_1728788_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23017.1|1729096_1731769_-	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
AXM20642.1|1731802_1732015_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20643.1|1732011_1732290_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20644.1|1732300_1732621_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.6	7.4e-24
AXM20645.1|1732623_1732881_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
AXM20646.1|1732952_1733390_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
AXM20647.1|1734050_1735037_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
AXM20648.1|1735033_1735435_-	oxidoreductase	NA	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
AXM20649.1|1735447_1738318_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	49.2	6.4e-207
AXM20650.1|1738350_1738464_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
AXM20651.1|1738472_1738775_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
AXM20652.1|1738820_1739330_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
AXM20653.1|1739360_1740527_-|tail	phage tail protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
AXM20654.1|1740538_1740898_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	65.3	1.2e-35
AXM20655.1|1740894_1741458_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	44.3	8.2e-26
AXM20656.1|1741518_1742097_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXM20657.1|1742104_1743610_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	48.2	6.6e-54
AXM20658.1|1743619_1744165_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	2.1e-50
AXM20659.1|1744157_1745048_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.0	6.8e-83
AXM20660.1|1745178_1746348_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20661.1|1746839_1747286_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	56.1	1.8e-36
AXM20662.1|1747273_1747693_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	63.0	1.4e-38
AXM20663.1|1747689_1748178_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	50.7	1.2e-25
AXM20664.1|1748177_1748819_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.9e-49
AXM20665.1|1748815_1749091_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	58.6	1.1e-20
AXM20666.1|1749083_1749440_-	hypothetical protein	NA	V9IQG9	Stenotrophomonas_phage	55.3	1.7e-21
AXM20667.1|1749444_1749654_-|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	58.0	3.5e-14
AXM20668.1|1749653_1750121_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.0	2.0e-30
AXM20669.1|1750220_1750940_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	62.9	3.4e-69
AXM20670.1|1750943_1751960_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.5	4.2e-137
AXM20671.1|1752006_1752849_-|capsid	phage capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.9	2.0e-68
AXM20672.1|1752970_1754755_+|terminase	terminase	terminase	V9IQL5	Stenotrophomonas_phage	75.6	4.7e-269
1754554:1754574	attR	CGCCGGCTGGACCGACGTGGC	NA	NA	NA	NA
AXM20673.1|1754754_1755777_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.5	2.6e-139
AXM20674.1|1755802_1756048_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	50.0	7.7e-13
AXM20675.1|1755965_1756667_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	76.2	3.2e-104
AXM20676.1|1756733_1757480_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20677.1|1757476_1758184_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20678.1|1758197_1758539_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20679.1|1758519_1759077_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	5.3e-09
AXM20680.1|1759025_1759427_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AXM20681.1|1760565_1761852_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	42.2	1.4e-81
AXM20682.1|1762079_1762415_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20683.1|1763121_1763526_-	response regulator	NA	NA	NA	NA	NA
AXM20684.1|1763604_1764102_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20685.1|1764240_1766037_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.5	1.5e-81
AXM20686.1|1766593_1767139_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
AXM20687.1|1767240_1771362_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	1.9e-47
AXM20688.1|1771582_1774225_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM20689.1|1775666_1777181_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
AXM20690.1|1777351_1778114_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 16
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	1990601	2062836	4948537	transposase,tRNA,coat,protease	Emiliania_huxleyi_virus(20.0%)	59	NA	NA
AXM20836.1|1990601_1991364_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM20837.1|1991755_1994320_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
AXM20838.1|1995300_1995648_+	RidA family protein	NA	NA	NA	NA	NA
AXM20839.1|1995809_1996880_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM20840.1|1996897_1997680_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
AXM20841.1|1997676_1998222_-	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
AXM20842.1|1998218_1999514_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	3.9e-39
AXM20843.1|1999510_2000470_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
AXM20844.1|2000394_2001645_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXM23030.1|2001641_2002640_-	acyl-CoA desaturase	NA	G4YAW5	Emiliania_huxleyi_virus	30.6	2.3e-18
AXM20845.1|2002865_2003711_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20846.1|2003695_2004259_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXM20847.1|2004317_2004686_-	DUF4345 domain-containing protein	NA	NA	NA	NA	NA
AXM20848.1|2004771_2005554_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20849.1|2005777_2005960_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20850.1|2006172_2006601_-	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
AXM20851.1|2006602_2007199_-	HAD family hydrolase	NA	NA	NA	NA	NA
AXM20852.1|2007406_2009491_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
AXM20853.1|2009715_2010165_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
AXM20854.1|2010928_2011987_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM20855.1|2012257_2013655_+	S-methylmethionine permease	NA	NA	NA	NA	NA
AXM20856.1|2013651_2014629_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AXM20857.1|2014810_2016748_-	DUF885 family protein	NA	NA	NA	NA	NA
AXM20858.1|2017168_2017945_-	VUT family protein	NA	R4TNY5	Halovirus	27.2	1.9e-09
AXM23031.1|2017949_2018624_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
AXM23032.1|2020254_2021631_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
AXM20859.1|2021670_2022066_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
AXM20860.1|2022108_2023584_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
AXM23033.1|2024812_2024983_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
AXM20861.1|2028671_2029235_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23034.1|2029707_2031024_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
AXM20862.1|2031191_2031794_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM23035.1|2031867_2032314_+	CopD family protein	NA	NA	NA	NA	NA
AXM20863.1|2032391_2032658_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20864.1|2032647_2032863_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20865.1|2033479_2034823_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
AXM20866.1|2034759_2036172_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
AXM20867.1|2036168_2036906_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
AXM20868.1|2036905_2039086_-	ligand-gated channel	NA	NA	NA	NA	NA
AXM20869.1|2039925_2040885_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
AXM20870.1|2041060_2044651_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
AXM20871.1|2045108_2045849_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
AXM23036.1|2045845_2047102_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AXM20872.1|2047140_2047932_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AXM20873.1|2047955_2048417_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AXM20874.1|2048413_2049427_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AXM20875.1|2049826_2052280_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AXM20876.1|2052276_2053623_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AXM20877.1|2053649_2054840_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AXM20878.1|2054842_2055670_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AXM20879.1|2055666_2056428_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
AXM20880.1|2056445_2057003_-	ribosome recycling factor	NA	NA	NA	NA	NA
AXM20881.1|2057183_2057906_-	UMP kinase	NA	NA	NA	NA	NA
AXM20882.1|2057962_2058340_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
AXM20883.1|2058467_2059346_-	elongation factor Ts	NA	NA	NA	NA	NA
AXM20884.1|2059515_2060319_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AXM20885.1|2060694_2061420_-	molecular chaperone	NA	NA	NA	NA	NA
AXM20886.1|2061422_2061755_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20887.1|2061801_2062836_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 17
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	2117665	2244445	4948537	transposase,tRNA	Ralstonia_phage(17.39%)	93	NA	NA
AXM20925.1|2117665_2118985_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM20926.1|2119319_2120246_-	multidrug transporter	NA	NA	NA	NA	NA
AXM20927.1|2120375_2120981_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM20928.1|2121319_2123089_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
AXM23040.1|2123085_2123679_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
AXM20929.1|2123946_2124540_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
AXM20930.1|2124738_2126175_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
AXM20931.1|2126416_2127619_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AXM20932.1|2127661_2130490_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
AXM20933.1|2130670_2131603_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM20934.1|2131599_2133099_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM23041.1|2133436_2133700_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
AXM20935.1|2133979_2134480_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
AXM20936.1|2134721_2136089_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
AXM20937.1|2139112_2139875_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23042.1|2141327_2142731_+	class II fumarate hydratase	NA	NA	NA	NA	NA
AXM20938.1|2142853_2143276_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20939.1|2143908_2144745_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20940.1|2144754_2145741_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM20941.1|2145737_2146613_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
AXM20942.1|2146609_2146972_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXM20943.1|2146974_2147223_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20944.1|2147358_2147916_+	glutathione peroxidase	NA	NA	NA	NA	NA
AXM20945.1|2148007_2148973_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXM20946.1|2148998_2150348_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
AXM20947.1|2150340_2150577_+	protein SlyX	NA	NA	NA	NA	NA
AXM20948.1|2150577_2151330_+	DUF2058 family protein	NA	NA	NA	NA	NA
AXM20949.1|2151663_2152509_+	transporter	NA	NA	NA	NA	NA
AXM23043.1|2152649_2153825_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM20950.1|2153838_2155149_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AXM20951.1|2155073_2156132_+	carbohydrate kinase	NA	NA	NA	NA	NA
