The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	7627	55011	5026592	holin,transposase,protease	Ralstonia_phage(33.33%)	44	NA	NA
AXM38412.1|7627_8464_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXM38413.1|8650_9457_+	M48 family peptidase	NA	NA	NA	NA	NA
AXM38414.1|9733_10927_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AXM38415.1|11080_11752_+	energy transducer TonB	NA	NA	NA	NA	NA
AXM38416.1|11836_12598_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
AXM38417.1|12644_13067_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXM38418.1|13070_13484_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXM38419.1|13779_14547_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AXM38420.1|14557_14827_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38421.1|14901_16362_-	cardiolipin synthase	NA	NA	NA	NA	NA
AXM38422.1|17008_18019_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
AXM38423.1|18290_19493_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AXM38424.1|19634_21773_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
AXM41843.1|21983_22277_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38425.1|22393_22939_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38426.1|23052_24033_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
AXM38427.1|24080_25247_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AXM41844.1|27435_28653_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
AXM38428.1|29273_30296_-	sugar kinase	NA	NA	NA	NA	NA
AXM38429.1|30876_32130_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38430.1|32203_33001_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38431.1|32988_33966_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38432.1|34050_34245_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38433.1|34847_35510_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
AXM38434.1|35663_36458_-	EcsC family protein	NA	NA	NA	NA	NA
AXM41845.1|36625_37099_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
AXM38435.1|39324_40287_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM38436.1|40773_41172_-	host attachment protein	NA	NA	NA	NA	NA
AXM38437.1|41263_41956_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38438.1|42125_42596_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AXM38439.1|42607_42790_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38440.1|44062_44374_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38441.1|44628_45576_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
AXM38442.1|45716_46763_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM38443.1|46901_47183_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38444.1|47223_47496_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38445.1|47587_47773_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38446.1|47886_48837_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
AXM38447.1|49543_50431_+	TIGR01777 family protein	NA	NA	NA	NA	NA
AXM38448.1|50736_51054_+	ATP-binding protein	NA	NA	NA	NA	NA
AXM38449.1|51513_52365_-	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
AXM38450.1|52606_54043_+	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
AXM38451.1|54159_54522_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38452.1|54525_55011_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 2
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	91808	147525	5026592	transposase	Ostreococcus_lucimarinus_virus(14.29%)	40	NA	NA
AXM38482.1|91808_92571_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38483.1|92578_94303_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
AXM38484.1|94313_94526_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38485.1|94543_95485_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AXM38486.1|95677_97042_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
AXM38487.1|97038_98667_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXM38488.1|99140_100724_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
AXM38489.1|100720_102955_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
AXM38490.1|102957_104715_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
AXM38491.1|104771_106661_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AXM38492.1|106657_109267_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
AXM38493.1|109289_109475_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
AXM38494.1|109589_111752_+	glycogen debranching enzyme GlgX	NA	NA	NA	NA	NA
AXM38495.1|111768_112401_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AXM38496.1|113202_114249_-	methylamine utilization protein	NA	NA	NA	NA	NA
AXM38497.1|115674_115875_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38498.1|115871_116837_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM38499.1|117982_120328_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM41848.1|120443_120902_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38500.1|120901_121234_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38501.1|121250_121511_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38502.1|122834_124244_+	FAD-binding protein	NA	NA	NA	NA	NA
AXM38503.1|124592_125024_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38504.1|125298_125634_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38505.1|126073_127363_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
AXM38506.1|127370_127622_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38507.1|127981_128962_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.0	1.0e-87
AXM38508.1|128910_129297_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38509.1|129427_129751_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38510.1|129692_129935_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38511.1|130310_131276_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM38512.1|132947_134324_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
AXM38513.1|134925_135807_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.5e-05
AXM38514.1|137601_138558_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
AXM38515.1|139222_140047_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
AXM38516.1|140220_141474_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM38517.1|142697_143387_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	1.3e-36
AXM38518.1|143399_144557_+	ABC transporter permease	NA	NA	NA	NA	NA
AXM38519.1|144569_145880_+	ABC transporter permease	NA	NA	NA	NA	NA
AXM38520.1|146559_147525_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	174324	230966	5026592	protease,tRNA,transposase	Acidithiobacillus_phage(28.57%)	32	NA	NA
AXM38534.1|174324_175290_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM38535.1|176802_178122_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM38536.1|178389_179766_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	9.5e-76
AXM38537.1|181167_182235_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM41853.1|182190_182388_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38538.1|182369_182465_-	xylosidase	NA	NA	NA	NA	NA
AXM38539.1|182440_182968_-	xylosidase	NA	NA	NA	NA	NA
AXM38540.1|183790_185974_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
AXM38541.1|185985_189336_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
AXM38542.1|189332_192449_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
AXM41854.1|194402_195368_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM41855.1|196993_197173_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38543.1|197175_197502_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38544.1|197517_197685_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38545.1|197767_199243_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.1	2.8e-102
AXM38546.1|200865_202185_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM38547.1|202328_203849_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AXM38548.1|203865_204144_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41856.1|204333_204672_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
AXM38549.1|205284_207270_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AXM38550.1|207901_208864_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM38551.1|209269_210082_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38552.1|210274_210886_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38553.1|211302_212160_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
AXM38554.1|212397_214284_+	arginine decarboxylase	NA	NA	NA	NA	NA
AXM41857.1|214654_215689_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM38555.1|217724_220445_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	2.8e-71
AXM38556.1|220510_222655_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.1	2.0e-27
AXM38557.1|222651_224334_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM38558.1|224653_226855_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.4	1.5e-19
AXM38559.1|226851_228528_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM38560.1|229061_230966_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 4
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	266624	342393	5026592	tail,transposase	Arthrobacter_phage(18.75%)	57	NA	NA
AXM38586.1|266624_267726_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
AXM38587.1|268500_269463_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM41859.1|271530_272496_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM41860.1|273174_274212_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
AXM38588.1|274719_275730_-	TIGR00266 family protein	NA	NA	NA	NA	NA
AXM38589.1|275918_276764_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.7	3.7e-06
AXM41862.1|276923_278129_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
AXM41861.1|278181_278514_+	calcium-dependent protein kinase 21	NA	NA	NA	NA	NA
AXM41863.1|278562_279300_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	1.5e-19
AXM38590.1|279296_280769_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
AXM38591.1|281055_282237_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
AXM38592.1|282308_283592_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
AXM38593.1|283588_284575_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
AXM38594.1|284619_285897_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AXM38595.1|285893_286514_-	transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	41.9	1.9e-07
AXM38596.1|286656_290364_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
AXM38597.1|290558_290921_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38598.1|291455_292373_+	AEC family transporter	NA	NA	NA	NA	NA
AXM38599.1|292725_293358_+	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	36.6	1.6e-09
AXM38600.1|293373_293850_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AXM38601.1|293853_294426_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AXM38602.1|294422_296438_+	phospholipase D family protein	NA	NA	NA	NA	NA
AXM38603.1|296701_297130_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
AXM38604.1|297249_298053_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AXM38605.1|298112_299102_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AXM38606.1|299515_301588_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AXM38607.1|301782_302394_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AXM38608.1|303547_304354_-	META domain-containing protein	NA	NA	NA	NA	NA
AXM38609.1|304490_305288_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AXM38610.1|305509_306919_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AXM41864.1|307196_307535_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
AXM38611.1|307524_309000_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	32.2	2.0e-31
AXM38612.1|309270_310326_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AXM38613.1|310318_311746_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
AXM41865.1|312367_312847_+	superoxide dismutase family protein	NA	I3XM75	Mamestra_brassicae_nuclear_polyhedrosis_virus	40.6	6.1e-14
AXM41866.1|312917_313550_+	superoxide dismutase family protein	NA	M1ICI8	Paramecium_bursaria_Chlorella_virus	41.0	7.8e-17
AXM38614.1|313832_314798_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM38615.1|314885_315422_-	microcystin-dependent protein	NA	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
AXM38616.1|315480_316008_-|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
AXM38617.1|316076_316622_-	microcystin-dependent protein	NA	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
AXM38618.1|321397_324052_-	ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	26.7	1.1e-48
AXM38619.1|324457_327871_+	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
AXM38620.1|327867_331941_+	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
AXM38621.1|332128_334381_+	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.7	8.7e-10
AXM38622.1|334475_334757_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
AXM38623.1|334774_335065_+	addiction module antidote protein, HigA family	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
AXM38624.1|335993_337388_+	type III secretion system effector protein	NA	NA	NA	NA	NA
AXM38625.1|337490_337589_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38626.1|337837_338170_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38627.1|338310_338505_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38628.1|338505_338730_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38629.1|338867_339302_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
AXM38630.1|339304_339781_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM38631.1|339773_340106_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41867.1|340204_340900_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38632.1|340896_341421_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38633.1|341430_342393_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
>prophage 5
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	349003	415374	5026592	tRNA,transposase	Staphylococcus_prophage(16.67%)	45	NA	NA
AXM41868.1|349003_349960_-|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	6.9e-41
AXM38640.1|350062_351382_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM38641.1|351510_352308_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38642.1|352341_353022_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
AXM38643.1|353096_354191_+	ferredoxin reductase	NA	NA	NA	NA	NA
AXM38644.1|354200_355322_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
AXM41869.1|355387_356377_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AXM38645.1|356505_357269_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM41870.1|358188_358326_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38646.1|359201_360000_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38647.1|360416_361451_-	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AXM38648.1|361482_362970_-	MFS transporter	NA	NA	NA	NA	NA
AXM41871.1|363068_365942_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM38649.1|366283_367765_+	MFS transporter	NA	NA	NA	NA	NA
AXM38650.1|369181_370159_+	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
AXM38651.1|370199_371618_+	glucuronate isomerase	NA	NA	NA	NA	NA
AXM38652.1|371844_372900_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38653.1|373877_375350_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
AXM38654.1|375572_378287_-	glucan 1,4-alpha-glucosidase	NA	NA	NA	NA	NA
AXM41872.1|378289_379990_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
AXM38655.1|379989_381249_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
AXM38656.1|381260_383225_-	9-O-acetylesterase	NA	NA	NA	NA	NA
AXM38657.1|383221_385417_-	alpha-glucuronidase	NA	NA	NA	NA	NA
AXM38658.1|385592_386660_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM38659.1|386885_388223_-	xylose isomerase	NA	NA	NA	NA	NA
AXM38660.1|388226_388736_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38661.1|388826_389744_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	4.1e-83
AXM38662.1|389807_390713_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	3.1e-43
AXM38663.1|391086_391314_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38664.1|391339_392125_+	M48 family peptidase	NA	NA	NA	NA	NA
AXM38665.1|392935_393691_-	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
AXM38666.1|393788_394754_-	ferrochelatase	NA	NA	NA	NA	NA
AXM38667.1|394908_395811_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38668.1|395883_396111_+	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AXM38669.1|396126_396768_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AXM38670.1|396764_397520_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
AXM38671.1|397671_398571_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38672.1|398630_399383_-	glutamine amidotransferase	NA	NA	NA	NA	NA
AXM38673.1|399518_399755_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38674.1|399782_400013_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38675.1|399926_400725_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38676.1|401189_409649_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38677.1|410034_411849_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
AXM38678.1|411938_412847_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AXM38679.1|413136_415374_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 6
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	535239	582563	5026592	integrase,transposase	Vibrio_phage(16.67%)	29	558743:558764	589770:589791
AXM38751.1|535239_536205_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM38752.1|537186_537768_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38753.1|538065_538689_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38754.1|539117_540038_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AXM38755.1|540037_540556_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38756.1|540717_543543_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
AXM38757.1|543638_543926_-	hypothetical protein	NA	A0A2I7SAW6	Vibrio_phage	31.6	8.2e-06
AXM41888.1|544202_544965_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38758.1|548321_548822_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41889.1|549728_550676_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
AXM38759.1|550809_551400_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
AXM38760.1|551610_552375_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AXM38761.1|552860_553280_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
AXM38762.1|553276_553708_-	ATP-binding protein	NA	NA	NA	NA	NA
AXM38763.1|553704_555711_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
AXM38764.1|555928_556276_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38765.1|556573_556699_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AXM38766.1|556792_557305_+	hypothetical protein	NA	Q8W6R2	Burkholderia_virus	69.5	5.5e-45
AXM38767.1|558732_558933_+	hypothetical protein	NA	NA	NA	NA	NA
558743:558764	attL	GGGGTTTTTCAGGGGCGACTAT	NA	NA	NA	NA
AXM38768.1|558998_562916_-	avirulence protein	NA	NA	NA	NA	NA
AXM38769.1|566238_568926_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AXM38770.1|569424_569679_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41890.1|570857_571959_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	5.2e-40
AXM38771.1|572317_572608_-	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
AXM38772.1|572684_575486_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
AXM38773.1|576433_577333_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AXM38774.1|578447_579590_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	6.2e-97
AXM41891.1|579621_579885_+	xanthomonadin biosynthesis protein	NA	NA	NA	NA	NA
AXM38775.1|581687_582563_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
589770:589791	attR	ATAGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
>prophage 7