AXM20952.1|2156128_2157334_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
AXM20953.1|2157720_2160474_-	methionine synthase	NA	NA	NA	NA	NA
AXM20954.1|2160616_2161756_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
AXM20955.1|2161752_2162748_-	methyltransferase domain-containing protein	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
AXM23044.1|2162869_2164018_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXM20956.1|2164017_2164158_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXM23045.1|2164351_2164576_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20957.1|2164529_2165975_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
AXM20958.1|2166541_2169070_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
AXM20959.1|2169280_2170079_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM20960.1|2171149_2171917_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AXM20961.1|2171918_2172266_+	hypothetical protein	NA	NA	NA	NA	NA
AXM20962.1|2172424_2173393_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM23046.1|2174745_2175711_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM23047.1|2176155_2177340_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXM20963.1|2177394_2178870_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
AXM20964.1|2179191_2179374_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
AXM20965.1|2179522_2180722_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AXM20966.1|2181582_2182551_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXM20967.1|2182830_2183629_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23048.1|2183854_2184820_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM20968.1|2187049_2188015_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM20969.1|2189046_2190015_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM20970.1|2191191_2192294_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
AXM23049.1|2192480_2192948_-	energy transducer TonB	NA	NA	NA	NA	NA
AXM20971.1|2193308_2194073_-	energy transducer TonB	NA	NA	NA	NA	NA
AXM20972.1|2194079_2195429_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
AXM20973.1|2195578_2196377_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM20974.1|2196816_2198136_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM20975.1|2198348_2199317_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXM20976.1|2199380_2199965_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AXM20977.1|2200064_2201078_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM23050.1|2202278_2202374_-	hypothetical protein	NA	NA	NA	NA	NA
AXM20978.1|2202447_2206047_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AXM20979.1|2206186_2206486_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
AXM20980.1|2206489_2206684_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
AXM20981.1|2206952_2210759_-	avirulence protein	NA	NA	NA	NA	NA
AXM20982.1|2213942_2218070_-	avirulence protein	NA	NA	NA	NA	NA
AXM20983.1|2218358_2219678_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM20984.1|2221509_2222595_-	peptidase C13	NA	NA	NA	NA	NA
AXM20985.1|2222922_2223621_-	acireductone synthase	NA	NA	NA	NA	NA
AXM20986.1|2223623_2224190_-	acireductone dioxygenase	NA	NA	NA	NA	NA
AXM20987.1|2224201_2224879_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
AXM20988.1|2224967_2226398_-	amino acid permease	NA	NA	NA	NA	NA
AXM20989.1|2226474_2227956_-	amino acid permease	NA	NA	NA	NA	NA
AXM20990.1|2228092_2228680_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AXM20991.1|2228821_2230063_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
AXM20992.1|2230271_2231690_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXM20993.1|2231724_2232024_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
AXM20994.1|2232020_2233892_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
AXM20995.1|2234181_2235201_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AXM23051.1|2235194_2235605_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
AXM20996.1|2235622_2236225_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AXM23052.1|2236217_2238155_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
AXM20997.1|2238323_2238794_-	cytochrome c biogenesis protein CcmE	NA	NA	NA	NA	NA
AXM20998.1|2238790_2238961_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
AXM20999.1|2238957_2239710_-	heme ABC transporter permease	NA	NA	NA	NA	NA
AXM21000.1|2239804_2240500_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
AXM21001.1|2240496_2241141_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
AXM21002.1|2241367_2242516_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AXM21003.1|2242655_2243459_+	amidohydrolase	NA	NA	NA	NA	NA
AXM23053.1|2243479_2244445_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 18
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	2342406	2474752	4948537	transposase,tRNA,protease	Xanthomonas_phage(60.98%)	117	NA	NA
AXM21073.1|2342406_2343819_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.4	1.0e-40
AXM21074.1|2344324_2345123_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM21075.1|2345436_2345763_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM21076.1|2345772_2346687_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
AXM21077.1|2346683_2347979_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
AXM21078.1|2347975_2349067_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AXM21079.1|2349063_2350191_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase	NA	NA	NA	NA	NA
AXM21080.1|2350187_2350790_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AXM21081.1|2350786_2351521_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AXM21082.1|2351514_2352291_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
AXM21083.1|2352280_2352901_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
AXM21084.1|2353486_2357341_-	avirulence protein	NA	NA	NA	NA	NA
AXM21085.1|2357565_2357865_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
AXM21086.1|2357868_2358063_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
AXM21087.1|2358330_2361630_-	avirulence protein	NA	NA	NA	NA	NA
AXM21088.1|2362171_2362951_-	pectate lyase	NA	NA	NA	NA	NA
AXM21089.1|2362989_2363091_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21090.1|2363844_2364030_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
AXM21091.1|2364029_2364233_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
AXM21092.1|2364368_2365442_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
AXM21093.1|2365546_2365846_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
AXM21094.1|2366209_2366449_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23062.1|2366555_2368040_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
AXM21095.1|2368041_2368362_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
AXM21096.1|2368358_2369543_+	zonular occludens toxin family protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	5.2e-54
AXM21097.1|2369597_2369768_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	2.5e-10
AXM21098.1|2369867_2370233_+	DUF4124 domain-containing protein	NA	A0A077JCA3	Xanthomonas_phage	69.6	6.0e-38
AXM21099.1|2370172_2370487_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.7	8.1e-15
AXM21100.1|2370876_2371137_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21101.1|2371336_2371720_+	hypothetical protein	NA	A0A1D6ZIV0	Xanthomonas_phage	100.0	1.7e-70
AXM21102.1|2371891_2372539_-	conjugal transfer protein	NA	A0A1D6ZIU7	Xanthomonas_phage	100.0	3.0e-120
AXM21103.1|2372540_2373728_-	hypothetical protein	NA	A0A1D6ZIU8	Xanthomonas_phage	100.0	2.8e-217
AXM21104.1|2373727_2374057_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
AXM21105.1|2374056_2375463_-	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	100.0	6.4e-245
AXM21106.1|2375599_2375830_-	methyltransferase	NA	A0A1D6ZIT7	Xanthomonas_phage	100.0	1.7e-30
AXM21107.1|2375841_2376045_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
AXM21108.1|2376048_2376345_-	DNA-binding protein	NA	A0A1D6ZIU6	Xanthomonas_phage	100.0	3.6e-49
AXM23063.1|2376341_2377382_-	replication initiation protein	NA	A0A1D6ZIT9	Xanthomonas_phage	100.0	8.2e-205
AXM21109.1|2377534_2377747_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	100.0	1.6e-27
AXM21110.1|2377746_2377932_-	hypothetical protein	NA	A0A1D6ZIV1	Xanthomonas_phage	100.0	1.4e-27
AXM21111.1|2378059_2378689_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	80.6	2.5e-71
AXM21112.1|2378813_2378996_-	antitoxin	NA	NA	NA	NA	NA
AXM21113.1|2379117_2379327_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21114.1|2379498_2380261_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM21115.1|2380663_2381089_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21116.1|2381485_2381728_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21117.1|2381702_2382215_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21118.1|2382347_2383110_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM21119.1|2384331_2388129_+	avirulence protein	NA	NA	NA	NA	NA
AXM21120.1|2388397_2388592_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
AXM21121.1|2388595_2388895_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
AXM21122.1|2389118_2392874_+	avirulence protein	NA	NA	NA	NA	NA
AXM21123.1|2392963_2393726_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM21124.1|2393957_2394152_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
AXM21125.1|2394155_2394455_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
AXM21126.1|2394679_2398696_+	avirulence protein	NA	NA	NA	NA	NA
AXM21127.1|2398869_2399091_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AXM21128.1|2399087_2399759_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
AXM21129.1|2401013_2401970_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM21130.1|2402384_2403353_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM21131.1|2403497_2404463_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM23064.1|2408848_2410033_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXM21132.1|2410083_2410983_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
AXM21133.1|2411149_2411656_+	glyoxalase	NA	NA	NA	NA	NA
AXM21134.1|2412130_2412763_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AXM21135.1|2412762_2414619_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
AXM21136.1|2414615_2416115_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21137.1|2416057_2416522_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AXM23065.1|2416518_2417319_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AXM21138.1|2417588_2418629_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AXM21139.1|2418625_2420395_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
AXM21140.1|2420391_2420856_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXM21141.1|2420859_2421522_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
AXM21142.1|2421550_2423959_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
AXM21143.1|2424212_2425178_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM21144.1|2426388_2426571_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21145.1|2426571_2427306_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
AXM21146.1|2427298_2428540_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
AXM21147.1|2428563_2429016_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21148.1|2428966_2429215_-	succinate dehydrogenase assembly factor 2 family protein	NA	NA	NA	NA	NA
AXM21149.1|2429325_2430108_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AXM21150.1|2430124_2430334_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21151.1|2430337_2432128_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AXM21152.1|2432162_2432549_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
AXM21153.1|2432545_2432941_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
AXM21154.1|2433000_2433267_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
AXM21155.1|2433210_2434083_+	folate-binding protein	NA	NA	NA	NA	NA
AXM21156.1|2434211_2435309_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
AXM21157.1|2435742_2437173_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
AXM21158.1|2437169_2438177_+	glucokinase	NA	NA	NA	NA	NA
AXM21159.1|2438173_2438893_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AXM21160.1|2438995_2440912_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AXM21161.1|2440967_2441627_+	keto-hydroxyglutarate-aldolase/keto-deoxy- phosphogluconate aldolase	NA	NA	NA	NA	NA
AXM21162.1|2443253_2443457_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21163.1|2444472_2444853_+	response regulator	NA	NA	NA	NA	NA
AXM21164.1|2445067_2448463_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
AXM21165.1|2450028_2450791_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM21166.1|2452686_2452920_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21167.1|2453086_2454061_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
AXM23066.1|2454824_2455034_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21168.1|2455628_2455838_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21169.1|2457406_2458540_+	phospholipase	NA	NA	NA	NA	NA
AXM21170.1|2458968_2459421_-	glutathione S-transferase	NA	NA	NA	NA	NA
AXM21171.1|2459739_2461257_-	fumarate hydratase	NA	NA	NA	NA	NA
AXM21172.1|2461590_2463471_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
AXM21173.1|2463659_2464439_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
AXM21174.1|2464589_2465075_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
AXM21175.1|2465052_2465301_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21176.1|2467531_2467771_-	HTH domain-containing protein	NA	NA	NA	NA	NA
AXM21177.1|2468022_2468736_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21178.1|2470260_2470761_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXM23067.1|2470922_2471501_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21179.1|2471592_2472093_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXM21180.1|2472159_2472993_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23068.1|2473043_2473358_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXM21181.1|2473541_2473730_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21182.1|2474143_2474752_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 19
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	2564865	2612961	4948537	transposase,tRNA	Moumouvirus(16.67%)	44	NA	NA
AXM21231.1|2564865_2566260_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
AXM21232.1|2566261_2566519_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21233.1|2566515_2566821_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21234.1|2566817_2567144_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21235.1|2567870_2568533_+	carbonate dehydratase	NA	NA	NA	NA	NA
AXM23078.1|2568621_2569152_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
AXM21236.1|2571375_2572647_+	kynureninase	NA	NA	NA	NA	NA
AXM21237.1|2572818_2574186_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
AXM21238.1|2574489_2575935_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AXM21239.1|2575931_2576618_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
AXM21240.1|2576590_2577610_+	aldo/keto reductase	NA	NA	NA	NA	NA
AXM21241.1|2577651_2578212_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
AXM21242.1|2578232_2579189_-	5'-nucleotidase	NA	NA	NA	NA	NA
AXM23079.1|2579356_2580133_-	NAD(+) kinase	NA	NA	NA	NA	NA
AXM21243.1|2580616_2582752_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AXM21244.1|2582748_2582940_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21245.1|2584714_2585221_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXM21246.1|2585261_2585789_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXM21247.1|2585785_2586277_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AXM21248.1|2586300_2586876_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AXM21249.1|2586952_2587906_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
AXM21250.1|2587994_2588867_-	sulfurtransferase	NA	NA	NA	NA	NA
AXM23080.1|2588863_2589631_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
AXM21251.1|2589821_2590520_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXM21252.1|2590683_2591466_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AXM21253.1|2591474_2591855_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21254.1|2591851_2592562_+	endonuclease III	NA	NA	NA	NA	NA
AXM21255.1|2593872_2594421_-	carbonic anhydrase	NA	NA	NA	NA	NA
AXM21256.1|2594592_2595561_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM21257.1|2596165_2597401_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM21258.1|2597964_2598285_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21259.1|2598624_2599875_+	porin	NA	NA	NA	NA	NA
AXM23081.1|2600009_2601083_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.4	5.0e-48
AXM21260.1|2601270_2602362_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
AXM21261.1|2602474_2603449_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AXM21262.1|2603448_2604318_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
AXM21263.1|2604340_2605171_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
AXM21264.1|2605299_2606010_+	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AXM21265.1|2606142_2606550_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21266.1|2606827_2607469_+	ribonuclease T	NA	NA	NA	NA	NA
AXM21267.1|2607539_2608859_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM21268.1|2609095_2610157_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23082.1|2610207_2611392_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXM21269.1|2611641_2612961_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 20
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	2619680	2691952	4948537	transposase,tRNA,protease	uncultured_Mediterranean_phage(33.33%)	53	NA	NA
AXM21274.1|2619680_2620826_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
AXM23083.1|2620895_2621966_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AXM21275.1|2622159_2622591_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AXM21276.1|2622714_2624211_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AXM21277.1|2624170_2624485_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21278.1|2624555_2625263_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21279.1|2628588_2629710_-	phytase	NA	NA	NA	NA	NA
AXM23084.1|2632588_2633221_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AXM21280.1|2633617_2634380_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM21281.1|2634660_2635692_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM21282.1|2635698_2637492_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AXM21283.1|2637488_2637773_-	4Fe-4S dicluster domain-containing protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
AXM23085.1|2637763_2637946_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23086.1|2638004_2638490_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21284.1|2638548_2639055_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
AXM21285.1|2639051_2639672_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AXM21286.1|2639912_2641817_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
AXM21287.1|2641904_2642962_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM21288.1|2643059_2644379_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM21289.1|2644612_2645770_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
AXM23087.1|2646046_2647012_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM21290.1|2646989_2648465_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
AXM21291.1|2650281_2651250_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM21292.1|2652164_2653133_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM21293.1|2653400_2653640_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21294.1|2655514_2656735_-	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AXM21295.1|2657049_2658447_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AXM21296.1|2658457_2659678_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AXM21297.1|2659674_2660313_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21298.1|2660383_2661244_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXM21299.1|2661240_2662029_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
AXM21300.1|2662039_2663245_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
AXM21301.1|2663263_2663689_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
AXM21302.1|2663908_2664541_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM21303.1|2664565_2666938_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
AXM21304.1|2667095_2668301_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
AXM21305.1|2668621_2669953_+	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
AXM21306.1|2669949_2670300_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21307.1|2670331_2670739_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
AXM21308.1|2670735_2671062_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23088.1|2671093_2672470_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
AXM21309.1|2672706_2676873_+	type III effector	NA	NA	NA	NA	NA
AXM23089.1|2676985_2677615_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
AXM21310.1|2677721_2679650_-	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
AXM21311.1|2679812_2682173_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
AXM21312.1|2682456_2683425_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
AXM21313.1|2683482_2684604_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXM23090.1|2686031_2686784_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXM23091.1|2686864_2687083_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXM21314.1|2687363_2689646_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.5	4.3e-174
AXM21315.1|2689789_2690110_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
AXM21316.1|2690360_2690819_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AXM21317.1|2690815_2691952_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 21
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	2773683	2803485	4948537	transposase	Ralstonia_phage(75.0%)	15	NA	NA
AXM21385.1|2773683_2775003_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM21386.1|2775152_2776121_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXM21387.1|2776215_2776746_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AXM21388.1|2776784_2782025_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.8	1.6e-09
AXM21389.1|2784245_2785214_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM21390.1|2786632_2787601_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXM21391.1|2789366_2789558_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21392.1|2797829_2798222_+	cytochrome c	NA	NA	NA	NA	NA
AXM21393.1|2798230_2798692_+	cytochrome c	NA	NA	NA	NA	NA