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	589793	644518	5026592	tRNA,transposase	Leptospira_phage(28.57%)	41	NA	NA
AXM38781.1|589793_591170_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.1e-76
AXM38782.1|591168_591387_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38783.1|591404_591563_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
AXM38784.1|591627_592638_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.2	4.5e-14
AXM38785.1|592866_594537_-	peptide synthase	NA	NA	NA	NA	NA
AXM38786.1|594855_595239_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AXM38787.1|595460_596363_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AXM38788.1|596359_598861_-	helicase SNF2	NA	NA	NA	NA	NA
AXM38789.1|598862_600494_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
AXM38790.1|600490_601654_-	Fic family protein	NA	NA	NA	NA	NA
AXM38791.1|601725_602742_-	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
AXM38792.1|602843_603164_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AXM38793.1|603549_604011_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38794.1|604037_604514_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AXM38795.1|604855_606079_-	MFS transporter	NA	NA	NA	NA	NA
AXM38796.1|606183_606795_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38797.1|606896_607640_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38798.1|607830_609177_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXM38799.1|609161_610604_-	sensor histidine kinase	NA	NA	NA	NA	NA
AXM38800.1|610653_612381_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AXM38801.1|612738_613335_+	Ax21 family protein	NA	NA	NA	NA	NA
AXM38802.1|613657_614683_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AXM38803.1|614698_615214_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
AXM38804.1|615323_615758_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AXM38805.1|615833_616256_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41893.1|616284_616755_-	thioesterase	NA	NA	NA	NA	NA
AXM38806.1|617217_618183_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM38807.1|618601_619567_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM38808.1|619895_620177_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38809.1|620092_620302_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38810.1|620311_621679_+	VOC family protein	NA	NA	NA	NA	NA
AXM38811.1|621968_625109_-	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AXM38812.1|625242_628491_-	acriflavine resistance protein B	NA	NA	NA	NA	NA
AXM38813.1|628583_629828_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM41894.1|630087_631122_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM38814.1|631203_632520_+	amidohydrolase	NA	NA	NA	NA	NA
AXM38815.1|633278_634094_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
AXM38816.1|635902_636859_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	4.5e-40
AXM41895.1|638678_640391_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38817.1|640580_642812_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
AXM38818.1|643415_644518_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
>prophage 8
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	656793	784922	5026592	integrase,tRNA,transposase	Staphylococcus_phage(14.29%)	116	684260:684276	722341:722357
AXM41899.1|656793_657759_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM38832.1|657837_658817_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.9	1.6e-37
AXM38833.1|658976_662177_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
AXM41900.1|662453_662930_+	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
AXM38834.1|662946_663900_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AXM38835.1|663938_665543_+	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
AXM38836.1|665523_665697_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38837.1|665693_666290_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
AXM38838.1|666328_667204_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
AXM38839.1|667296_667515_-	twin transmembrane helix small protein	NA	NA	NA	NA	NA
AXM38840.1|667575_668295_+	SURF1 family protein	NA	NA	NA	NA	NA
AXM38841.1|668322_668898_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38842.1|668908_670072_+	heme A synthase	NA	NA	NA	NA	NA
AXM38843.1|670074_670971_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AXM38844.1|671359_672940_-	thioredoxin family protein	NA	NA	NA	NA	NA
AXM38845.1|673123_674170_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
AXM38846.1|674427_674661_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38847.1|674895_676215_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM38848.1|676364_677333_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.5e-99
AXM38849.1|677545_678865_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM38850.1|679394_679910_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXM38851.1|680312_682535_-	primosomal protein N'	NA	NA	NA	NA	NA
AXM38852.1|683000_684026_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38853.1|684009_684612_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
684260:684276	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
AXM38854.1|684942_685788_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38855.1|685747_686029_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38856.1|686306_687683_+	MATE family efflux transporter	NA	NA	NA	NA	NA
AXM38857.1|687767_689669_+	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
AXM38858.1|689854_690070_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38859.1|690176_690953_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXM38860.1|691114_691789_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AXM38861.1|691785_692559_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AXM38862.1|692782_693346_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AXM38863.1|693356_695849_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
AXM38864.1|696031_697306_-	RDD family protein	NA	NA	NA	NA	NA
AXM38865.1|697347_698070_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
AXM38866.1|698110_698584_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AXM38867.1|698626_699769_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AXM38868.1|699840_700977_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
AXM38869.1|701109_701622_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
AXM38870.1|702015_702939_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
AXM38871.1|702938_704252_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
AXM38872.1|704302_706024_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AXM38873.1|706188_707466_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
AXM38874.1|707663_708488_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AXM38875.1|708488_709547_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
AXM38876.1|709712_711218_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41901.1|711214_711724_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38877.1|711833_712967_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
AXM38878.1|713209_713731_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXM38879.1|713930_714845_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
AXM38880.1|714945_715386_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AXM38881.1|715494_717369_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
AXM38882.1|717561_717882_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38883.1|718510_719785_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.4e-110
AXM38884.1|719697_719961_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	71.4	7.2e-17
AXM38885.1|719918_720125_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38886.1|720121_720394_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41902.1|720390_720636_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38887.1|722571_723807_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
722341:722357	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
AXM38888.1|723875_724265_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38889.1|724261_724465_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38890.1|724587_725553_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM38891.1|726791_727514_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.2e-16
AXM38892.1|727524_728961_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
AXM38893.1|728960_730229_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
AXM38894.1|730318_732460_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AXM38895.1|732544_733210_-	DUF2894 domain-containing protein	NA	NA	NA	NA	NA
AXM38896.1|733206_733881_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38897.1|733877_736535_-	DUF802 domain-containing protein	NA	NA	NA	NA	NA
AXM38898.1|736545_737295_-	DUF3348 domain-containing protein	NA	NA	NA	NA	NA
AXM38899.1|737621_737834_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38900.1|738254_738476_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38901.1|738485_738800_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AXM38902.1|739260_740580_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM38903.1|740831_742580_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
AXM38904.1|742669_743632_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
AXM38905.1|745925_746372_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
AXM38906.1|746679_746895_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXM38907.1|747174_748239_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
AXM38908.1|748317_748674_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AXM38909.1|748901_751073_+	beta-glucosidase	NA	NA	NA	NA	NA
AXM38910.1|753406_754369_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM38911.1|755002_755329_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38912.1|755364_756543_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
AXM38913.1|756717_757152_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41903.1|757712_757994_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38914.1|758039_758837_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38915.1|759049_759812_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38916.1|759871_761188_-	amino acid permease	NA	NA	NA	NA	NA
AXM38917.1|761184_761961_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38918.1|762242_763005_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38919.1|763453_764416_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM38920.1|764635_765433_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38921.1|765588_766686_-	dipeptide epimerase	NA	NA	NA	NA	NA
AXM41904.1|766682_768095_-	NlpC-P60 family protein	NA	NA	NA	NA	NA
AXM38922.1|768318_769125_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AXM38923.1|769217_769964_+	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
AXM41905.1|770270_770468_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
AXM38924.1|770678_771056_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41906.1|771281_771623_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
AXM38925.1|771690_771915_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38926.1|771829_772270_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
AXM38927.1|772307_773057_+	HAD family hydrolase	NA	NA	NA	NA	NA
AXM38928.1|773194_773770_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41907.1|773864_774512_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38929.1|774554_775352_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38930.1|775360_776170_-	glycosyl transferase	NA	NA	NA	NA	NA
AXM38931.1|776345_777149_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AXM38932.1|777252_778230_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38933.1|778226_779492_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
AXM41908.1|779917_780481_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38934.1|780571_781867_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
AXM38935.1|781935_782841_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38936.1|783043_783424_-	peptide-binding protein	NA	NA	NA	NA	NA
AXM41909.1|783956_784922_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 9
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	805795	867392	5026592	transposase	Leptospira_phage(22.22%)	39	NA	NA
AXM41910.1|805795_806830_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	33.1	9.4e-44
AXM38952.1|807712_808645_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
AXM38953.1|808847_809177_+	J domain-containing protein	NA	NA	NA	NA	NA
AXM41911.1|809571_810243_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AXM38954.1|810239_810731_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM38955.1|810965_811895_+	lipid kinase YegS	NA	NA	NA	NA	NA
AXM38956.1|812492_813968_+	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
AXM38957.1|814002_814851_+	threonine aldolase	NA	NA	NA	NA	NA
AXM41912.1|814899_816001_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.5e-42
AXM41913.1|816211_816808_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38958.1|817155_818739_-	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.0	2.5e-35
AXM38959.1|819129_819321_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38960.1|821837_824162_-	S9 family peptidase	NA	NA	NA	NA	NA
AXM38961.1|826070_827162_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
AXM41914.1|827537_828611_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM41915.1|829202_830081_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM41916.1|830269_831154_+	DMT family transporter	NA	NA	NA	NA	NA
AXM38962.1|831429_833202_-	cellulase	NA	NA	NA	NA	NA
AXM38963.1|833610_835311_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
AXM41917.1|836477_837854_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
AXM38964.1|837947_838943_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AXM38965.1|839188_840100_+	magnesium transporter	NA	NA	NA	NA	NA
AXM38966.1|840694_840979_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38967.1|841309_841756_+	autotransporter	NA	NA	NA	NA	NA
AXM38968.1|842019_842988_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	6.6e-100
AXM38969.1|843200_844520_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM38970.1|844936_846610_-	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
AXM38971.1|846634_846841_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41918.1|846863_847649_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
AXM38972.1|848696_849459_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38973.1|849702_850707_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38974.1|850745_851675_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AXM38975.1|852222_855093_-	insulinase family protein	NA	NA	NA	NA	NA
AXM38976.1|855346_857971_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
AXM41919.1|859205_860648_-	endoglucanase	NA	H2DE45	Erwinia_phage	32.3	7.4e-47
AXM38977.1|860855_862343_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.9	1.6e-124
AXM38978.1|863733_865383_+	peptidase M20	NA	NA	NA	NA	NA
AXM38979.1|865310_865571_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38980.1|866156_867392_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 10
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	950097	987747	5026592	tRNA,transposase	Herpes_simplex_virus(33.33%)	22	NA	NA
AXM39037.1|950097_951333_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM39038.1|952064_954755_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM39039.1|954905_957803_+	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
AXM39040.1|960358_961525_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
AXM39041.1|961739_962507_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXM39042.1|962551_963829_+	glucose/galactose MFS transporter	NA	NA	NA	NA	NA
AXM39043.1|963869_964937_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM39044.1|964943_965972_+	SIS domain-containing protein	NA	NA	NA	NA	NA
AXM39045.1|965974_967129_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AXM39046.1|967548_968154_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
AXM39047.1|968150_969404_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
AXM39048.1|969405_971304_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
AXM39049.1|971305_973348_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
AXM39050.1|973972_974203_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41925.1|974664_975630_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM39051.1|975782_977102_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM39052.1|977481_978939_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM39053.1|978967_979177_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39054.1|979290_980505_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
AXM39055.1|982475_983238_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM41926.1|984071_985304_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	K4IEX3	Salmonella_phage	41.7	2.0e-72
AXM39056.1|986949_987747_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 12
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1170963	1218421	5026592	tRNA,transposase	Ralstonia_phage(28.57%)	46	NA	NA
AXM39192.1|1170963_1171726_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM39193.1|1172438_1172624_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39194.1|1172816_1174556_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	54.8	9.9e-179
AXM39195.1|1174699_1174906_+	cellulose biosynthesis protein	NA	NA	NA	NA	NA
AXM39196.1|1174960_1175602_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AXM39197.1|1175603_1175840_+	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
AXM39198.1|1175954_1176419_-	response regulator	NA	NA	NA	NA	NA
AXM39199.1|1176415_1177246_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	38.5	5.8e-12
AXM39200.1|1177583_1178552_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM39201.1|1179974_1180943_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM39202.1|1181142_1182462_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM39203.1|1183789_1184305_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
AXM39204.1|1184400_1185051_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
AXM39205.1|1184996_1185470_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39206.1|1185466_1186045_-	glutamine amidotransferase	NA	NA	NA	NA	NA
AXM39207.1|1187478_1188444_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM39208.1|1189107_1190076_-	transaldolase	NA	NA	NA	NA	NA
AXM39209.1|1190138_1190570_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
AXM39210.1|1190566_1190803_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39211.1|1190996_1191938_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM39212.1|1192029_1193622_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	28.4	1.9e-19
AXM39213.1|1193817_1194381_-	peroxiredoxin	NA	NA	NA	NA	NA
AXM39214.1|1194582_1195428_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AXM39215.1|1195665_1196064_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39216.1|1196107_1196434_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AXM39217.1|1196444_1196822_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39218.1|1197329_1198271_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
AXM39219.1|1198471_1199269_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
AXM39220.1|1199249_1199801_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AXM39221.1|1199797_1200784_-	exodeoxyribonuclease IX	NA	A0A2H4IAS6	Erwinia_phage	27.0	2.8e-13
AXM39222.1|1200780_1201356_-	nitroreductase	NA	NA	NA	NA	NA
AXM39223.1|1201723_1204063_+	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
AXM39224.1|1204208_1205306_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AXM41940.1|1205703_1206189_-	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