AXM21394.1|2799196_2799457_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21395.1|2799532_2799775_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21396.1|2800017_2800203_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21397.1|2800245_2800452_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23095.1|2801214_2802180_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM21398.1|2802186_2803485_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 22
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	2807671	2844252	4948537	transposase,tRNA	Streptococcus_phage(28.57%)	32	NA	NA
AXM21401.1|2807671_2808628_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	4.0e-41
AXM21402.1|2809430_2809694_+	cytochrome D ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AXM23097.1|2809835_2810801_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM21403.1|2811138_2811249_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
AXM21404.1|2811469_2812735_+	MFS transporter	NA	NA	NA	NA	NA
AXM21405.1|2812715_2814629_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
AXM21406.1|2814996_2816241_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
AXM21407.1|2816405_2817560_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
AXM21408.1|2817573_2817834_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21409.1|2817833_2818202_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM21410.1|2818198_2819494_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AXM21411.1|2819617_2820568_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AXM21412.1|2821180_2822524_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AXM21413.1|2822563_2823664_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
AXM21414.1|2823669_2824122_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXM21415.1|2824363_2825605_-	argininosuccinate synthase	NA	NA	NA	NA	NA
AXM21416.1|2825676_2826702_-	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
AXM21417.1|2827014_2827509_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21418.1|2827679_2829110_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
AXM21419.1|2829607_2830045_+	SufE family protein	NA	NA	NA	NA	NA
AXM21420.1|2830041_2831292_+	MFS transporter	NA	NA	NA	NA	NA
AXM21421.1|2831359_2832421_-	peptidase S41	NA	NA	NA	NA	NA
AXM21422.1|2832563_2833604_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AXM21423.1|2833694_2833976_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
AXM21424.1|2833972_2835322_+	dihydroorotase	NA	NA	NA	NA	NA
AXM21425.1|2835261_2836161_+	M23 family peptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.6e-13
AXM21426.1|2837059_2837822_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM21427.1|2837848_2838112_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23098.1|2838833_2839868_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM21428.1|2840311_2841631_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM21429.1|2841767_2842736_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM21430.1|2842935_2844252_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 23
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	2876083	2936349	4948537	transposase,tRNA,protease	Bacillus_virus(22.22%)	51	NA	NA
AXM21457.1|2876083_2876962_-|protease	protease HtpX	protease	NA	NA	NA	NA
AXM21458.1|2877059_2877959_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AXM21459.1|2878046_2878787_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AXM23101.1|2878946_2879522_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
AXM21460.1|2879695_2880667_-	TraB/GumN family protein	NA	NA	NA	NA	NA
AXM21461.1|2880700_2881642_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
AXM21462.1|2881641_2883519_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
AXM21463.1|2883656_2885390_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
AXM21464.1|2885442_2885943_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AXM21465.1|2885939_2887427_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AXM21466.1|2887451_2888519_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AXM21467.1|2888664_2890002_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
AXM21468.1|2890297_2891560_-	virulence factor	NA	NA	NA	NA	NA
AXM21469.1|2891776_2892524_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM21470.1|2892840_2894676_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
AXM21471.1|2894947_2896039_+	ribonuclease D	NA	NA	NA	NA	NA
AXM21472.1|2896135_2896504_-	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
AXM21473.1|2896367_2896718_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21474.1|2897131_2897533_+	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AXM21475.1|2898039_2898174_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23102.1|2898396_2898576_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21476.1|2899177_2899468_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXM21477.1|2899455_2899734_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AXM23103.1|2900218_2900407_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AXM23104.1|2901179_2902364_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
AXM23105.1|2902944_2903910_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM21478.1|2908402_2908819_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
AXM21479.1|2909029_2909356_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21480.1|2909388_2909829_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
AXM21481.1|2909907_2910543_-	stringent starvation protein A	NA	NA	NA	NA	NA
AXM21482.1|2910935_2911679_-	cytochrome c1	NA	NA	NA	NA	NA
AXM21483.1|2911686_2912946_-	cytochrome b	NA	NA	NA	NA	NA
AXM21484.1|2912945_2913590_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AXM21485.1|2914119_2915106_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
AXM21486.1|2917033_2918488_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AXM21487.1|2918911_2919898_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
AXM21488.1|2920309_2920972_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21489.1|2921026_2921512_+	endoribonuclease YbeY	NA	NA	NA	NA	NA
AXM21490.1|2921511_2922030_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21491.1|2922124_2923003_+	CBS domain-containing protein	NA	NA	NA	NA	NA
AXM21492.1|2922999_2924280_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
AXM21493.1|2924295_2925297_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
AXM23106.1|2925448_2926813_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXM23107.1|2927067_2927478_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21494.1|2927633_2928464_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AXM21495.1|2928479_2928842_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
AXM21496.1|2928777_2930025_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
AXM21497.1|2930170_2931682_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21498.1|2931668_2933255_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AXM21499.1|2933251_2934454_-	HlyD family secretion protein	NA	NA	NA	NA	NA
AXM21500.1|2934897_2936349_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 24
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	2950392	3021814	4948537	transposase	Ralstonia_phage(50.0%)	43	NA	NA
AXM21511.1|2950392_2951155_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM21512.1|2951380_2952733_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AXM23108.1|2952793_2955931_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21513.1|2956097_2956952_+	plasmid replication/partition related protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
AXM21514.1|2957122_2958427_+	DUF445 family protein	NA	NA	NA	NA	NA
AXM21515.1|2958568_2962663_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.1e-55
AXM21516.1|2962696_2963683_+	two-component system response regulator	NA	W8CYM9	Bacillus_phage	26.8	2.8e-05
AXM21517.1|2963807_2964791_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.4e-97
AXM21518.1|2964732_2964972_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21519.1|2965239_2970264_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
AXM21520.1|2970541_2971201_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM21521.1|2971215_2972520_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM21522.1|2972532_2975703_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AXM21523.1|2976678_2977635_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM21524.1|2979495_2982012_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
AXM21525.1|2982008_2982965_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
AXM21526.1|2983123_2984866_+	PTS fructose transporter subunit EIIBC	NA	NA	NA	NA	NA
AXM23109.1|2985184_2986321_+	carbohydrate porin	NA	NA	NA	NA	NA
AXM21527.1|2986879_2987848_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM21528.1|2988147_2989116_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM21529.1|2989410_2991756_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23110.1|2991773_2992505_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21530.1|2992536_2994879_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21531.1|2994903_2995632_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21532.1|2995660_2998003_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23111.1|2998027_2998771_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21533.1|2998801_3001144_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21534.1|3001168_3001906_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21535.1|3001931_3004766_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21536.1|3004762_3005692_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM21537.1|3005700_3008463_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.5	6.6e-44
AXM21538.1|3010028_3012620_-	avirulence protein	NA	NA	NA	NA	NA
AXM21539.1|3012788_3013757_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXM21540.1|3013819_3014209_-	type VI secretion protein	NA	NA	NA	NA	NA
AXM21541.1|3014363_3015323_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM21542.1|3015255_3015570_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
AXM21543.1|3015797_3017117_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM21544.1|3018221_3018638_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
AXM21545.1|3018634_3018943_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23112.1|3018884_3019262_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21546.1|3019323_3019959_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21547.1|3020057_3020735_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
AXM21548.1|3020845_3021814_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
>prophage 25
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	3145471	3157246	4948537	tRNA	Escherichia_phage(22.22%)	14	NA	NA
AXM21634.1|3145471_3145771_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
AXM21635.1|3145813_3146044_-	hypothetical protein	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
AXM21636.1|3146287_3147037_-	isopentenyl transferase	NA	NA	NA	NA	NA
AXM21637.1|3147041_3147737_-	DNA helicase	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
AXM21638.1|3147672_3147900_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23123.1|3147922_3148222_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23124.1|3148609_3149014_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
AXM21639.1|3149739_3149952_-	carbon storage regulator	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
AXM21640.1|3150091_3152740_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
AXM21641.1|3152841_3153330_-	recombination regulator RecX	NA	NA	NA	NA	NA
AXM21642.1|3153380_3153584_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21643.1|3153632_3154667_-	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