AXM39225.1|1206194_1206545_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41941.1|1206541_1207111_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXM41942.1|1207234_1207540_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AXM39226.1|1207536_1209024_+	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
AXM39227.1|1208937_1209736_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM41943.1|1209824_1210004_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39228.1|1209939_1210164_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39229.1|1210278_1210698_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39230.1|1210884_1211439_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
AXM39231.1|1211503_1212589_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
AXM39232.1|1216042_1217740_+	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	33.2	5.3e-28
AXM39233.1|1217947_1218421_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
>prophage 13
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1273454	1415289	5026592	tRNA,transposase	Ralstonia_phage(25.93%)	109	NA	NA
AXM41946.1|1273454_1274513_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM39293.1|1274694_1275458_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM39294.1|1277970_1279056_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.9	4.0e-61
AXM39295.1|1279052_1280123_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	5.7e-60
AXM39296.1|1280130_1280826_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.8e-36
AXM39297.1|1280822_1281272_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
AXM39298.1|1281359_1281542_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41947.1|1281601_1284556_-	glycine dehydrogenase (aminomethyl-transferring)	NA	M4QFZ1	Prochlorococcus_phage	49.8	2.6e-256
AXM39299.1|1285023_1285206_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41948.1|1285636_1286440_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.3	4.5e-25
AXM41949.1|1286528_1287740_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM39300.1|1287736_1289896_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.0	5.7e-35
AXM39301.1|1291237_1291642_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39302.1|1291723_1293742_-	peptidase M2 family protein	NA	NA	NA	NA	NA
AXM39303.1|1293853_1295524_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
AXM41950.1|1295520_1296285_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AXM39304.1|1296384_1298118_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AXM39305.1|1298336_1299053_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.9	1.4e-22
AXM39306.1|1299045_1300338_+	sensor histidine kinase	NA	NA	NA	NA	NA
AXM39307.1|1300489_1300981_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39308.1|1301049_1301307_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
AXM39309.1|1301309_1302119_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
AXM39310.1|1302154_1302895_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
AXM39311.1|1302899_1303496_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM39312.1|1303740_1304937_+	sensor histidine kinase	NA	NA	NA	NA	NA
AXM39313.1|1304936_1305578_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXM39314.1|1305928_1307110_+	polyketide cyclase	NA	NA	NA	NA	NA
AXM39315.1|1307173_1307578_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
AXM39316.1|1307580_1308255_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
AXM39317.1|1308318_1309116_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
AXM39318.1|1309246_1309426_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AXM39319.1|1309422_1309707_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39320.1|1310323_1311526_+	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
AXM39321.1|1311725_1312268_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39322.1|1312543_1313275_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39323.1|1313474_1314353_+	M15 family peptidase	NA	A0A0A0RV08	Bacillus_phage	42.7	2.5e-05
AXM41951.1|1314462_1314723_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
AXM39324.1|1314782_1316264_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39325.1|1316279_1320017_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AXM39326.1|1320013_1320997_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
AXM39327.1|1320993_1321800_+	OmpA family protein	NA	NA	NA	NA	NA
AXM39328.1|1321852_1322926_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AXM39329.1|1323875_1326851_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.8	4.5e-54
AXM39330.1|1326837_1329903_+	DNA repair protein	NA	NA	NA	NA	NA
AXM39331.1|1329955_1330915_-	sulfatase modifying factor 1	NA	NA	NA	NA	NA
AXM41952.1|1330982_1331558_+	DNA repair protein	NA	NA	NA	NA	NA
AXM39332.1|1331610_1332573_-	sulfatase modifying factor 1	NA	NA	NA	NA	NA
AXM41953.1|1332667_1333207_+	DNA repair protein	NA	NA	NA	NA	NA
AXM39333.1|1333420_1334377_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
AXM41954.1|1336965_1338000_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM39334.1|1338789_1339752_-	sulfatase modifying factor 1	NA	A0A7H6	Microcystis_virus	30.5	1.2e-16
AXM39335.1|1342642_1343506_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM39336.1|1343511_1344213_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM39337.1|1344265_1345222_+|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM39338.1|1345771_1347091_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM39339.1|1347303_1348272_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM39340.1|1348356_1348590_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM39341.1|1348822_1350142_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM39342.1|1350341_1351310_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM39343.1|1351849_1356340_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AXM39344.1|1356486_1357806_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM39345.1|1358005_1358974_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXM41955.1|1359111_1359681_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM39346.1|1359677_1362086_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AXM39347.1|1362417_1362879_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39348.1|1363125_1364016_-	pirin family protein	NA	NA	NA	NA	NA
AXM39349.1|1364193_1364463_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41956.1|1364777_1365491_-	endonuclease V	NA	NA	NA	NA	NA
AXM39350.1|1365594_1366344_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AXM41957.1|1366692_1366947_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39351.1|1367087_1367285_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39352.1|1367290_1369348_+	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.4	3.6e-79
AXM41958.1|1371295_1372417_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AXM39353.1|1372431_1373259_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AXM39354.1|1373242_1374526_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AXM39355.1|1374552_1375068_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM39356.1|1375078_1377247_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.6	2.9e-10
AXM41959.1|1377158_1377341_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39357.1|1378847_1379816_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM39358.1|1380515_1380845_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
AXM39359.1|1381334_1384799_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AXM39360.1|1385201_1385744_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXM41960.1|1386155_1387064_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AXM39361.1|1387508_1388219_+	histidine kinase	NA	NA	NA	NA	NA
AXM39362.1|1388346_1389405_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM39363.1|1389526_1390846_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM39364.1|1390916_1391729_-	peptidase C1	NA	NA	NA	NA	NA
AXM39365.1|1392463_1392847_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39366.1|1392960_1393965_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.1	6.4e-98
AXM39367.1|1394339_1395563_+	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.7	2.4e-54
AXM39368.1|1395562_1396465_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39369.1|1396421_1397876_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	41.0	9.0e-93
AXM39370.1|1397855_1398911_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	41.7	8.4e-64
AXM41961.1|1398971_1399784_-	peptidase C1	NA	NA	NA	NA	NA
AXM39371.1|1400299_1400683_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39372.1|1400805_1401810_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	4.9e-98
AXM39373.1|1402000_1402615_-	peptidase C1	NA	NA	NA	NA	NA
AXM39374.1|1402725_1403694_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM39375.1|1404204_1404792_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AXM39376.1|1404909_1405794_+	nitrilase	NA	NA	NA	NA	NA
AXM39377.1|1406979_1408383_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AXM39378.1|1408396_1408903_+	transcriptional repressor	NA	NA	NA	NA	NA
AXM39379.1|1409308_1409767_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM39380.1|1410544_1410748_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39381.1|1412167_1412653_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
AXM39382.1|1412880_1413096_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
AXM39383.1|1413346_1413826_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AXM39384.1|1413957_1414386_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39385.1|1414458_1415289_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
>prophage 14
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1421638	1487642	5026592	transposase	Bacillus_virus(11.76%)	45	NA	NA
AXM39390.1|1421638_1423579_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
AXM39391.1|1423795_1424350_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
AXM39392.1|1424571_1426002_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
AXM39393.1|1426068_1427523_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	5.7e-47
AXM39394.1|1427681_1427930_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39395.1|1427939_1428665_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
AXM39396.1|1428763_1429174_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXM39397.1|1429225_1430182_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.7	2.6e-40
AXM39398.1|1430425_1432807_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM39399.1|1435435_1435846_+	MerC domain-containing protein	NA	NA	NA	NA	NA
AXM39400.1|1436145_1436328_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
AXM39401.1|1436460_1437501_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AXM39402.1|1437573_1439019_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
AXM39403.1|1439145_1440444_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
AXM39404.1|1440700_1441246_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
AXM39405.1|1441242_1442706_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
AXM39406.1|1444168_1444423_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39407.1|1444825_1445359_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
AXM39408.1|1445384_1445786_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39409.1|1445754_1446135_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39410.1|1446131_1446374_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
AXM41963.1|1446402_1447062_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39411.1|1447737_1449642_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
AXM39412.1|1449905_1452302_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
AXM39413.1|1452451_1453174_+	pseudouridine synthase	NA	NA	NA	NA	NA
AXM39414.1|1456093_1456594_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
AXM39415.1|1456535_1458212_+	serine hydrolase	NA	NA	NA	NA	NA
AXM39416.1|1458358_1459624_+	cation:proton antiporter	NA	NA	NA	NA	NA
AXM39417.1|1459682_1460876_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.3	4.0e-22
AXM39418.1|1460872_1461562_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
AXM39419.1|1461667_1463137_+	outer membrane channel protein	NA	NA	NA	NA	NA
AXM39420.1|1463156_1463993_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
AXM39421.1|1464018_1465122_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM39422.1|1465118_1468175_+	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AXM39423.1|1468240_1468831_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AXM39424.1|1468962_1470795_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
AXM41964.1|1471480_1472515_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM39425.1|1473852_1475088_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM39426.1|1476729_1481211_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AXM39427.1|1481216_1481585_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39428.1|1481754_1482723_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM39429.1|1483414_1484371_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	1.1e-41
AXM39430.1|1484249_1484657_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39431.1|1485217_1486537_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM39432.1|1486673_1487642_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
>prophage 15
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1538322	1593133	5026592	tRNA,transposase	Ralstonia_phage(66.67%)	29	NA	NA
AXM39475.1|1538322_1541154_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
AXM39476.1|1541468_1541969_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
AXM39477.1|1542057_1543008_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
AXM39478.1|1543521_1544457_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AXM39479.1|1544456_1546457_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AXM39480.1|1546459_1547086_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AXM39481.1|1547085_1547421_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
AXM41969.1|1547770_1549468_+	M61 family peptidase	NA	NA	NA	NA	NA
AXM39482.1|1549692_1551939_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	4.4e-54
AXM39483.1|1551962_1553582_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39484.1|1558466_1558856_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39485.1|1560231_1560594_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39486.1|1561261_1561414_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39487.1|1561417_1561993_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39488.1|1563563_1563845_+|transposase	transposase	transposase	NA	NA	NA	NA
AXM39489.1|1568919_1569888_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	6.6e-100
AXM39490.1|1569998_1570325_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39491.1|1570317_1570914_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39492.1|1573791_1574589_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM39493.1|1575923_1576892_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXM39494.1|1576943_1577219_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39495.1|1577222_1578185_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM39496.1|1578732_1579470_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39497.1|1579958_1581278_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM39498.1|1583329_1584061_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39499.1|1584088_1586923_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39500.1|1586919_1587849_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM39501.1|1587857_1590620_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.6	6.0e-45
AXM39502.1|1592164_1593133_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
>prophage 16
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1596971	1667208	5026592	plate,protease,transposase	Xanthomonas_phage(40.0%)	46	NA	NA
AXM39506.1|1596971_1597475_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXM39507.1|1597478_1599356_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXM39508.1|1599319_1600330_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXM39509.1|1600362_1603068_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.1e-80
AXM39510.1|1603256_1603754_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39511.1|1603987_1604314_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39512.1|1604701_1605160_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39513.1|1605424_1607362_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
AXM39514.1|1607370_1607910_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39515.1|1607906_1609319_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AXM39516.1|1609315_1610653_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXM39517.1|1610654_1611971_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
AXM39518.1|1611974_1615433_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AXM39519.1|1615429_1616077_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
AXM39520.1|1616073_1616796_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
AXM39521.1|1616792_1619696_+	serine/threonine protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
AXM39522.1|1619692_1620019_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39523.1|1620191_1621220_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AXM39524.1|1621228_1622209_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM39525.1|1622322_1624782_-	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
AXM39526.1|1624778_1625771_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AXM41971.1|1625767_1626475_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXM41972.1|1629507_1632588_-	histidine kinase	NA	NA	NA	NA	NA
AXM39527.1|1633004_1634102_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM39528.1|1634487_1636575_-	type III effector	NA	NA	NA	NA	NA
AXM39529.1|1636946_1637456_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39530.1|1637449_1638406_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
AXM39531.1|1639118_1639697_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM39532.1|1639820_1640933_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM39533.1|1640989_1643578_+	hydrophobe/amphiphile efflux-1 family RND transporter	NA	NA	NA	NA	NA
AXM39534.1|1643660_1645136_+|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	5.4e-101
AXM39535.1|1646198_1650320_-	TAL effector protein PthXo1	NA	NA	NA	NA	NA
AXM39536.1|1650543_1650843_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	89.1	1.2e-44
AXM39537.1|1650846_1651041_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
AXM39538.1|1651309_1655740_-	avirulence protein	NA	NA	NA	NA	NA
AXM39539.1|1655963_1656263_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
AXM39540.1|1656266_1656461_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
AXM39541.1|1656729_1660449_-	avirulence protein	NA	NA	NA	NA	NA
AXM39542.1|1660657_1661362_-	C-type cytochrome biogenesis protein	NA	NA	NA	NA	NA
AXM41973.1|1661361_1661853_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
AXM39543.1|1661852_1662395_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AXM39544.1|1662391_1664380_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
AXM39545.1|1664443_1664914_-	cytochrome c-type biogenesis protein CcmE 1	NA	NA	NA	NA	NA
AXM39546.1|1664910_1665117_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
AXM39547.1|1665113_1665872_-	heme ABC transporter permease	NA	NA	NA	NA	NA
AXM39548.1|1665882_1667208_-|protease	serine protease	protease	A0A217EQY2	Bacillus_phage	39.2	2.4e-23
>prophage 17
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1726662	1736867	5026592	tRNA	Pseudomonas_phage(28.57%)	10	NA	NA
AXM41988.1|1726662_1728339_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