AXM21644.1|3154839_3155481_-	LexA repressor 2	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
AXM23125.1|3155569_3157246_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 26
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	3197548	3276431	4948537	plate,transposase,protease	Xanthomonas_phage(44.44%)	56	NA	NA
AXM21677.1|3197548_3198505_+|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM21678.1|3198603_3199716_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AXM21679.1|3199712_3200843_-	glycosyltransferase	NA	NA	NA	NA	NA
AXM21680.1|3200964_3201663_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM23133.1|3201659_3202895_-	amidohydrolase	NA	NA	NA	NA	NA
AXM21681.1|3202907_3203750_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM21682.1|3204030_3204882_-	chain-length determining protein	NA	NA	NA	NA	NA
AXM23134.1|3204927_3206061_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21683.1|3206057_3207008_-	glycosyltransferase	NA	NA	NA	NA	NA
AXM21684.1|3207004_3208258_-	O-antigen translocase	NA	NA	NA	NA	NA
AXM21685.1|3208254_3209367_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	28.4	1.4e-29
AXM21686.1|3209366_3210299_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM21687.1|3210285_3211239_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21688.1|3211242_3211914_-	sugar O-acyltransferase	NA	NA	NA	NA	NA
AXM21689.1|3211910_3212342_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
AXM23135.1|3212736_3213267_+	cytochrome b	NA	NA	NA	NA	NA
AXM21690.1|3213350_3214691_+	cytochrome C	NA	NA	NA	NA	NA
AXM21691.1|3214716_3215109_+	cytochrome c family protein	NA	NA	NA	NA	NA
AXM23136.1|3215551_3216340_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23137.1|3216403_3216985_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXM21692.1|3216876_3217638_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
AXM21693.1|3217634_3218960_+|protease	serine protease	protease	A0A217EQY2	Bacillus_phage	39.2	2.4e-23
AXM21694.1|3218970_3219729_+	heme ABC transporter permease	NA	NA	NA	NA	NA
AXM21695.1|3219725_3219932_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
AXM21696.1|3219928_3220399_+	cytochrome c-type biogenesis protein CcmE 1	NA	NA	NA	NA	NA
AXM21697.1|3220462_3222451_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
AXM21698.1|3222447_3222990_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AXM23138.1|3222989_3223487_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
AXM21699.1|3223486_3224191_+	C-type cytochrome biogenesis protein	NA	NA	NA	NA	NA
AXM21700.1|3224315_3228119_+	avirulence protein	NA	NA	NA	NA	NA
AXM21701.1|3228387_3228582_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
AXM21702.1|3228585_3228885_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
AXM21703.1|3229108_3233560_+	avirulence protein	NA	NA	NA	NA	NA
AXM21704.1|3233828_3234023_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
AXM21705.1|3234026_3234326_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	90.2	3.2e-45
AXM21706.1|3234549_3238890_+	avirulence protein	NA	NA	NA	NA	NA
AXM21707.1|3239952_3241428_-|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	5.4e-101
AXM21708.1|3241510_3244099_-	hydrophobe/amphiphile efflux-1 family RND transporter	NA	NA	NA	NA	NA
AXM21709.1|3244155_3245268_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM21710.1|3245392_3245971_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM21711.1|3247457_3249545_+	type III effector	NA	NA	NA	NA	NA
AXM21712.1|3251443_3254524_+	histidine kinase	NA	NA	NA	NA	NA
AXM23139.1|3257559_3258267_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXM21713.1|3258263_3259256_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AXM21714.1|3259252_3261712_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
AXM21715.1|3261825_3262806_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM21716.1|3262814_3263843_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AXM21717.1|3264009_3264807_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM21718.1|3264869_3265667_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM21719.1|3265727_3266054_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21720.1|3266050_3268954_-	serine/threonine protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
AXM21721.1|3268950_3269673_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
AXM21722.1|3269669_3270317_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
AXM21723.1|3270313_3273772_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AXM21724.1|3273775_3275092_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
AXM21725.1|3275093_3276431_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 27
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	3285393	3356053	4948537	transposase,plate	Ralstonia_phage(71.43%)	52	NA	NA
AXM21732.1|3285393_3286404_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXM21733.1|3286367_3288245_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXM21734.1|3288248_3288752_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXM21735.1|3288739_3289573_-	ImpE protein	NA	NA	NA	NA	NA
AXM21736.1|3289608_3290112_-	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
AXM21737.1|3290211_3291726_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AXM23140.1|3291718_3292225_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AXM21738.1|3293583_3294552_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM21739.1|3294687_3296004_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM21740.1|3296174_3297410_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXM21741.1|3297595_3298564_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM21742.1|3298615_3300532_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21743.1|3300556_3301294_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21744.1|3301324_3303667_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23141.1|3303684_3304431_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21745.1|3304459_3307294_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21746.1|3307951_3309781_-	transmembrane repetitive protein	NA	NA	NA	NA	NA
AXM21747.1|3309794_3310394_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
AXM21748.1|3310482_3310839_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AXM21749.1|3310835_3311258_+	energy transducer TonB	NA	NA	NA	NA	NA
AXM21750.1|3311273_3311507_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AXM21751.1|3311533_3311794_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AXM21752.1|3312142_3313933_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AXM21753.1|3313965_3314952_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AXM21754.1|3315362_3319076_+	ribonuclease E/G	NA	NA	NA	NA	NA
AXM21755.1|3319601_3320365_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM21756.1|3320468_3321116_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXM21757.1|3321337_3322099_-	sulfurtransferase	NA	NA	NA	NA	NA
AXM21758.1|3322256_3323225_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM21759.1|3323358_3323724_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21760.1|3323782_3324214_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXM21761.1|3324225_3325488_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
AXM21762.1|3325471_3326764_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
AXM21763.1|3327133_3327904_+	phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AXM21764.1|3328660_3329896_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXM23142.1|3331195_3331453_-	stress-induced protein	NA	NA	NA	NA	NA
AXM21765.1|3331892_3332876_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
AXM21766.1|3333191_3334160_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM21767.1|3334288_3335251_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM21768.1|3335690_3335870_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23143.1|3336234_3337200_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM21769.1|3338407_3339385_+	siroheme synthase	NA	NA	NA	NA	NA
AXM21770.1|3340193_3340388_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AXM21771.1|3341781_3342144_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21772.1|3342127_3342697_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
AXM21773.1|3342734_3343988_-	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AXM21774.1|3344193_3344571_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23144.1|3346244_3346451_-|transposase	transposase	transposase	NA	NA	NA	NA
AXM21775.1|3346499_3347735_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM21776.1|3348572_3349607_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM21777.1|3350282_3352658_-	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
AXM23145.1|3354868_3356053_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.7e-41
>prophage 28
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	3490717	3550995	4948537	transposase,tRNA,protease	Burkholderia_virus(14.29%)	51	NA	NA
AXM21874.1|3490717_3491481_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM21875.1|3492504_3494871_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXM23156.1|3494867_3495542_-	methylamine utilization protein	NA	NA	NA	NA	NA
AXM21876.1|3495751_3496690_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
AXM21877.1|3496812_3498162_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AXM21878.1|3498158_3499046_-	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AXM21879.1|3499363_3500170_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AXM21880.1|3500615_3501833_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AXM21881.1|3501938_3502907_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
AXM21882.1|3503256_3503925_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AXM21883.1|3503921_3504695_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AXM23157.1|3505268_3507335_-	ferrous iron transporter B	NA	NA	NA	NA	NA
AXM21884.1|3507901_3508927_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXM21885.1|3509011_3510085_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
AXM21886.1|3510077_3511181_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
AXM21887.1|3511191_3512118_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AXM21888.1|3512198_3512849_+	SCO family protein	NA	NA	NA	NA	NA
AXM21889.1|3512845_3513694_+	phosphatidylserine decarboxylase proenzyme	NA	NA	NA	NA	NA
AXM21890.1|3514244_3515828_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
AXM23158.1|3515747_3515933_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21891.1|3517250_3518468_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXM21892.1|3518428_3518650_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23159.1|3518826_3519333_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
AXM21893.1|3519454_3520855_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AXM21894.1|3521117_3521693_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
AXM21895.1|3521689_3522124_+	HIT family protein	NA	NA	NA	NA	NA
AXM21896.1|3522151_3522319_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21897.1|3522928_3523114_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21898.1|3523148_3523718_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
AXM21899.1|3523810_3524662_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AXM21900.1|3526049_3528065_+	M13 family peptidase	NA	NA	NA	NA	NA
AXM21901.1|3528335_3529034_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXM21902.1|3529074_3529482_-	cysteine methyltransferase	NA	NA	NA	NA	NA