AXM39595.1|1728427_1729069_+	LexA repressor 2	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
AXM39596.1|1729241_1730276_+	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
AXM39597.1|1730324_1730528_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39598.1|1730578_1731067_+	recombination regulator RecX	NA	NA	NA	NA	NA
AXM39599.1|1731168_1733817_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
AXM39600.1|1733956_1734169_+	carbon storage regulator	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
AXM39601.1|1734771_1735299_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	57.4	1.2e-34
AXM41989.1|1735686_1735986_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39602.1|1736171_1736867_+	DNA helicase	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
>prophage 18
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1775727	1839468	5026592	tRNA,transposase	uncultured_Caudovirales_phage(46.15%)	42	NA	NA
AXM39636.1|1775727_1776490_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM39637.1|1776900_1777617_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AXM39638.1|1777856_1778981_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.2	7.8e-44
AXM39639.1|1778980_1779424_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39640.1|1779432_1782675_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
AXM39641.1|1782671_1783148_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AXM39642.1|1783164_1784085_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
AXM39643.1|1784081_1785821_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	27.8	1.3e-42
AXM39644.1|1786367_1787687_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM41996.1|1788077_1788296_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39645.1|1788477_1788855_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39646.1|1789015_1789717_-|transposase	DDE transposase	transposase	A9YX10	Burkholderia_phage	32.9	1.9e-16
AXM39647.1|1792525_1793473_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AXM39648.1|1793726_1794851_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	9.4e-05
AXM39649.1|1795055_1796573_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.7	5.5e-85
AXM39650.1|1796714_1797851_+	two-component system response regulator	NA	NA	NA	NA	NA
AXM39651.1|1797852_1798191_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39652.1|1798215_1800393_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.8	3.0e-47
AXM39653.1|1800404_1801274_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AXM39654.1|1801450_1803133_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.4	3.2e-33
AXM39655.1|1803782_1806551_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
AXM39656.1|1806698_1806947_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXM39657.1|1806943_1807354_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
AXM39658.1|1807419_1810011_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
AXM39659.1|1810364_1811180_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AXM41997.1|1811835_1814079_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AXM39660.1|1814187_1815264_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AXM39661.1|1815260_1815857_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
AXM39662.1|1815853_1816720_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
AXM39663.1|1816973_1819373_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	7.9e-09
AXM41998.1|1819451_1819757_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39664.1|1820017_1820816_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM39665.1|1821664_1822147_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM39666.1|1822282_1823080_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AXM39667.1|1823149_1823332_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39668.1|1823388_1824186_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM39669.1|1824889_1827151_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
AXM39670.1|1827544_1829806_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
AXM39671.1|1830398_1832474_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
AXM41999.1|1833161_1835273_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.2e-14
AXM39672.1|1836003_1838262_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	4.9e-13
AXM39673.1|1838502_1839468_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1862623	1916901	5026592	transposase	Ralstonia_phage(50.0%)	30	NA	NA
AXM39691.1|1862623_1863943_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM39692.1|1864170_1864485_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
AXM39693.1|1864417_1865377_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM39694.1|1865531_1865921_+	type VI secretion protein	NA	NA	NA	NA	NA
AXM39695.1|1870766_1871156_+	type VI secretion protein	NA	NA	NA	NA	NA
AXM39696.1|1871195_1873787_+	avirulence protein	NA	NA	NA	NA	NA
AXM39697.1|1875352_1878115_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.6	3.3e-43
AXM39698.1|1878123_1879053_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM39699.1|1879049_1881887_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39700.1|1881911_1882646_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39701.1|1882663_1885006_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42002.1|1885037_1885769_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39702.1|1885839_1887159_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM42003.1|1887455_1888490_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM39703.1|1888529_1889456_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.5e-93
AXM39704.1|1889539_1891852_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39705.1|1891862_1892831_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM42004.1|1893560_1894697_-	carbohydrate porin	NA	NA	NA	NA	NA
AXM39706.1|1895015_1896758_-	PTS fructose transporter subunit EIIBC	NA	NA	NA	NA	NA
AXM39707.1|1896916_1897873_-	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
AXM39708.1|1897869_1900386_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
AXM39709.1|1900546_1901542_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM39710.1|1902176_1902940_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM39711.1|1903064_1904030_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM39712.1|1905005_1908176_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AXM39713.1|1908188_1909493_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM39714.1|1909507_1910167_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM39715.1|1910444_1915469_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
AXM39716.1|1915736_1915976_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39717.1|1915917_1916901_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	2.0e-96
>prophage 20
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1943583	2004652	5026592	protease,tRNA,transposase	Bacillus_virus(22.22%)	51	NA	NA
AXM39732.1|1943583_1944903_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM39733.1|1945409_1946612_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AXM39734.1|1946608_1948195_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AXM39735.1|1948181_1949693_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39736.1|1949838_1951086_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	9.0e-25
AXM39737.1|1951021_1951384_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
AXM39738.1|1951399_1952230_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AXM42006.1|1952385_1952796_-	hypothetical protein	NA	NA	NA	NA	NA
AXM42007.1|1953050_1954415_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXM39739.1|1954566_1955568_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
AXM39740.1|1955583_1956864_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
AXM39741.1|1956860_1957739_-	CBS domain-containing protein	NA	NA	NA	NA	NA
AXM39742.1|1957833_1958352_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39743.1|1958351_1958837_-	endoribonuclease YbeY	NA	NA	NA	NA	NA
AXM39744.1|1958891_1959554_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39745.1|1959965_1960952_-	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
AXM39746.1|1961375_1962830_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AXM39747.1|1964765_1965752_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
AXM39748.1|1966281_1966926_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AXM39749.1|1966925_1968185_+	cytochrome b	NA	NA	NA	NA	NA
AXM42008.1|1968192_1968936_+	cytochrome c1	NA	NA	NA	NA	NA
AXM39750.1|1969328_1969964_+	stringent starvation protein A	NA	NA	NA	NA	NA
AXM39751.1|1970042_1970483_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
AXM39752.1|1970515_1970842_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39753.1|1971052_1971469_-	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
AXM42009.1|1975961_1976927_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM42010.1|1977507_1978692_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXM42011.1|1979464_1979653_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AXM39754.1|1980137_1980416_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AXM39755.1|1980403_1980694_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXM42012.1|1981295_1981475_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39756.1|1981697_1981832_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39757.1|1981976_1982774_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM39758.1|1983190_1983592_-	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AXM39759.1|1984005_1984356_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39760.1|1984684_1985776_-	ribonuclease D	NA	NA	NA	NA	NA
AXM39761.1|1986047_1987883_+	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
AXM39762.1|1988199_1988946_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM39763.1|1989163_1990426_+	virulence factor	NA	NA	NA	NA	NA
AXM39764.1|1990721_1992059_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	35.8	5.0e-37
AXM39765.1|1992204_1993272_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AXM39766.1|1993296_1994784_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AXM39767.1|1994780_1995281_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AXM39768.1|1995333_1997067_+	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
AXM39769.1|1997204_1999082_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
AXM39770.1|1999081_2000035_+	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
AXM39771.1|2000068_2001040_+	TraB/GumN family protein	NA	NA	NA	NA	NA
AXM42013.1|2001213_2001789_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
AXM39772.1|2001948_2002689_-	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AXM39773.1|2002776_2003676_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AXM39774.1|2003773_2004652_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 21
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	2037064	2096501	5026592	tRNA,transposase	Streptococcus_phage(25.0%)	45	NA	NA
AXM39799.1|2037064_2037863_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM39800.1|2038850_2039819_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM39801.1|2039955_2041275_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM39802.1|2041498_2041987_+	general stress protein	NA	NA	NA	NA	NA
AXM39803.1|2042358_2042622_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39804.1|2043493_2044393_-	M23 family peptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.6e-13
AXM39805.1|2044332_2045682_-	dihydroorotase	NA	NA	NA	NA	NA
AXM39806.1|2045678_2045960_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
AXM39807.1|2046050_2047079_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AXM39808.1|2047221_2048283_+	peptidase S41	NA	NA	NA	NA	NA
AXM39809.1|2048350_2049601_-	MFS transporter	NA	NA	NA	NA	NA
AXM39810.1|2049597_2050035_-	SufE family protein	NA	NA	NA	NA	NA
AXM39811.1|2050532_2051963_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
AXM39812.1|2052133_2052628_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39813.1|2052940_2053966_+	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
AXM39814.1|2054037_2055279_+	argininosuccinate synthase	NA	NA	NA	NA	NA
AXM39815.1|2055520_2055973_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXM39816.1|2055978_2057079_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
AXM39817.1|2057118_2058462_+	acetylglutamate kinase	NA	NA	NA	NA	NA
AXM39818.1|2059074_2060025_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AXM39819.1|2060148_2061444_+	argininosuccinate lyase	NA	NA	NA	NA	NA
AXM39820.1|2061440_2061809_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM39821.1|2061808_2062069_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39822.1|2062082_2063237_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
AXM39823.1|2063415_2064660_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
AXM39824.1|2065027_2066941_+	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
AXM39825.1|2066921_2068187_-	MFS transporter	NA	NA	NA	NA	NA
AXM39826.1|2068407_2068518_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
AXM39827.1|2068896_2069160_-	cytochrome D ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AXM39828.1|2069208_2070309_-	cytochrome D ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AXM42018.1|2070460_2072197_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
AXM39829.1|2072193_2073879_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
AXM39830.1|2074047_2075346_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM42019.1|2075352_2076318_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM39831.1|2077080_2077287_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39832.1|2077329_2077515_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39833.1|2077757_2078000_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39834.1|2078075_2078336_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39835.1|2078840_2079302_-	cytochrome c	NA	NA	NA	NA	NA
AXM39836.1|2079310_2079703_-	cytochrome c	NA	NA	NA	NA	NA
AXM39837.1|2084559_2087031_+	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	21.9	1.2e-47
AXM39838.1|2087070_2087628_+	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AXM39839.1|2087983_2088175_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39840.1|2090424_2093739_-	avirulence protein	NA	NA	NA	NA	NA
AXM39841.1|2095444_2096501_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	2102702	2145077	5026592	tRNA,transposase	uncultured_Mediterranean_phage(28.57%)	29	NA	NA
AXM39847.1|2102702_2103746_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM42022.1|2104025_2104789_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM42023.1|2105404_2106037_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AXM39848.1|2108921_2110043_+	phytase	NA	NA	NA	NA	NA
AXM39849.1|2113734_2114703_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXM39850.1|2116869_2117577_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39851.1|2117647_2117962_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39852.1|2117921_2119418_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AXM39853.1|2119541_2119973_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AXM42024.1|2120152_2121223_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AXM39854.1|2121292_2122438_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
AXM39855.1|2122569_2122923_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AXM39856.1|2123119_2124964_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AXM39857.1|2125058_2126027_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.3	1.4e-28
AXM39858.1|2126107_2126470_-	recombinase	NA	NA	NA	NA	NA
AXM39859.1|2129088_2130477_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM42025.1|2130726_2131911_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
AXM39860.1|2131961_2133023_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM39861.1|2133259_2134579_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM39862.1|2134649_2135291_-	ribonuclease T	NA	NA	NA	NA	NA
AXM39863.1|2135568_2135964_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39864.1|2136096_2136807_-	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AXM39865.1|2136935_2137766_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
AXM39866.1|2137788_2138658_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
AXM39867.1|2138657_2139632_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AXM39868.1|2139744_2140836_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
AXM39869.1|2141021_2142113_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.4	5.1e-48
AXM39870.1|2142230_2143481_-	porin	NA	NA	NA	NA	NA
AXM39871.1|2144314_2145077_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 23
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	2234059	2301554	5026592	protease,transposase	Bacillus_phage(25.0%)	43	NA	NA
AXM39932.1|2234059_2235016_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
AXM39933.1|2235628_2237005_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	7.1e-63
AXM39934.1|2239557_2240736_+	N-acetylmuramoyl-L-alanine amidase	NA	M1IEI0	Bacillus_phage	39.6	1.9e-08
AXM39935.1|2240773_2241694_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
AXM39936.1|2242309_2243677_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	37.9	9.9e-25
AXM39937.1|2243680_2244166_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AXM39938.1|2244201_2245017_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.1	2.1e-30
AXM39939.1|2245013_2245856_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AXM39940.1|2246034_2246415_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AXM39941.1|2246411_2247926_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AXM39942.1|2248084_2248426_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AXM39943.1|2248429_2249053_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39944.1|2249287_2251243_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
AXM42032.1|2251676_2254289_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
AXM42034.1|2254281_2254539_-	hypothetical protein	NA	NA	NA	NA	NA
AXM42033.1|2254548_2256111_+	sodium transporter	NA	A0A240F3J2	Aeromonas_phage	39.5	2.7e-87
AXM39945.1|2256355_2258212_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AXM42035.1|2259538_2261728_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AXM39946.1|2261856_2263635_-	peptidase M14	NA	NA	NA	NA	NA
AXM39947.1|2264836_2265445_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXM39948.1|2265861_2266050_-	hypothetical protein	NA	NA	NA	NA	NA
AXM42036.1|2266233_2266548_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXM39949.1|2266598_2267432_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39950.1|2267498_2267999_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXM42037.1|2268090_2268669_-	hypothetical protein	NA	NA	NA	NA	NA
AXM39951.1|2268830_2269331_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXM39952.1|2270855_2271569_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39953.1|2271820_2272060_+	HTH domain-containing protein	NA	NA	NA	NA	NA
AXM39954.1|2274290_2274539_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39955.1|2274516_2275002_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
AXM39956.1|2275152_2275932_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
AXM39957.1|2276120_2278001_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
AXM39958.1|2278334_2279852_+	fumarate hydratase	NA	NA	NA	NA	NA
AXM39959.1|2280170_2280623_+	glutathione S-transferase	NA	NA	NA	NA	NA
AXM39960.1|2284314_2285289_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
AXM39961.1|2285455_2285689_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39962.1|2289504_2290023_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	40.7	6.8e-27