AXM21903.1|3529919_3530882_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM21904.1|3532165_3533416_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXM21905.1|3533423_3534668_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
AXM21906.1|3534895_3535375_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXM23160.1|3535485_3536022_+	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
AXM21907.1|3536131_3536881_+	NlpC/P60 family protein	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
AXM21908.1|3537088_3537580_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AXM21909.1|3538693_3540013_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AXM21910.1|3540156_3541863_+	alkaline phosphatase	NA	NA	NA	NA	NA
AXM21911.1|3541896_3543201_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AXM21912.1|3543232_3543493_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AXM21913.1|3543494_3544370_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
AXM23161.1|3546204_3546669_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
AXM21914.1|3546720_3546909_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21915.1|3546881_3547202_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23162.1|3547198_3548566_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AXM21916.1|3548711_3549293_+	ribosome-associated protein	NA	NA	NA	NA	NA
AXM21917.1|3549549_3550995_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 29
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	3570095	3620086	4948537	transposase,tRNA,integrase	Ralstonia_phage(33.33%)	42	3594203:3594262	3610873:3611536
AXM21930.1|3570095_3572738_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
AXM21931.1|3572810_3573422_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
AXM21932.1|3573626_3574484_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
AXM21933.1|3574739_3575189_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AXM21934.1|3575545_3576781_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM23163.1|3576808_3577774_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM21935.1|3577898_3578661_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM21936.1|3578718_3578907_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21937.1|3579271_3579565_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21938.1|3580038_3580272_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
AXM21939.1|3580305_3581319_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXM21940.1|3581286_3581478_-	hypothetical protein	NA	NA	NA	NA	NA
AXM21941.1|3581568_3582888_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM21942.1|3582975_3584190_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
AXM21943.1|3584335_3584863_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21944.1|3584859_3585825_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM21945.1|3586065_3586828_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM21946.1|3587130_3589263_+	glycogen debranching enzyme GlgX	NA	NA	NA	NA	NA
AXM21947.1|3589813_3590782_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXM21948.1|3590942_3591911_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM23164.1|3592055_3593021_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM21949.1|3592986_3593400_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AXM21950.1|3593396_3594160_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3594203:3594262	attL	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTC	NA	NA	NA	NA
AXM21951.1|3595031_3595829_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM21952.1|3595862_3596255_-	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AXM21953.1|3596345_3596738_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23165.1|3599076_3599496_+|integrase	integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
AXM21954.1|3600723_3600948_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21955.1|3601212_3602997_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
AXM21956.1|3603187_3603388_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AXM21957.1|3603923_3604718_+	thiazole synthase	NA	NA	NA	NA	NA
AXM21958.1|3604710_3605004_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21959.1|3605019_3605778_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AXM21960.1|3605853_3607716_+	SLC13 family permease	NA	NA	NA	NA	NA
AXM23166.1|3607773_3608115_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AXM21961.1|3608374_3608650_+	hypothetical protein	NA	NA	NA	NA	NA
AXM21962.1|3611696_3612410_+	FAA hydrolase family protein	NA	NA	NA	NA	NA
3610873:3611536	attR	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTCAGCACAAGCCCAAACGCGGATGACGGCGTACAACGGCGGCCACACGCAGCTGGGTGCCGGAGGAGTTGCGGATTGTGCATCGCCCCGAAGAAGTGCAGACGCGCTTGGTCCCAGGTCATTGGGAAGGCGACTTGATCAAGGGCGCATTCAATCGTTCTTGCGTGGGCACGTTGGTGGAACGCAAGACGCGCTTTGTCGTGCTGTGCCGCATGGATGGCTGCACGGCCGCAGATGCGCTGGAAGGGTTTACCCGGCAAATGAAGAAACTGCCGGCCTCAATGCGGACAAGTCTGACCTACGATCGCGGTACCGAGCTCACGTGCTACGCCGAGCTGATGCAAGGATTGAACATCGACGTGTGGTTCGCTGATCCACATGCGCCGTGGCAGCGGGGAAGTAACGAGAACACCAACGGCCTGCTGCGCCAATTCCTGCCCAAGGGCGCCGACCTGTCCACTGTCAGCCAAGAGTATCTCAATCACATCGCACTGCTGATGAATACCCGCCCTCGTCAGACGCTCGGATGGAAGACACCAAGCGAGGCAATGGAGGAAGAAATCGCAGCACTCAAATCACGTGTTGCACTTGAATCTTGAGACTGCCC	NA	NA	NA	NA
AXM21963.1|3612470_3612893_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
AXM21964.1|3613024_3613788_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM21965.1|3616861_3617773_-	RNA methyltransferase	NA	NA	NA	NA	NA
AXM23167.1|3618288_3618426_-	acetyltransferase	NA	NA	NA	NA	NA
AXM23168.1|3619120_3620086_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 30
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	3667536	3709475	4948537	transposase,protease	Ralstonia_phage(44.44%)	33	NA	NA
AXM21994.1|3667536_3668505_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXM21995.1|3669525_3670560_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM21996.1|3670943_3671669_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXM21997.1|3671800_3672262_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23171.1|3675708_3677829_-	S9 family peptidase	NA	NA	NA	NA	NA
AXM21998.1|3678095_3678941_-	transporter	NA	NA	NA	NA	NA
AXM21999.1|3679197_3679560_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22000.1|3679932_3680901_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM22001.1|3681225_3683196_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
AXM22002.1|3683624_3685022_+|protease	serine protease	protease	NA	NA	NA	NA
AXM23172.1|3685134_3685953_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
AXM23173.1|3686263_3689461_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.0e-81
AXM23174.1|3689501_3689684_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22003.1|3689696_3691115_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
AXM23175.1|3691124_3691727_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
AXM22004.1|3691776_3692382_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
AXM22005.1|3692531_3692753_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXM22006.1|3692762_3693188_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
AXM22007.1|3693679_3694477_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM22008.1|3695554_3696334_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AXM22009.1|3696548_3697178_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM22010.1|3697238_3697994_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23176.1|3698322_3699099_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22011.1|3699095_3699338_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22012.1|3699507_3701082_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AXM23177.1|3701330_3701597_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22013.1|3701875_3705055_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	1.2e-73
AXM22014.1|3705054_3705729_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22015.1|3705728_3706475_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22016.1|3706471_3706666_-	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
AXM22017.1|3707172_3708141_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM22018.1|3708192_3708504_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AXM22019.1|3708506_3709475_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 31
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	4140004	4236288	4948537	transposase,tRNA	Ralstonia_phage(22.22%)	68	NA	NA
AXM23214.1|4140004_4141612_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM22357.1|4141809_4142037_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
AXM22358.1|4142041_4142701_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
AXM22359.1|4142887_4144252_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AXM23215.1|4144467_4145163_+	VIT family protein	NA	NA	NA	NA	NA
AXM22360.1|4146109_4146733_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AXM23216.1|4146934_4147675_+	cytochrome c4	NA	NA	NA	NA	NA
AXM22361.1|4147768_4148419_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
AXM22362.1|4148510_4149326_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
AXM23217.1|4149375_4150113_+	EEP domain-containing protein	NA	NA	NA	NA	NA
AXM22363.1|4152041_4153031_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
AXM22364.1|4153153_4155727_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
AXM22365.1|4155919_4156682_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM22366.1|4156755_4157724_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM22367.1|4158344_4159313_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXM22368.1|4159315_4159522_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22369.1|4159617_4159884_+|transposase	transposase	transposase	NA	NA	NA	NA
AXM22370.1|4160815_4161614_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23218.1|4163260_4164493_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	K4IEX3	Salmonella_phage	41.7	2.0e-72
AXM22371.1|4164532_4165495_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM22372.1|4165670_4166627_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM22373.1|4166838_4167807_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM22374.1|4168142_4168905_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM22375.1|4172315_4173281_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM22376.1|4173742_4173973_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22377.1|4174597_4176640_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
AXM22378.1|4176641_4178540_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
AXM22379.1|4178541_4179795_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
AXM22380.1|4179791_4180397_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
AXM22381.1|4180816_4181971_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AXM22382.1|4181973_4183002_-	SIS domain-containing protein	NA	NA	NA	NA	NA
AXM22383.1|4182998_4184075_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM22384.1|4184115_4185393_-	glucose/galactose MFS transporter	NA	NA	NA	NA	NA
AXM22385.1|4185437_4186205_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXM22386.1|4186419_4187586_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
AXM22387.1|4190129_4193027_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
AXM22388.1|4193177_4195868_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM22389.1|4196149_4197106_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.6e-42