AXM39963.1|2291756_2293076_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM39964.1|2293126_2293531_-	hypothetical protein	NA	NA	NA	NA	NA
AXM42038.1|2294104_2295229_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	32.3	2.6e-15
AXM39965.1|2295225_2297454_+	peptidase S8 and S53, subtilisin, kexin, sedolisin	NA	NA	NA	NA	NA
AXM39966.1|2297535_2298750_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.2	6.9e-54
AXM39967.1|2300534_2301554_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	2309587	2361714	5026592	transposase	Planktothrix_phage(25.0%)	40	NA	NA
AXM39973.1|2309587_2312548_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
AXM42041.1|2313698_2314461_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM39974.1|2314577_2317973_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
AXM39975.1|2318187_2318568_-	response regulator	NA	NA	NA	NA	NA
AXM39976.1|2319583_2319787_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39977.1|2319829_2320592_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM39978.1|2322229_2322889_-	keto-hydroxyglutarate-aldolase/keto-deoxy- phosphogluconate aldolase	NA	NA	NA	NA	NA
AXM39979.1|2322944_2324861_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AXM39980.1|2324963_2325683_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AXM39981.1|2325679_2326687_-	glucokinase	NA	NA	NA	NA	NA
AXM39982.1|2326683_2328114_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
AXM39983.1|2328548_2329646_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
AXM39984.1|2329774_2330647_-	folate-binding protein	NA	NA	NA	NA	NA
AXM42042.1|2330590_2330857_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
AXM39985.1|2330916_2331312_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
AXM39986.1|2331308_2331695_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
AXM39987.1|2331729_2333520_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AXM39988.1|2333523_2333733_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39989.1|2333749_2334532_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AXM39990.1|2334642_2334891_+	succinate dehydrogenase assembly factor 2 family protein	NA	NA	NA	NA	NA
AXM39991.1|2334841_2335294_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39992.1|2335317_2336559_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
AXM39993.1|2336551_2337286_+	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
AXM39994.1|2337286_2337469_+	hypothetical protein	NA	NA	NA	NA	NA
AXM39995.1|2338679_2339645_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM39996.1|2339898_2342307_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
AXM39997.1|2342335_2342998_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
AXM39998.1|2343001_2343466_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXM39999.1|2343462_2345232_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
AXM40000.1|2345228_2346269_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AXM40001.1|2346560_2347340_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AXM42043.1|2347336_2347801_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AXM40002.1|2347743_2349243_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40003.1|2349239_2351096_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
AXM40004.1|2351095_2351728_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AXM40005.1|2352202_2352709_-	glyoxalase	NA	NA	NA	NA	NA
AXM42044.1|2352875_2353862_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	4.0e-36
AXM42045.1|2353825_2355010_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
AXM40006.1|2360824_2361496_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
AXM40007.1|2361492_2361714_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 25
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	2372429	2380077	5026592		Xanthomonas_phage(80.0%)	13	NA	NA
AXM40015.1|2372429_2372615_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
AXM40016.1|2372614_2372818_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
AXM40017.1|2372953_2374027_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
AXM40018.1|2374131_2374431_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
AXM40019.1|2374794_2375034_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42046.1|2375140_2376625_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
AXM40020.1|2376626_2376947_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
AXM40021.1|2376943_2378128_+	zonular occludens toxin family protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	2.3e-54
AXM40022.1|2378182_2378353_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	2.5e-10
AXM40023.1|2378416_2378818_+	DUF4124 domain-containing protein	NA	A0A077JCA3	Xanthomonas_phage	64.3	3.9e-38
AXM40024.1|2378757_2379072_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.7	8.1e-15
AXM40025.1|2379461_2379722_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40026.1|2379720_2380077_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.2	1.5e-17
>prophage 26
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	2509600	2546779	5026592	transposase	Bacillus_virus(33.33%)	29	NA	NA
AXM42059.1|2509600_2510566_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM40113.1|2510586_2511390_-	amidohydrolase	NA	NA	NA	NA	NA
AXM40114.1|2511529_2512678_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AXM40115.1|2512904_2513549_+	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
AXM40116.1|2513545_2514241_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
AXM40117.1|2514335_2515088_+	heme ABC transporter permease	NA	NA	NA	NA	NA
AXM40118.1|2515084_2515255_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
AXM40119.1|2515251_2515722_+	cytochrome c biogenesis protein CcmE	NA	NA	NA	NA	NA
AXM42060.1|2515890_2517828_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
AXM40120.1|2517820_2518423_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AXM42061.1|2518440_2518851_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
AXM40121.1|2518844_2519864_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AXM40122.1|2520153_2522025_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
AXM40123.1|2522021_2522321_-	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
AXM40124.1|2522355_2523774_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXM40125.1|2523982_2525224_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
AXM40126.1|2525372_2525960_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AXM40127.1|2526096_2527578_+	amino acid permease	NA	NA	NA	NA	NA
AXM40128.1|2527654_2529085_+	amino acid permease	NA	NA	NA	NA	NA
AXM40129.1|2529173_2529851_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
AXM40130.1|2529862_2530429_+	acireductone dioxygenase	NA	NA	NA	NA	NA
AXM40131.1|2530431_2531130_+	acireductone synthase	NA	NA	NA	NA	NA
AXM40132.1|2531455_2532541_+	peptidase C13	NA	NA	NA	NA	NA
AXM42062.1|2535184_2536504_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM40133.1|2536716_2537685_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM40134.1|2538558_2539716_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
AXM42063.1|2539992_2540958_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM40135.1|2542529_2543849_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM40136.1|2545543_2546779_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 27
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	2664226	2781440	5026592	tRNA,transposase	Xanthomonas_phage(10.0%)	74	NA	NA
AXM40229.1|2664226_2665189_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM40230.1|2666783_2667044_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40231.1|2667239_2668559_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM40232.1|2668602_2669142_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AXM40233.1|2673508_2673835_-	sel1 repeat family protein	NA	NA	NA	NA	NA
AXM42072.1|2673828_2674794_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM40234.1|2674841_2675036_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40235.1|2680830_2685801_-	glutamate synthase	NA	NA	NA	NA	NA
AXM40236.1|2686605_2688081_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.3e-99
AXM40237.1|2689632_2693235_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AXM40238.1|2693503_2693698_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
AXM40239.1|2693701_2694001_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
AXM40240.1|2694224_2697980_+	avirulence protein	NA	NA	NA	NA	NA
AXM42073.1|2698053_2698149_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40241.1|2699349_2700363_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM40242.1|2700462_2701059_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AXM40243.1|2701110_2702079_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM40244.1|2702291_2703611_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM40245.1|2704050_2704848_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40246.1|2704998_2706348_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
AXM40247.1|2706354_2707119_+	energy transducer TonB	NA	NA	NA	NA	NA
AXM42074.1|2707479_2707947_+	energy transducer TonB	NA	NA	NA	NA	NA
AXM42075.1|2708133_2709235_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.6e-36
AXM40248.1|2711252_2712218_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM40249.1|2716055_2717255_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AXM40250.1|2717403_2717586_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
AXM42076.1|2719439_2720624_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXM40251.1|2721687_2722653_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM40252.1|2722653_2723407_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40253.1|2724111_2725326_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
AXM40254.1|2725597_2726566_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.5e-99
AXM40255.1|2726750_2727986_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXM40256.1|2728038_2728806_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AXM40257.1|2730033_2732562_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	3.1e-64
AXM40258.1|2733128_2734574_-	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
AXM42077.1|2734527_2734752_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40259.1|2734945_2735086_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXM42078.1|2735085_2736234_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXM40260.1|2736355_2737351_+	methyltransferase domain-containing protein	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
AXM40261.1|2737347_2738487_+	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
AXM40262.1|2738629_2741383_+	methionine synthase	NA	NA	NA	NA	NA
AXM40263.1|2741769_2742975_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
AXM40264.1|2742971_2744030_-	carbohydrate kinase	NA	NA	NA	NA	NA
AXM40265.1|2743954_2745265_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AXM42079.1|2745278_2746454_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM40266.1|2746594_2747440_-	transporter	NA	NA	NA	NA	NA
AXM40267.1|2747773_2748526_-	DUF2058 family protein	NA	NA	NA	NA	NA
AXM40268.1|2748526_2748763_-	protein SlyX	NA	NA	NA	NA	NA
AXM40269.1|2748755_2750105_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.6	1.4e-79
AXM40270.1|2750130_2751096_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXM40271.1|2751187_2751745_-	glutathione peroxidase	NA	NA	NA	NA	NA
AXM40272.1|2751880_2752129_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40273.1|2752131_2752494_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXM40274.1|2752490_2753366_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
AXM40275.1|2753362_2754349_+	ABC transporter permease	NA	NA	NA	NA	NA
AXM40276.1|2754358_2755189_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40277.1|2755502_2755736_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40278.1|2755821_2756244_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42080.1|2756366_2757770_-	class II fumarate hydratase	NA	NA	NA	NA	NA
AXM40279.1|2759221_2759985_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40280.1|2763007_2764375_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
AXM40281.1|2764621_2765122_+	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
AXM42081.1|2765401_2765665_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
AXM40282.1|2766002_2767499_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM40283.1|2767495_2768428_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM40284.1|2768608_2771437_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
AXM40285.1|2771479_2772682_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AXM40286.1|2772923_2774360_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
AXM40287.1|2774565_2775159_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
AXM42082.1|2775426_2776020_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
AXM40288.1|2776016_2777786_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
AXM40289.1|2778124_2778730_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM40290.1|2778859_2779786_+	multidrug transporter	NA	NA	NA	NA	NA
AXM40291.1|2780120_2781440_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 28
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	2805929	2873554	5026592	protease,coat,transposase	Bacillus_virus(25.0%)	56	NA	NA
AXM40309.1|2805929_2806692_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40310.1|2806689_2807424_-	class A beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AXM40311.1|2807474_2809055_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AXM40312.1|2809061_2810255_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM40313.1|2810265_2811783_-	multidrug RND transporter	NA	NA	NA	NA	NA
AXM40314.1|2811779_2812220_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXM40315.1|2812341_2813193_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXM40316.1|2813253_2815497_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	5.0e-82
AXM40317.1|2815952_2816489_-	bacterioferritin	NA	NA	NA	NA	NA
AXM42085.1|2816584_2819002_+	penicillin acylase family protein	NA	NA	NA	NA	NA
AXM40318.1|2819934_2820288_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40319.1|2820381_2822508_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AXM40320.1|2822510_2822723_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40321.1|2822884_2823991_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
AXM40322.1|2824059_2825754_-	asparagine synthase B	NA	E5ERH5	Ostreococcus_lucimarinus_virus	38.6	2.5e-86
AXM40323.1|2826048_2827179_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AXM40324.1|2827183_2827684_-	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	41.7	2.3e-27
AXM40325.1|2827680_2828037_-	arsenate reductase	NA	NA	NA	NA	NA
AXM40326.1|2828499_2829696_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AXM40327.1|2829712_2832322_-	bifunctional uridylyltransferase/uridylyl-removing protein	NA	NA	NA	NA	NA
AXM40328.1|2832318_2833095_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AXM40329.1|2833387_2833939_+	SCPU domain-containing protein	NA	NA	NA	NA	NA
AXM40330.1|2833947_2834718_+	molecular chaperone	NA	NA	NA	NA	NA
AXM40331.1|2834734_2837086_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AXM40332.1|2837082_2838117_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AXM40333.1|2838163_2838496_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40334.1|2838498_2839224_+	molecular chaperone	NA	NA	NA	NA	NA
AXM40335.1|2839615_2840419_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
AXM40336.1|2840588_2841467_+	elongation factor Ts	NA	NA	NA	NA	NA
AXM40337.1|2841594_2841972_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
AXM40338.1|2842028_2842751_+	UMP kinase	NA	NA	NA	NA	NA
AXM40339.1|2842931_2843489_+	ribosome recycling factor	NA	NA	NA	NA	NA
AXM40340.1|2843506_2844268_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
AXM40341.1|2844264_2845092_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AXM40342.1|2845094_2846285_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AXM40343.1|2846311_2847658_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AXM40344.1|2847654_2850108_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AXM40345.1|2850230_2851028_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40346.1|2851359_2852373_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AXM40347.1|2852369_2852831_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AXM40348.1|2852854_2853646_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AXM42086.1|2853684_2854941_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AXM40349.1|2854937_2855678_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.2e-24
AXM40350.1|2856135_2859726_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	2.0e-181
AXM40351.1|2859901_2860861_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
AXM40352.1|2861700_2863881_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM40353.1|2863880_2864618_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	4.5e-08
AXM40354.1|2864614_2866027_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
AXM40355.1|2865963_2867307_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
AXM40356.1|2867307_2867793_+|transposase	IS5/IS1182 family transposase	transposase	K4I1H9	Acidithiobacillus_phage	58.5	1.9e-34
AXM40357.1|2868128_2868395_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42087.1|2868472_2868919_-	CopD family protein	NA	NA	NA	NA	NA
AXM40358.1|2868992_2869595_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM42088.1|2869762_2871079_+	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
AXM40359.1|2871551_2872115_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40360.1|2872588_2873554_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 29
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	2879168	2930033	5026592	tRNA,transposase	Acidithiobacillus_phage(12.5%)	46	NA	NA
AXM40363.1|2879168_2880545_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.7e-75
AXM40364.1|2880664_2881879_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.7	1.4e-54
AXM42090.1|2883528_2884203_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
AXM40365.1|2884207_2884984_+	VUT family protein	NA	R4TNY5	Halovirus	27.2	1.9e-09
AXM40366.1|2886256_2888194_+	DUF885 family protein	NA	NA	NA	NA	NA
AXM40367.1|2888375_2889353_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AXM40368.1|2889349_2890747_-	S-methylmethionine permease	NA	NA	NA	NA	NA
AXM40369.1|2891024_2892077_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	41.7	3.4e-65
AXM40370.1|2892840_2893290_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
AXM40371.1|2893514_2895599_+|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
AXM40372.1|2895795_2896392_+	HAD family hydrolase	NA	NA	NA	NA	NA
AXM40373.1|2896393_2896822_+	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
AXM40374.1|2897034_2897217_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40375.1|2897440_2898223_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40376.1|2898308_2898677_+	DUF4345 domain-containing protein	NA	NA	NA	NA	NA
AXM40377.1|2898735_2899299_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXM40378.1|2899283_2900129_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42091.1|2900354_2901353_+	acyl-CoA desaturase	NA	G4YAW5	Emiliania_huxleyi_virus	30.6	2.3e-18
AXM40379.1|2901349_2902600_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXM40380.1|2902524_2903484_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
AXM40381.1|2903480_2904776_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	3.9e-39
AXM40382.1|2904772_2905318_+	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
AXM40383.1|2905314_2906097_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
AXM40384.1|2906114_2907185_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM40385.1|2907347_2907695_-	RidA family protein	NA	NA	NA	NA	NA