AXM22390.1|4197139_4197352_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22391.1|4197596_4198832_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM22392.1|4200267_4201452_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM22393.1|4201519_4202257_+	pteridine reductase	NA	NA	NA	NA	NA
AXM22394.1|4202425_4202941_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AXM22395.1|4203032_4204535_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
AXM22396.1|4204538_4204979_-	response regulator	NA	NA	NA	NA	NA
AXM22397.1|4204975_4206787_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
AXM23219.1|4207072_4207435_-	BON domain-containing protein	NA	NA	NA	NA	NA
AXM22398.1|4207594_4208647_+	oxidoreductase	NA	NA	NA	NA	NA
AXM22399.1|4208986_4209928_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
AXM22400.1|4209948_4211286_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22401.1|4211457_4211838_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AXM22402.1|4211962_4212724_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
AXM22403.1|4214972_4216376_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
AXM22404.1|4216498_4217554_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
AXM23220.1|4217726_4218581_+	endonuclease	NA	NA	NA	NA	NA
AXM22405.1|4218872_4221056_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
AXM23221.1|4221554_4222550_-	restriction endonuclease	NA	NA	NA	NA	NA
AXM22406.1|4222645_4224457_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM22407.1|4224701_4225715_-	lipoyl synthase	NA	NA	NA	NA	NA
AXM22408.1|4225729_4226428_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
AXM22409.1|4226415_4226694_-	DUF493 family protein	NA	NA	NA	NA	NA
AXM22410.1|4227759_4228965_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
AXM22411.1|4229073_4229355_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22412.1|4229465_4230881_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
AXM22413.1|4230877_4232017_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AXM22414.1|4233756_4235031_-	DUF3380 domain-containing protein	NA	B3FJ91	Pseudomonas_phage	33.7	1.2e-21
AXM22415.1|4235030_4235249_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22416.1|4235325_4236288_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
>prophage 32
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	4302466	4432993	4948537	transposase,tRNA	Leptospira_phage(20.0%)	105	NA	NA
AXM22460.1|4302466_4303230_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23226.1|4304277_4305063_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
AXM22461.1|4305085_4305292_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22462.1|4305316_4306990_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
AXM22463.1|4307533_4307980_-	autotransporter	NA	NA	NA	NA	NA
AXM22464.1|4308310_4308595_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22465.1|4309189_4310101_-	magnesium transporter	NA	NA	NA	NA	NA
AXM22466.1|4310346_4311342_+	type III secretion system effector protein	NA	NA	NA	NA	NA
AXM23227.1|4311435_4312812_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
AXM22467.1|4313978_4315679_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
AXM22468.1|4316087_4317860_+	cellulase	NA	NA	NA	NA	NA
AXM23228.1|4318135_4319020_-	DMT family transporter	NA	NA	NA	NA	NA
AXM23229.1|4319208_4320087_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM23230.1|4320286_4320682_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22469.1|4322126_4323218_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
AXM22470.1|4325126_4327451_+	S9 family peptidase	NA	NA	NA	NA	NA
AXM22471.1|4327646_4329593_-	S9 family peptidase	NA	NA	NA	NA	NA
AXM22472.1|4329967_4330159_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22473.1|4330549_4332133_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
AXM23231.1|4332480_4333077_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22474.1|4334425_4335274_-	threonine aldolase	NA	NA	NA	NA	NA
AXM22475.1|4335308_4336784_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
AXM22476.1|4337374_4338304_-	lipid kinase YegS	NA	NA	NA	NA	NA
AXM22477.1|4338538_4339030_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM23232.1|4339026_4339698_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AXM22478.1|4340092_4340422_-	J domain-containing protein	NA	NA	NA	NA	NA
AXM22479.1|4340624_4341557_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
AXM22480.1|4342345_4343144_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23233.1|4343291_4344326_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM22481.1|4347193_4347679_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
AXM22482.1|4348217_4351046_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
AXM22483.1|4351045_4351420_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
AXM22484.1|4351416_4352967_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
AXM22485.1|4352963_4353470_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
AXM22486.1|4353466_4353751_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
AXM22487.1|4353747_4354101_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
AXM22488.1|4354548_4354887_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22489.1|4355310_4356636_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
AXM22490.1|4357000_4358071_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
AXM22491.1|4358241_4358730_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXM22492.1|4359086_4359677_-	thioredoxin family protein	NA	NA	NA	NA	NA
AXM22493.1|4359688_4361197_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.6	2.9e-62
AXM22494.1|4361639_4362533_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
AXM22495.1|4363933_4364599_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
AXM23234.1|4365231_4366197_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM22496.1|4366729_4367110_+	peptide-binding protein	NA	NA	NA	NA	NA
AXM22497.1|4367312_4368218_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22498.1|4368286_4369582_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
AXM23235.1|4369672_4370236_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22499.1|4370661_4371927_-	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
AXM22500.1|4371923_4372901_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22501.1|4373004_4373808_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AXM22502.1|4373983_4374793_+	glycosyl transferase	NA	NA	NA	NA	NA
AXM22503.1|4374800_4375599_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23236.1|4375641_4376289_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22504.1|4376383_4376959_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22505.1|4377170_4378490_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM22506.1|4378639_4379608_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM22507.1|4379733_4380486_-	HAD family hydrolase	NA	NA	NA	NA	NA
AXM22508.1|4380523_4380964_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
AXM23237.1|4381170_4381512_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
AXM22509.1|4381737_4382115_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23238.1|4382325_4382523_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
AXM22510.1|4382829_4383576_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
AXM22511.1|4383668_4384475_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AXM23239.1|4384698_4386111_+	NlpC-P60 family protein	NA	NA	NA	NA	NA
AXM22512.1|4386107_4387205_+	dipeptide epimerase	NA	NA	NA	NA	NA
AXM22513.1|4387359_4388158_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM22514.1|4388211_4389010_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM22515.1|4389229_4390192_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM22516.1|4390639_4391403_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM22517.1|4391684_4392461_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22518.1|4392457_4393774_+	amino acid permease	NA	NA	NA	NA	NA
AXM22519.1|4394290_4395526_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM22520.1|4395692_4396655_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM22521.1|4397199_4397481_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22522.1|4398041_4398476_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22523.1|4398650_4399829_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
AXM22524.1|4399864_4400191_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22525.1|4400824_4401787_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM22526.1|4404120_4406292_-	beta-glucosidase	NA	NA	NA	NA	NA
AXM22527.1|4406519_4406876_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AXM22528.1|4406954_4408019_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
AXM22529.1|4408298_4408514_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXM22530.1|4408821_4409268_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
AXM22531.1|4410745_4411708_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
AXM22532.1|4411797_4413546_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
AXM22533.1|4414873_4415119_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22534.1|4415118_4415352_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22535.1|4415609_4416656_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
AXM22536.1|4416839_4418420_+	thioredoxin family protein	NA	NA	NA	NA	NA
AXM22537.1|4418808_4419705_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AXM22538.1|4419707_4420871_-	heme A synthase	NA	NA	NA	NA	NA
AXM22539.1|4420881_4421457_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22540.1|4421484_4422204_-	SURF1 family protein	NA	NA	NA	NA	NA
AXM22541.1|4422264_4422483_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
AXM22542.1|4422582_4423458_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
AXM22543.1|4423496_4424093_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
AXM22544.1|4424089_4424263_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22545.1|4424243_4425848_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
AXM22546.1|4425886_4426840_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AXM23240.1|4426856_4427333_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
AXM22547.1|4427609_4430810_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
AXM22548.1|4430969_4431948_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
AXM23241.1|4432027_4432993_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 33
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	4445230	4525691	4948537	transposase,tRNA,integrase	Leptospira_phage(21.43%)	56	4502233:4502252	4516292:4516311
AXM23244.1|4445230_4446332_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
AXM22562.1|4446936_4449168_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
AXM23245.1|4449357_4451070_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22563.1|4451218_4452595_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.4e-79
AXM22564.1|4454801_4455600_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM22565.1|4456584_4457553_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM22566.1|4457719_4458691_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
AXM22567.1|4458883_4460068_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXM22568.1|4460535_4461351_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
AXM22569.1|4462109_4463426_-	amidohydrolase	NA	NA	NA	NA	NA
AXM22570.1|4463685_4464930_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM22571.1|4465022_4468271_+	acriflavine resistance protein B	NA	NA	NA	NA	NA
AXM22572.1|4468404_4471545_+	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AXM22573.1|4471834_4473202_-	VOC family protein	NA	NA	NA	NA	NA