AXM40386.1|2908675_2911240_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
AXM40387.1|2911863_2913234_-	virulence factor family protein	NA	NA	NA	NA	NA
AXM40388.1|2913303_2913498_-	oxidoreductase-like protein	NA	NA	NA	NA	NA
AXM40389.1|2913557_2914166_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40390.1|2914201_2914804_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AXM40391.1|2915077_2915533_-	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
AXM40392.1|2915748_2915925_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40393.1|2915973_2916081_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXM40394.1|2916095_2917307_-	MFS transporter	NA	NA	NA	NA	NA
AXM40395.1|2917527_2918646_+	alkene reductase	NA	NA	NA	NA	NA
AXM40396.1|2918716_2919094_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42092.1|2919536_2919827_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40397.1|2920115_2920451_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
AXM40398.1|2920565_2921615_+	cation transporter	NA	NA	NA	NA	NA
AXM40399.1|2921862_2923098_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM40400.1|2923273_2923747_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXM40401.1|2923886_2925263_+	heat-shock protein Hsp70	NA	NA	NA	NA	NA
AXM40402.1|2925452_2925638_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40403.1|2926617_2927416_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40404.1|2927532_2928852_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM40405.1|2929064_2930033_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
>prophage 30
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	3058564	3141686	5026592	transposase,tRNA,protease	Bacillus_phage(20.0%)	55	NA	NA
AXM40492.1|3058564_3059392_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXM40493.1|3059680_3060637_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM40494.1|3060746_3060917_-	hypothetical protein	NA	NA	NA	NA	NA
AXM42100.1|3061619_3062003_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40495.1|3062908_3064153_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM40496.1|3064149_3064428_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40497.1|3064505_3064907_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40498.1|3064960_3065188_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40499.1|3065189_3065561_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
AXM40500.1|3066544_3068008_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
AXM40501.1|3068143_3070486_+	alpha-mannosidase	NA	NA	NA	NA	NA
AXM40502.1|3070765_3072607_+	beta-galactosidase	NA	NA	NA	NA	NA
AXM42101.1|3072656_3075188_-	type III secretion system effector protein XopK	NA	NA	NA	NA	NA
AXM40503.1|3075805_3076006_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40504.1|3076063_3076384_-	R body protein RebB-like protein	NA	NA	NA	NA	NA
AXM40505.1|3076763_3077867_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
AXM42102.1|3078008_3079967_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40506.1|3080076_3080808_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AXM40507.1|3080804_3081869_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
AXM40508.1|3086517_3087837_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM42103.1|3087969_3089052_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM40509.1|3089063_3089687_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM40510.1|3089937_3090414_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM40511.1|3090447_3091650_-	chemotaxis protein	NA	NA	NA	NA	NA
AXM40512.1|3091657_3098584_-	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
AXM40513.1|3098697_3100734_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
AXM40514.1|3100773_3101304_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM40515.1|3101303_3101666_-	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
AXM42104.1|3101683_3102085_-	response regulator	NA	NA	NA	NA	NA
AXM40516.1|3102334_3103285_+	glutathione synthase	NA	NA	NA	NA	NA
AXM40517.1|3103281_3104157_+	energy transducer TonB	NA	NA	NA	NA	NA
AXM42105.1|3104450_3105401_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.5	1.5e-64
AXM40518.1|3105363_3106083_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AXM40519.1|3106096_3108124_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
AXM40520.1|3108323_3108848_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40521.1|3108861_3111306_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
AXM40522.1|3111547_3113650_+	glycosyltransferase	NA	NA	NA	NA	NA
AXM42106.1|3113982_3115425_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40523.1|3115756_3117943_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
AXM40524.1|3118232_3118313_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
AXM40525.1|3118396_3119296_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
AXM40526.1|3119292_3120045_+	pyrroloquinoline-quinone synthase	NA	NA	NA	NA	NA
AXM40527.1|3120041_3120320_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
AXM40528.1|3120316_3121435_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
AXM40529.1|3121497_3122010_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40530.1|3122438_3123953_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
AXM40531.1|3125394_3128049_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM40532.1|3128269_3132391_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
AXM40533.1|3132492_3133038_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
AXM40534.1|3133594_3135391_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.5	1.5e-81
AXM40535.1|3135529_3136027_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40536.1|3136105_3136510_+	response regulator	NA	NA	NA	NA	NA
AXM40537.1|3137140_3137815_-	7-cyano-7-deazaguanine synthase	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
AXM40538.1|3139636_3140399_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40539.1|3140450_3141686_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 31
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	3155736	3217461	5026592	tRNA,transposase	Ralstonia_phage(33.33%)	39	NA	NA
AXM40555.1|3155736_3157503_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AXM40556.1|3157660_3158437_+	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
AXM40557.1|3158934_3159228_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AXM40558.1|3159668_3160907_+	MFS transporter	NA	NA	NA	NA	NA
AXM40559.1|3163490_3165047_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40560.1|3166434_3167829_+	DNA repair protein RadA	NA	NA	NA	NA	NA
AXM40561.1|3170799_3173355_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	5.0e-30
AXM40562.1|3173611_3176446_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40563.1|3176492_3177255_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40564.1|3177288_3178026_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42107.1|3178521_3180729_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	26.9	6.9e-28
AXM40565.1|3180670_3181576_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM40566.1|3184281_3185238_+|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM40567.1|3185528_3186545_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40568.1|3186612_3188448_-	transmembrane repetitive protein	NA	NA	NA	NA	NA
AXM40569.1|3188461_3189061_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
AXM40570.1|3189148_3189505_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AXM40571.1|3189501_3189924_+	energy transducer TonB	NA	NA	NA	NA	NA
AXM40572.1|3189939_3190173_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AXM42108.1|3190223_3190460_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AXM40573.1|3190808_3192593_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AXM40574.1|3192625_3193612_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AXM40575.1|3194022_3197730_+	ribonuclease E/G	NA	NA	NA	NA	NA
AXM40576.1|3198255_3199019_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40577.1|3199122_3199770_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXM40578.1|3199991_3200753_-	sulfurtransferase	NA	NA	NA	NA	NA
AXM40579.1|3200852_3201218_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40580.1|3201276_3201708_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXM40581.1|3201719_3202982_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
AXM40582.1|3202965_3204258_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
AXM40583.1|3204627_3205398_+	phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AXM40584.1|3205607_3205826_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40585.1|3205735_3206950_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
AXM40586.1|3207096_3207860_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40587.1|3208330_3209566_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM42109.1|3210864_3211122_-	stress-induced protein	NA	NA	NA	NA	NA
AXM40588.1|3211561_3212545_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	3.3e-99
AXM40589.1|3212860_3213829_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
AXM40590.1|3216498_3217461_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 32
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	3285862	3366534	5026592	holin,plate,integrase,head,tRNA,tail,terminase,transposase,capsid,portal	Stenotrophomonas_phage(53.66%)	83	3324176:3324222	3366611:3366657
AXM40633.1|3285862_3286661_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40634.1|3286803_3287830_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM42111.1|3289343_3289880_+	hypothetical protein	NA	A0A2I2L3Z7	Orpheovirus	33.8	4.0e-14
AXM42112.1|3292670_3293753_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM40635.1|3293870_3294851_-	TraB/GumN family protein	NA	NA	NA	NA	NA
AXM40636.1|3294960_3295422_-	cupin domain-containing protein	NA	A0A291AU44	Pandoravirus	40.0	6.3e-16
AXM42113.1|3295456_3296248_-	glycosyltransferase	NA	NA	NA	NA	NA
AXM40637.1|3296255_3297050_-	polysaccharide pyruvyl transferase family protein	NA	A0A1V0SAR6	Catovirus	36.0	6.0e-22
AXM40638.1|3297086_3298283_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AXM40639.1|3298347_3299841_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AXM40640.1|3299858_3300908_-	glycosyltransferase	NA	NA	NA	NA	NA
AXM40641.1|3300904_3302047_-	GDP-mannose:cellobiosyl-diphosphopolyprenol alpha-mannosyltransferase	NA	NA	NA	NA	NA
AXM42114.1|3302114_3303191_-	polysaccharide biosynthesis protein GumF	NA	NA	NA	NA	NA
AXM40642.1|3303207_3304299_-	polysaccharide biosynthesis protein GumF	NA	NA	NA	NA	NA
AXM40643.1|3304295_3305597_-	polysaccharide biosynthesis protein GumE	NA	NA	NA	NA	NA
AXM40644.1|3305679_3307134_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
AXM40645.1|3307377_3308817_-	polysaccharide biosynthesis protein GumC	NA	NA	NA	NA	NA
AXM42115.1|3308798_3309440_-	polysaccharide export protein	NA	NA	NA	NA	NA
AXM40646.1|3310105_3310462_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AXM40647.1|3310442_3310742_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.7e-12
AXM40648.1|3310763_3313142_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AXM40649.1|3313250_3314246_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.0	1.0e-31
AXM40650.1|3314500_3314860_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AXM40651.1|3314870_3315068_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AXM40652.1|3315316_3315859_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.2	1.5e-13
AXM40653.1|3315907_3317812_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.7	2.0e-124
AXM40654.1|3319492_3319687_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40655.1|3319879_3321115_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM40656.1|3321424_3323446_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AXM40657.1|3323584_3324127_+	prepilin-type cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
3324176:3324222	attL	TTGGCGCCCGAAGTTGGACTCGAACCAACGACCCCCTGATTAACAGT	NA	NA	NA	NA
AXM40658.1|3325201_3325933_-	hypothetical protein	NA	NA	NA	NA	NA
AXM42116.1|3326069_3327053_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	1.7e-98
AXM40659.1|3327126_3329961_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40660.1|3329957_3330884_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM40661.1|3332636_3334016_+	SIR2 family protein	NA	NA	NA	NA	NA
AXM40662.1|3334099_3334303_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40663.1|3334299_3334740_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40664.1|3334853_3335564_-	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	76.5	9.2e-107
AXM40665.1|3335481_3335727_-	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	4.1e-14
AXM40666.1|3335752_3336775_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.5	1.5e-139
AXM40667.1|3336774_3338559_-|terminase	terminase	terminase	V9IQL5	Stenotrophomonas_phage	75.6	4.7e-269
AXM40668.1|3338680_3339523_+|capsid	phage capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.9	1.5e-68
AXM40669.1|3339569_3340586_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.5	5.5e-137
AXM40670.1|3340589_3341309_+|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
AXM40671.1|3341408_3341876_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
AXM40672.1|3341875_3342085_+|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	58.0	3.5e-14
AXM40673.1|3342089_3342446_+	hypothetical protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
AXM40674.1|3342438_3342714_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
AXM40675.1|3342710_3343352_+	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.9e-49
AXM40676.1|3343351_3343840_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	51.4	4.2e-26
AXM40677.1|3343836_3344256_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	63.7	3.7e-39
AXM40678.1|3344243_3344690_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	56.1	4.1e-36
AXM40679.1|3345181_3346351_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40680.1|3346481_3347372_+|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	52.7	2.0e-82
AXM40681.1|3347364_3347910_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.0	1.2e-50
AXM40682.1|3347919_3349425_+|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	48.6	1.3e-54
AXM40683.1|3349432_3350011_+|tail	phage tail protein	tail	NA	NA	NA	NA
AXM40684.1|3350071_3350635_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	43.7	9.1e-25
AXM40685.1|3350631_3350991_+|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.1	1.9e-36
AXM40686.1|3351002_3352169_+|tail	phage tail protein	tail	E5FFG9	Burkholderia_phage	64.3	1.2e-135
AXM40687.1|3352199_3352709_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
AXM40688.1|3352754_3353057_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	70.1	2.0e-26
AXM40689.1|3353065_3353179_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
AXM40690.1|3353211_3356082_+|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	49.8	1.8e-206
AXM40691.1|3356094_3356496_+	oxidoreductase	NA	V9IQX3	Stenotrophomonas_phage	62.9	1.0e-38
AXM40692.1|3356492_3357479_+	phage late control D family protein	NA	E5E3U4	Burkholderia_phage	53.1	4.7e-93
AXM40693.1|3358086_3358518_-	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	36.4	1.5e-11
AXM40694.1|3358590_3358851_+	DNA-binding protein	NA	NA	NA	NA	NA
AXM42117.1|3358853_3359171_+	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	59.8	3.9e-25
AXM40695.1|3359183_3359462_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40696.1|3359458_3359671_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42118.1|3359703_3362364_+	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	70.5	0.0e+00
AXM40697.1|3362687_3362906_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40698.1|3362902_3363181_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40699.1|3363170_3363443_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40700.1|3363633_3363942_+	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	48.6	6.1e-15
AXM40701.1|3363934_3364117_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40702.1|3364109_3364382_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42119.1|3364378_3364603_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40703.1|3364599_3364872_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40704.1|3364868_3365078_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40705.1|3365074_3365293_+	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	55.9	2.3e-16
AXM40706.1|3365292_3366534_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.9	4.8e-119
3366611:3366657	attR	TTGGCGCCCGAAGTTGGACTCGAACCAACGACCCCCTGATTAACAGT	NA	NA	NA	NA
>prophage 33
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	3414052	3475357	5026592	protease,tRNA,transposase	Burkholderia_virus(12.5%)	51	NA	NA
AXM40747.1|3414052_3414816_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40748.1|3415839_3418206_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXM42122.1|3418202_3418877_-	methylamine utilization protein	NA	NA	NA	NA	NA
AXM40749.1|3419086_3420025_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
AXM40750.1|3420147_3421497_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AXM40751.1|3421493_3422381_-	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AXM40752.1|3422700_3423507_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AXM40753.1|3423952_3425170_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AXM40754.1|3425275_3426244_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	1.1e-09
AXM40755.1|3426572_3427241_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AXM40756.1|3427237_3428011_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AXM42123.1|3428584_3430651_-	ferrous iron transporter B	NA	NA	NA	NA	NA
AXM40757.1|3431217_3432243_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXM40758.1|3432327_3433401_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
AXM40759.1|3433393_3434497_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
AXM40760.1|3434507_3435434_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AXM40761.1|3435514_3436165_+	SCO family protein	NA	NA	NA	NA	NA
AXM40762.1|3436161_3437010_+	phosphatidylserine decarboxylase proenzyme	NA	NA	NA	NA	NA
AXM40763.1|3437560_3439144_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
AXM42124.1|3439063_3439249_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40764.1|3441316_3442273_-|transposase	IS30 family transposase IS1112b	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
AXM40765.1|3442802_3443024_-	hypothetical protein	NA	NA	NA	NA	NA
AXM42125.1|3443200_3443707_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
AXM40766.1|3443828_3445229_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AXM40767.1|3445491_3446067_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
AXM40768.1|3446063_3446498_+	HIT family protein	NA	NA	NA	NA	NA
AXM40769.1|3446525_3446693_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40770.1|3447281_3447467_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40771.1|3447501_3448071_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
AXM40772.1|3448163_3449015_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AXM40773.1|3450402_3452418_+	M13 family peptidase	NA	NA	NA	NA	NA
AXM40774.1|3452688_3453387_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXM40775.1|3453427_3453835_-	cysteine methyltransferase	NA	NA	NA	NA	NA
AXM40776.1|3454272_3455235_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM40777.1|3456527_3457778_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXM40778.1|3457785_3459030_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
AXM40779.1|3459257_3459737_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXM42126.1|3459847_3460384_+	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
AXM40780.1|3460493_3461243_+	NlpC/P60 family protein	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