AXM22574.1|4473211_4473421_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22575.1|4473946_4474912_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM22576.1|4475330_4476296_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM23246.1|4476758_4477229_+	thioesterase	NA	NA	NA	NA	NA
AXM22577.1|4477257_4477680_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22578.1|4477755_4478190_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AXM22579.1|4478299_4478815_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
AXM22580.1|4478830_4479856_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AXM22581.1|4480178_4480775_-	Ax21 family protein	NA	NA	NA	NA	NA
AXM22582.1|4481132_4482860_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AXM22583.1|4482909_4484352_+	sensor histidine kinase	NA	NA	NA	NA	NA
AXM22584.1|4484336_4485683_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXM22585.1|4485873_4486623_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22586.1|4486724_4487336_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22587.1|4487440_4488664_+	MFS transporter	NA	NA	NA	NA	NA
AXM22588.1|4489005_4489482_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AXM22589.1|4489508_4489970_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22590.1|4490355_4490676_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AXM22591.1|4490777_4491794_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
AXM22592.1|4491865_4493029_+	Fic family protein	NA	NA	NA	NA	NA
AXM22593.1|4493025_4494657_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
AXM22594.1|4494658_4497160_+	helicase SNF2	NA	NA	NA	NA	NA
AXM22595.1|4497156_4498059_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AXM22596.1|4498280_4498664_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AXM22597.1|4498982_4500653_+	peptide synthase	NA	NA	NA	NA	NA
AXM22598.1|4500881_4501892_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.6	1.5e-14
AXM22599.1|4501956_4502115_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
4502233:4502252	attL	AGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
AXM22600.1|4502349_4503726_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
AXM22601.1|4503736_4504270_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXM22602.1|4504698_4505958_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
AXM22603.1|4506096_4507404_-	MFS transporter	NA	NA	NA	NA	NA
AXM22604.1|4509488_4510523_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM22605.1|4510873_4511419_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AXM23247.1|4511444_4511711_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AXM22606.1|4511885_4513724_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AXM22607.1|4513954_4514830_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
AXM23248.1|4516652_4516916_-	xanthomonadin biosynthesis protein	NA	NA	NA	NA	NA
4516292:4516311	attR	GGGGTTTTTCAGGGGCGACT	NA	NA	NA	NA
AXM22608.1|4516947_4518090_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
AXM22609.1|4519216_4520116_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AXM22610.1|4521062_4523864_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
AXM22611.1|4523940_4524231_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
AXM22612.1|4524588_4525691_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	6.7e-40
>prophage 34
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	4679255	4746676	4948537	transposase,tRNA	Mycobacterium_phage(16.67%)	46	NA	NA
AXM22707.1|4679255_4681493_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AXM22708.1|4681781_4682690_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AXM22709.1|4682779_4684594_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
AXM23266.1|4684979_4693436_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22710.1|4693903_4694701_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM22711.1|4694615_4694846_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23267.1|4694873_4695110_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22712.1|4695245_4695998_+	glutamine amidotransferase	NA	NA	NA	NA	NA
AXM22713.1|4696057_4696957_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22714.1|4697108_4697864_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
AXM22715.1|4697860_4698496_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AXM22716.1|4698511_4698739_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AXM22717.1|4698811_4699714_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22718.1|4699868_4700834_+	ferrochelatase	NA	NA	NA	NA	NA
AXM22719.1|4700931_4701687_+	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
AXM22720.1|4701767_4702226_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22721.1|4702496_4703282_-	M48 family peptidase	NA	NA	NA	NA	NA
AXM22722.1|4703307_4703535_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22723.1|4703908_4704814_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	4.1e-43
AXM22724.1|4704877_4705795_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
AXM22725.1|4705885_4706395_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22726.1|4706398_4707736_+	xylose isomerase	NA	NA	NA	NA	NA
AXM22727.1|4707961_4709029_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM22728.1|4709204_4711400_+	alpha-glucuronidase	NA	NA	NA	NA	NA
AXM22729.1|4711396_4713361_+	9-O-acetylesterase	NA	NA	NA	NA	NA
AXM22730.1|4713372_4714632_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
AXM23268.1|4714631_4716332_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
AXM22731.1|4716334_4719049_+	glucan 1,4-alpha-glucosidase	NA	NA	NA	NA	NA
AXM22732.1|4719271_4720744_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
AXM22733.1|4721721_4722777_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22734.1|4723004_4724423_-	glucuronate isomerase	NA	NA	NA	NA	NA
AXM22735.1|4724463_4725441_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
AXM22736.1|4726857_4728339_-	MFS transporter	NA	NA	NA	NA	NA
AXM23269.1|4728680_4731554_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM22737.1|4731652_4733140_+	MFS transporter	NA	NA	NA	NA	NA
AXM22738.1|4733171_4734206_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AXM22739.1|4734622_4735420_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM23270.1|4736296_4736434_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23271.1|4736726_4737683_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM22740.1|4739191_4740292_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXM22741.1|4740357_4741479_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
AXM22742.1|4741488_4742583_-	ferredoxin reductase	NA	NA	NA	NA	NA
AXM22743.1|4742657_4743338_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
AXM22744.1|4743370_4744169_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM22745.1|4744297_4745617_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM22746.1|4745719_4746676_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
>prophage 35
CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	4824356	4890431	4948537	transposase,protease	Staphylococcus_phage(25.0%)	59	NA	NA
AXM22792.1|4824356_4825325_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXM22793.1|4825872_4826974_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.2	1.2e-41
AXM22794.1|4827654_4827957_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22795.1|4828102_4828906_-	2,5-didehydrogluconate reductase DkgB	NA	A0A2H4PQR8	Staphylococcus_phage	34.3	4.7e-35
AXM22796.1|4828967_4829996_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AXM22797.1|4830134_4831106_-	aldo/keto reductase	NA	NA	NA	NA	NA
AXM22798.1|4831338_4832193_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AXM23281.1|4832285_4832858_+	pseudouridine synthase	NA	NA	NA	NA	NA
AXM22799.1|4832879_4833074_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22800.1|4833180_4833621_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22801.1|4833783_4836285_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	25.4	6.0e-20
AXM22802.1|4836973_4837447_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	48.7	2.1e-35
AXM22803.1|4837759_4839079_-	L-fuconate dehydratase	NA	NA	NA	NA	NA
AXM22804.1|4839602_4840460_-	FAA hydrolase family protein	NA	NA	NA	NA	NA
AXM22805.1|4840630_4841401_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXM22806.1|4841397_4842270_-	amidohydrolase	NA	NA	NA	NA	NA
AXM22807.1|4842266_4843277_-	aldo/keto reductase	NA	NA	NA	NA	NA
AXM22808.1|4843273_4843495_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22809.1|4843589_4844687_+	xylosidase	NA	NA	NA	NA	NA
AXM22810.1|4844820_4845024_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22811.1|4845703_4845928_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22812.1|4845939_4846608_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXM22813.1|4846869_4848813_-	acetyl-coenzyme A synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	38.2	1.3e-83
AXM22814.1|4849110_4849464_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22815.1|4849460_4850510_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22816.1|4850596_4850914_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
AXM22817.1|4850910_4852638_+	cation acetate symporter	NA	NA	NA	NA	NA
AXM22818.1|4853245_4853947_-	ROK family protein	NA	NA	NA	NA	NA
AXM22819.1|4854303_4855083_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AXM22820.1|4855079_4855517_+	GFA family protein	NA	NA	NA	NA	NA
AXM22821.1|4855578_4855830_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AXM22822.1|4855956_4856553_+	4-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AXM22823.1|4856571_4858143_-	alkaline phosphatase	NA	NA	NA	NA	NA
AXM23282.1|4858319_4859948_-	alkaline phosphatase	NA	NA	NA	NA	NA
AXM23283.1|4860170_4860809_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
AXM22824.1|4861877_4862237_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22825.1|4862421_4862658_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AXM22826.1|4862671_4862839_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AXM22827.1|4863271_4863739_-	amidohydrolase	NA	NA	NA	NA	NA
AXM22828.1|4863735_4864971_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM23284.1|4865610_4865784_-	4-oxalomesaconate hydratase	NA	NA	NA	NA	NA
AXM22829.1|4865842_4866898_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
AXM22830.1|4866890_4867562_-	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
AXM22831.1|4867659_4868967_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM22832.1|4868983_4870402_+	cardiolipin synthase	NA	NA	NA	NA	NA
AXM22833.1|4870973_4872368_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AXM22834.1|4872367_4872706_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22835.1|4872715_4874902_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.7	2.2e-111
AXM22836.1|4875077_4875302_-	hypothetical protein	NA	NA	NA	NA	NA
AXM23285.1|4875882_4876848_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM23286.1|4877023_4878439_-	amino acid permease	NA	NA	NA	NA	NA
AXM22837.1|4878655_4878865_+	hypothetical protein	NA	NA	NA	NA	NA
AXM22838.1|4878929_4881254_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
AXM23287.1|4881659_4882022_+	hypothetical protein	NA	NA	NA	NA	NA
AXM23288.1|4882399_4882945_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
AXM22839.1|4884606_4885926_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM22840.1|4886198_4887326_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
AXM22841.1|4888181_4889522_-	hypothetical protein	NA	NA	NA	NA	NA
AXM22842.1|4889738_4890431_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