AXM40781.1|3461450_3461942_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AXM40782.1|3463055_3464375_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AXM40783.1|3464518_3466225_+	alkaline phosphatase	NA	NA	NA	NA	NA
AXM40784.1|3466258_3467563_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AXM40785.1|3467594_3467855_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AXM40786.1|3467856_3468732_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
AXM42127.1|3470566_3471031_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
AXM40787.1|3471082_3471271_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40788.1|3471243_3471564_-	hypothetical protein	NA	NA	NA	NA	NA
AXM42128.1|3471560_3472928_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AXM40789.1|3473073_3473655_+	ribosome-associated protein	NA	NA	NA	NA	NA
AXM40790.1|3473911_3475357_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 34
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	3483452	3555128	5026592	tRNA,transposase	Ralstonia_phage(33.33%)	54	NA	NA
AXM40795.1|3483452_3484250_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40796.1|3484549_3487663_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM40797.1|3489078_3489549_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AXM40798.1|3490103_3490313_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
AXM40799.1|3490638_3491754_-	J domain-containing protein	NA	NA	NA	NA	NA
AXM40800.1|3491765_3492182_-	ribosome silencing factor	NA	NA	NA	NA	NA
AXM40801.1|3492238_3493138_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AXM40802.1|3493134_3494163_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AXM40803.1|3494185_3494821_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40804.1|3495334_3497977_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.8	3.6e-172
AXM40805.1|3498049_3498661_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
AXM40806.1|3498865_3499723_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
AXM40807.1|3499978_3500428_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AXM42130.1|3500727_3501693_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM40808.1|3501817_3502580_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40809.1|3502637_3502826_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40810.1|3503190_3503484_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40811.1|3503957_3504191_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
AXM40812.1|3504224_3505238_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXM40813.1|3505205_3505397_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40814.1|3505487_3506807_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM40815.1|3506894_3508109_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
AXM40816.1|3508809_3509778_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM40817.1|3509938_3510904_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM40818.1|3511144_3511907_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40819.1|3512209_3514342_+	glycogen debranching enzyme GlgX	NA	NA	NA	NA	NA
AXM40820.1|3514892_3515861_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM42131.1|3516005_3516971_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM40821.1|3516936_3517350_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AXM40822.1|3517346_3518110_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40823.1|3518981_3519779_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40824.1|3519812_3520205_-	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AXM40825.1|3520295_3520688_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40826.1|3524683_3524908_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40827.1|3525172_3526957_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
AXM40828.1|3527147_3527348_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AXM40829.1|3527883_3528678_+	thiazole synthase	NA	NA	NA	NA	NA
AXM40830.1|3528670_3528964_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40831.1|3528979_3529738_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AXM40832.1|3529813_3531676_+	SLC13 family permease	NA	NA	NA	NA	NA
AXM42132.1|3531733_3532075_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AXM40833.1|3532334_3532610_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42133.1|3532748_3534125_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.1e-76
AXM40834.1|3535657_3536371_+	FAA hydrolase family protein	NA	NA	NA	NA	NA
AXM40835.1|3536431_3536854_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
AXM40836.1|3536985_3537749_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM40837.1|3540822_3541734_-	RNA methyltransferase	NA	NA	NA	NA	NA
AXM42134.1|3542249_3542387_-	acetyltransferase	NA	NA	NA	NA	NA
AXM42135.1|3543081_3544047_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM40838.1|3544926_3547596_-	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	48.3	1.8e-240
AXM40839.1|3547947_3551073_-	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	22.8	7.0e-74
AXM40840.1|3551069_3552140_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM40841.1|3552640_3553609_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM40842.1|3553808_3555128_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 35
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	3584853	3659288	5026592	plate,protease,transposase	Tupanvirus(11.11%)	51	NA	NA
AXM42136.1|3584853_3585855_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM40867.1|3586881_3588987_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.1	5.1e-137
AXM40868.1|3589348_3589537_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42137.1|3589812_3591051_+	type III secretion system effector protein	NA	NA	NA	NA	NA
AXM40869.1|3591278_3593420_-	outer protein P	NA	NA	NA	NA	NA
AXM40870.1|3594252_3594978_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXM40871.1|3595109_3595571_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40872.1|3597685_3599806_-	S9 family peptidase	NA	NA	NA	NA	NA
AXM40873.1|3600072_3600918_-	transporter	NA	NA	NA	NA	NA
AXM40874.1|3601174_3601537_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40875.1|3602042_3604013_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
AXM40876.1|3604441_3605839_+|protease	serine protease	protease	NA	NA	NA	NA
AXM42138.1|3605951_3606770_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
AXM42139.1|3607080_3610278_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	1.7e-80
AXM42140.1|3610318_3610501_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40877.1|3610513_3611932_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
AXM42141.1|3611941_3612544_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
AXM40878.1|3612593_3613199_-	LexA repressor 1	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
AXM40879.1|3613348_3613570_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXM40880.1|3613579_3614005_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	44.0	1.5e-08
AXM40881.1|3614399_3614597_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40882.1|3615520_3616300_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AXM40883.1|3616514_3617144_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM40884.1|3617204_3617960_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40885.1|3618288_3619065_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40886.1|3619037_3619304_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40887.1|3619473_3621048_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AXM40888.1|3621296_3621563_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40889.1|3622833_3623790_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
AXM40890.1|3625208_3626678_-	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	33.6	9.3e-29
AXM40891.1|3626682_3627405_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40892.1|3628104_3630486_-	restriction endonuclease	NA	NA	NA	NA	NA
AXM40893.1|3630564_3630873_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXM40894.1|3630879_3631143_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40895.1|3631452_3634926_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	21.9	1.9e-08
AXM40896.1|3635065_3636064_+	Abi family protein	NA	NA	NA	NA	NA
AXM40897.1|3636110_3637655_+	SAM-dependent methyltransferase	NA	A0A220A2U5	Liberibacter_phage	24.2	1.2e-13
AXM40898.1|3637632_3639138_+	hypothetical protein	NA	NA	NA	NA	NA
AXM40899.1|3639171_3639480_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXM42142.1|3639486_3639750_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40900.1|3640481_3641237_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AXM40901.1|3641530_3642553_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40902.1|3642562_3644578_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40903.1|3645062_3646094_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40904.1|3646102_3648964_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40905.1|3648982_3649888_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM40906.1|3652684_3653038_-	hypothetical protein	NA	NA	NA	NA	NA
AXM40907.1|3653088_3655821_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
AXM40908.1|3655906_3656998_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXM40909.1|3656961_3658797_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXM40910.1|3658799_3659288_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 36
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	3861063	3931851	5026592	protease,transposase	Xanthomonas_phage(40.0%)	47	NA	NA
AXM41049.1|3861063_3862299_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXM41050.1|3862720_3864109_-	amino acid permease	NA	NA	NA	NA	NA
AXM41051.1|3864864_3865806_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AXM41052.1|3866119_3866884_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AXM41053.1|3867076_3868459_+	amino acid permease	NA	NA	NA	NA	NA
AXM41054.1|3868898_3870296_+|protease	serine protease	protease	NA	NA	NA	NA
AXM41055.1|3870542_3870728_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41056.1|3870858_3871257_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41057.1|3871401_3872406_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXM41058.1|3872443_3873961_-	tryptophan 7-halogenase	NA	A0A1D7SEI2	Cyanophage	32.3	8.1e-52
AXM41059.1|3874001_3875048_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
AXM42161.1|3875058_3875811_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AXM41060.1|3875886_3876123_+	transcriptional regulator	NA	NA	NA	NA	NA
AXM41061.1|3876142_3879289_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM41062.1|3880347_3882354_-	M1 family peptidase	NA	NA	NA	NA	NA
AXM41063.1|3882573_3883020_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
AXM41064.1|3885011_3886178_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.1	5.8e-74
AXM41065.1|3886179_3886752_-	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	27.7	1.1e-09
AXM41066.1|3886764_3887169_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
AXM41067.1|3887206_3887878_-	DUF2491 family protein	NA	NA	NA	NA	NA
AXM41068.1|3887880_3888963_-	potassium channel protein	NA	NA	NA	NA	NA
AXM41069.1|3888988_3889762_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
AXM41070.1|3889774_3890191_-	DUF2170 family protein	NA	NA	NA	NA	NA
AXM41071.1|3890371_3890971_-	pyridoxine/pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AXM41072.1|3891137_3891680_+	shikimate kinase	NA	NA	NA	NA	NA
AXM42162.1|3891676_3892789_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
AXM41073.1|3893090_3893342_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41074.1|3893356_3894421_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
AXM41075.1|3895892_3899609_+	avirulence protein	NA	NA	NA	NA	NA
AXM41076.1|3899877_3900072_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
AXM41077.1|3900075_3900375_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
AXM41078.1|3900598_3905050_+	avirulence protein	NA	NA	NA	NA	NA
AXM41079.1|3905318_3905513_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.0e-19
AXM41080.1|3905516_3905816_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	9.3e-45
AXM41081.1|3906039_3910167_+	avirulence protein	NA	NA	NA	NA	NA
AXM41082.1|3910340_3910562_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AXM41083.1|3910558_3911230_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	36.8	3.1e-24
AXM41084.1|3911251_3912121_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	1.2e-28
AXM41085.1|3912617_3914072_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41086.1|3916082_3917372_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AXM41087.1|3920762_3921212_-	azurin	NA	NA	NA	NA	NA
AXM41088.1|3922654_3923158_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41089.1|3923182_3923608_-	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
AXM41090.1|3926756_3927374_+	hydrolase	NA	NA	NA	NA	NA
AXM41091.1|3927620_3928847_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	3.1e-17
AXM41092.1|3928919_3929792_+	ion transporter	NA	NA	NA	NA	NA
AXM41093.1|3931052_3931851_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 37
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	3935004	4003087	5026592	transposase	Ralstonia_phage(22.22%)	53	NA	NA
AXM41096.1|3935004_3935985_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	3.7e-98
AXM42163.1|3936418_3937306_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
AXM42164.1|3937519_3937909_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41097.1|3937988_3938666_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
AXM41098.1|3938880_3939849_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXM41099.1|3940288_3941608_+	sensor histidine kinase	NA	NA	NA	NA	NA
AXM41100.1|3941717_3942683_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM41101.1|3942771_3943535_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM42165.1|3943922_3944924_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AXM41102.1|3945279_3945576_-	hypothetical protein	NA	NA	NA	NA	NA
AXM42166.1|3947471_3948506_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM42168.1|3949910_3950684_+	endonuclease	NA	NA	NA	NA	NA
AXM42167.1|3950697_3951528_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXM41103.1|3951598_3952375_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXM41104.1|3952385_3953078_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AXM41105.1|3953077_3953692_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
AXM41106.1|3954034_3954619_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41107.1|3955921_3956287_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
AXM42169.1|3956386_3957748_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AXM41108.1|3957765_3958464_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.5	6.4e-28
AXM41109.1|3959130_3959970_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXM41110.1|3959969_3960644_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
AXM41111.1|3960640_3962140_-	long-chain acyl-CoA synthetase	NA	NA	NA	NA	NA
AXM42170.1|3962136_3962784_-	thermostable hemolysin	NA	NA	NA	NA	NA
AXM41112.1|3965052_3966228_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41113.1|3966357_3969072_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM41114.1|3969391_3970384_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
AXM41115.1|3970386_3971103_+	M23 family peptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	9.2e-06
AXM41116.1|3971921_3973922_-	transketolase	NA	NA	NA	NA	NA
AXM41117.1|3974148_3975429_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AXM41118.1|3975626_3975944_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41119.1|3976239_3977997_-	protein BatD	NA	NA	NA	NA	NA
AXM41120.1|3977993_3979811_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AXM41121.1|3979807_3980815_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AXM41122.1|3980811_3981273_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
AXM41123.1|3981275_3982238_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
AXM41124.1|3982258_3983278_-	MoxR family ATPase	NA	NA	NA	NA	NA
AXM41125.1|3983900_3984923_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM41126.1|3985068_3987018_-	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
AXM41127.1|3987037_3987571_-	fimbrial protein	NA	NA	NA	NA	NA
AXM41128.1|3987567_3988233_-	fimbrial protein	NA	NA	NA	NA	NA
AXM41129.1|3988229_3988988_-	fimbrial protein	NA	NA	NA	NA	NA
AXM41130.1|3988987_3990046_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
AXM41131.1|3990168_3992691_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
AXM41132.1|3993000_3993651_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42171.1|3994026_3995316_-	citrate synthase	NA	NA	NA	NA	NA
AXM41133.1|3995529_3995772_-	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AXM41134.1|3995843_3996782_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AXM41135.1|3996907_3999061_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AXM41136.1|3999081_3999462_-	RidA family protein	NA	NA	NA	NA	NA
AXM41137.1|3999541_4001713_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
AXM41138.1|4001841_4002141_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AXM41139.1|4002288_4003087_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 38
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	4062243	4291833	5026592	integrase,protease,transposase	Bacillus_phage(13.16%)	168	4061929:4061947	4179370:4179388
4061929:4061947	attL	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
AXM41182.1|4062243_4063479_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM41183.1|4064467_4066069_+	rhamnogalacturonase B	NA	NA	NA	NA	NA
AXM42180.1|4066685_4067432_-	cellulase	NA	NA	NA	NA	NA
AXM41184.1|4067904_4068663_-	cellulase	NA	NA	NA	NA	NA
AXM41185.1|4069179_4069695_-	peptide deformylase	NA	NA	NA	NA	NA
AXM42181.1|4070016_4070439_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.8e-41
AXM41186.1|4071210_4073079_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AXM41187.1|4073117_4074071_+	MoxR family ATPase	NA	NA	NA	NA	NA
AXM41188.1|4074076_4075033_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
AXM41189.1|4075025_4076978_+	DUF3488 domain-containing protein	NA	NA	NA	NA	NA
AXM41190.1|4076974_4077508_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41191.1|4077627_4077978_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AXM41192.1|4078079_4078673_-	recombination protein RecR	NA	NA	NA	NA	NA
AXM41193.1|4078770_4079091_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AXM41194.1|4079097_4081194_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
AXM41195.1|4081755_4082202_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
AXM41196.1|4082198_4082444_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
AXM41197.1|4082440_4082938_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AXM41198.1|4082962_4083322_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AXM41199.1|4083339_4084371_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
AXM41200.1|4084370_4085120_-	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
AXM41201.1|4085119_4085869_-	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
AXM41202.1|4085889_4086939_+	lipopolysaccharide heptosyltransferase family protein	NA	NA	NA	NA	NA
AXM41203.1|4087149_4087554_-	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
AXM42182.1|4087664_4088351_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
AXM42183.1|4088449_4089415_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM41204.1|4090374_4092072_-	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM41205.1|4092068_4094273_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	3.5e-19
AXM41206.1|4094334_4094598_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AXM41207.1|4094594_4096277_-	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM41208.1|4096273_4098421_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	1.2e-27
AXM41209.1|4098486_4101207_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.7	2.4e-70
AXM41210.1|4101602_4101803_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41211.1|4102699_4103329_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41212.1|4103586_4103802_+	hypothetical protein	NA	A0A1W6JTB0	Pseudomonas_phage	65.8	3.6e-06
AXM41213.1|4104155_4104860_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
AXM41214.1|4105295_4106030_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	1.1e-35
AXM41215.1|4106038_4106491_-	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
AXM41216.1|4106518_4107175_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41217.1|4107187_4107955_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AXM41218.1|4107951_4109130_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AXM41219.1|4109856_4111827_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXM41220.1|4112658_4112931_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
AXM41221.1|4113144_4115616_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
AXM41222.1|4115759_4117046_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
AXM41223.1|4117170_4117797_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
AXM41224.1|4117889_4119182_-	trigger factor	NA	NA	NA	NA	NA
AXM41225.1|4122499_4123261_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41226.1|4123404_4124412_-	isocitrate dehydrogenase	NA	NA	NA	NA	NA
AXM41227.1|4124675_4125641_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM41228.1|4125641_4126395_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM41229.1|4126545_4126941_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AXM41230.1|4126937_4127246_-	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	4.7e-07
AXM41231.1|4127395_4129042_+	M48 family peptidase	NA	NA	NA	NA	NA
AXM41232.1|4129222_4129912_+	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	36.2	3.4e-34
AXM41233.1|4129969_4131313_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.8	3.8e-29
AXM42184.1|4131428_4133531_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AXM41234.1|4133702_4135229_+	exopolyphosphatase	NA	NA	NA	NA	NA
AXM41235.1|4135433_4136570_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AXM41236.1|4136550_4137093_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AXM41237.1|4137740_4138484_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AXM42185.1|4138663_4139083_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41238.1|4139702_4139900_-	hypothetical protein	NA	NA	NA	NA	NA
AXM42186.1|4140186_4141011_-	DUF455 family protein	NA	NA	NA	NA	NA
AXM41239.1|4141149_4142616_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.7	1.4e-85
AXM41240.1|4142646_4143393_-	CvpA family protein	NA	NA	NA	NA	NA
AXM41241.1|4143607_4144690_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
AXM41242.1|4144757_4146056_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AXM41243.1|4147027_4147672_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AXM41244.1|4147763_4149914_-	S46 family peptidase	NA	NA	NA	NA	NA
AXM41245.1|4152125_4154459_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM42187.1|4154973_4155996_+	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
AXM41246.1|4156065_4156779_-	hypothetical protein	NA	NA	NA	NA	NA
AXM42188.1|4157132_4158167_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	3.4e-25
AXM41247.1|4158174_4159128_-	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
AXM41248.1|4159124_4159985_-	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
AXM41249.1|4159988_4161086_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXM41250.1|4161176_4162385_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.5	1.3e-20
AXM41251.1|4162387_4162780_+	HNH endonuclease	NA	NA	NA	NA	NA
AXM41252.1|4162730_4163591_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AXM41253.1|4163610_4164120_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41254.1|4164312_4165410_-	hypothetical protein	NA	NA	NA	NA	NA
AXM42189.1|4165657_4165852_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41255.1|4165825_4166848_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AXM41256.1|4167055_4169095_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
AXM41257.1|4169193_4170597_+	MFS transporter	NA	NA	NA	NA	NA
AXM41258.1|4172335_4172977_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42190.1|4174209_4174938_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.4e-06
AXM41259.1|4174970_4175733_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM41260.1|4175727_4175970_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
AXM41261.1|4176518_4176980_+	cell wall hydrolase	NA	NA	NA	NA	NA
AXM41262.1|4177261_4178581_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM41263.1|4178792_4179686_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	3.1e-96
4179370:4179388	attR	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
AXM41264.1|4181066_4181865_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM41265.1|4182106_4182721_+	glutathione S-transferase	NA	NA	NA	NA	NA
AXM41266.1|4182803_4183790_-	malate dehydrogenase	NA	NA	NA	NA	NA
AXM41267.1|4183905_4184400_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
AXM41268.1|4184644_4186474_+	translational GTPase TypA	NA	NA	NA	NA	NA
AXM41269.1|4186492_4186963_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
AXM41270.1|4187885_4189013_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AXM41271.1|4189113_4190496_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
AXM41272.1|4190743_4192867_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM41273.1|4193395_4193914_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AXM42191.1|4198110_4199001_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41274.1|4203688_4205008_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM42192.1|4205753_4206677_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
AXM41275.1|4206864_4207662_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM41276.1|4208583_4209346_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM41277.1|4209435_4210401_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM41278.1|4210702_4212280_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41279.1|4212347_4213111_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM41280.1|4213177_4214383_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	6.9e-54
AXM41281.1|4215754_4216552_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM41282.1|4217524_4218409_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41283.1|4218555_4219152_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AXM42193.1|4219151_4220510_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
AXM41284.1|4220876_4221440_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
AXM41285.1|4221599_4222856_+	6-phosphofructokinase	NA	NA	NA	NA	NA
AXM42194.1|4223426_4224392_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM42195.1|4224535_4225027_-	hypothetical protein	NA	NA	NA	NA	NA
AXM42196.1|4225311_4225485_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42197.1|4225481_4226447_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM41286.1|4228700_4229183_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41287.1|4229379_4229916_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
AXM41288.1|4230062_4231178_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
AXM41289.1|4231792_4234762_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
AXM41290.1|4234807_4235701_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXM41291.1|4235811_4238163_-	biopolymer transporter Tol	NA	NA	NA	NA	NA
AXM41292.1|4238588_4240466_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
AXM41293.1|4241742_4242744_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AXM41294.1|4242787_4244509_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
AXM41295.1|4244492_4244750_+	acetolactate synthase	NA	NA	NA	NA	NA
AXM41296.1|4244825_4245950_+	threonine dehydratase	NA	NA	NA	NA	NA
AXM41297.1|4245946_4247509_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
AXM41298.1|4247839_4248913_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AXM42198.1|4248949_4249699_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM41299.1|4249731_4250379_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AXM41300.1|4250446_4251895_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AXM42199.1|4252015_4252900_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM42200.1|4253873_4254839_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM41301.1|4255007_4255469_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41302.1|4255739_4256393_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM42201.1|4256521_4257178_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
AXM41303.1|4257198_4258578_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41304.1|4258850_4260167_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AXM41305.1|4260243_4261164_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
AXM41306.1|4261397_4262732_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
AXM41307.1|4262712_4263825_-	glycosyltransferase	NA	NA	NA	NA	NA
AXM41308.1|4263834_4264032_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AXM41309.1|4264157_4264691_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41310.1|4265317_4265953_-	transcriptional regulator	NA	NA	NA	NA	NA
AXM41311.1|4268659_4271332_-	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	3.4e-77
AXM41312.1|4271657_4272950_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	37.7	6.4e-74
AXM41313.1|4273287_4273473_-	DUF2065 family protein	NA	NA	NA	NA	NA
AXM41314.1|4273767_4274631_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AXM42202.1|4274630_4275758_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
AXM41315.1|4276387_4276774_-	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
AXM41316.1|4277013_4277913_-	J domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
AXM41317.1|4278323_4278800_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXM41318.1|4278962_4279445_+	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
AXM41319.1|4279487_4280048_+	bacterioferritin	NA	NA	NA	NA	NA
AXM41320.1|4280182_4281145_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	1.5e-43
AXM41321.1|4283570_4284806_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXM41322.1|4285051_4285588_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41323.1|4285476_4285761_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41324.1|4286086_4287034_-	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
AXM41325.1|4287208_4290196_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM41326.1|4291034_4291833_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 39
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	4318541	4387308	5026592	tRNA,transposase	Enterobacteria_phage(12.5%)	47	NA	NA
AXM41349.1|4318541_4319507_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM41350.1|4319618_4321910_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
AXM41351.1|4322037_4322712_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
AXM41352.1|4322708_4324553_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
AXM41353.1|4324549_4325416_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
AXM41354.1|4325435_4326068_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
AXM41355.1|4326070_4327105_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
AXM41356.1|4327119_4327410_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
AXM41357.1|4333927_4334767_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AXM41358.1|4335377_4336535_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
AXM41359.1|4336570_4338733_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM41360.1|4339108_4339684_+	nicotinamide riboside transporter PnuC	NA	NA	NA	NA	NA
AXM41361.1|4339789_4340518_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
AXM41362.1|4340934_4341774_-	glycosyltransferase	NA	NA	NA	NA	NA
AXM41363.1|4341770_4344083_-	type II secretion system protein GspD	NA	A7BJX1	Enterobacteria_phage	23.5	5.2e-10
AXM41364.1|4344079_4344889_-	general secretion pathway protein GspN	NA	NA	NA	NA	NA
AXM41365.1|4344878_4345532_-	general secretion pathway protein GspM	NA	NA	NA	NA	NA
AXM41366.1|4345515_4346637_-	general secretion pathway protein GspL	NA	NA	NA	NA	NA
AXM41367.1|4346633_4347485_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
AXM41368.1|4347481_4348117_-	type II secretion system protein J	NA	NA	NA	NA	NA
AXM41369.1|4348113_4348530_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AXM41370.1|4348526_4349036_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
AXM42205.1|4349045_4349477_-	type II secretion system protein GspG	NA	NA	NA	NA	NA
AXM41371.1|4349744_4350962_-	type II secretion system F family protein	NA	NA	NA	NA	NA
AXM41372.1|4350961_4351141_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41373.1|4351137_4352877_-	type II secretion system protein GspE	NA	NA	NA	NA	NA
AXM41374.1|4355097_4358895_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41375.1|4359351_4359615_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41376.1|4359872_4363925_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	7.5e-121
AXM41377.1|4364323_4365121_-	DsbC family protein	NA	NA	NA	NA	NA
AXM41378.1|4365572_4366544_-	site-specific tyrosine recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.9	6.4e-18
AXM41379.1|4366970_4367438_+	RDD family protein	NA	NA	NA	NA	NA
AXM42206.1|4367852_4368959_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AXM41380.1|4368955_4370038_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AXM41381.1|4370145_4371618_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	6.2e-49
AXM41382.1|4371617_4371923_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41383.1|4371963_4372389_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AXM41384.1|4372596_4375539_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.8	6.4e-130
AXM41385.1|4375546_4375849_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41386.1|4376475_4377577_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.2	6.5e-43
AXM41387.1|4377759_4378077_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AXM41388.1|4378127_4379447_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM41389.1|4379659_4380628_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM41390.1|4380764_4382084_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM41391.1|4382403_4383444_+	pectate lyase	NA	NA	NA	NA	NA
AXM42207.1|4383710_4385756_-	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	8.2e-15
AXM41392.1|4385988_4387308_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 40
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	4408213	4418841	5026592		Enterobacteria_phage(57.14%)	10	NA	NA
AXM41410.1|4408213_4409560_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
AXM41411.1|4409606_4411010_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
AXM41412.1|4411126_4412035_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
AXM41413.1|4412031_4412589_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
AXM41414.1|4412585_4413473_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	58.2	2.9e-94
AXM42210.1|4413528_4414584_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
AXM41415.1|4414809_4415556_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
AXM41416.1|4415555_4416497_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
AXM41417.1|4416719_4417538_+	ABC transporter permease	NA	NA	NA	NA	NA
AXM41418.1|4417527_4418841_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
>prophage 41
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	4517700	4580382	5026592	transposase,protease	Bacillus_phage(16.67%)	53	NA	NA
AXM41504.1|4517700_4519608_+|protease	protease	protease	A0A1B0T6A2	Bacillus_phage	30.7	6.7e-19
AXM41505.1|4519731_4520268_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41506.1|4520433_4520700_+	DUF3297 family protein	NA	NA	NA	NA	NA
AXM42222.1|4521113_4521875_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AXM41507.1|4521871_4522816_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.3	3.4e-24
AXM41508.1|4523062_4524700_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
AXM41509.1|4524938_4525118_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41510.1|4525167_4525596_-	hypothetical protein	NA	NA	NA	NA	NA
AXM42223.1|4526305_4526758_+	fasciclin domain-containing protein	NA	NA	NA	NA	NA
AXM41511.1|4527397_4528846_-	DUF4130 domain-containing protein	NA	NA	NA	NA	NA
AXM41512.1|4528852_4530097_-	putative DNA modification/repair radical SAM protein	NA	NA	NA	NA	NA
AXM41513.1|4530294_4531113_-	dioxygenase	NA	NA	NA	NA	NA
AXM41514.1|4531210_4531489_-	DoxX family membrane protein	NA	NA	NA	NA	NA
AXM41515.1|4531604_4532174_+	flavodoxin family protein	NA	NA	NA	NA	NA
AXM41516.1|4532313_4533309_+	aldo/keto reductase	NA	NA	NA	NA	NA
AXM41517.1|4533332_4533521_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41518.1|4533549_4534245_+	glycosyltransferase	NA	NA	NA	NA	NA
AXM42224.1|4534395_4536465_+	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	26.9	2.9e-60
AXM41519.1|4536803_4537661_-	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
AXM42225.1|4538190_4538877_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41520.1|4539208_4540804_-	APC family permease	NA	NA	NA	NA	NA
AXM41521.1|4542285_4543074_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.4	1.2e-19
AXM41522.1|4543074_4543617_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41523.1|4543891_4545106_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXM42226.1|4545138_4545393_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41524.1|4545414_4545609_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41525.1|4546132_4547452_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM41526.1|4550926_4551307_+	response regulator	NA	NA	NA	NA	NA
AXM41527.1|4551275_4551542_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41528.1|4551541_4552822_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXM41529.1|4553946_4555347_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AXM41530.1|4559573_4560539_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM41531.1|4560723_4561056_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AXM41532.1|4561061_4563386_+	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AXM41533.1|4563524_4563785_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41534.1|4563705_4563900_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41535.1|4564219_4564666_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AXM41536.1|4564764_4565250_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AXM42227.1|4565282_4565690_+	four helix bundle protein	NA	NA	NA	NA	NA
AXM41537.1|4565725_4567093_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AXM41538.1|4567231_4567597_-	hypothetical protein	NA	NA	NA	NA	NA
AXM42228.1|4567593_4567986_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41539.1|4568054_4568519_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41540.1|4569091_4569478_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41541.1|4569464_4570406_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AXM41542.1|4570552_4571068_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41543.1|4571211_4571589_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXM42229.1|4572299_4573145_+	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
AXM41544.1|4573251_4573524_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXM42230.1|4574208_4575174_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM41545.1|4575170_4575365_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41546.1|4575824_4576781_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM41547.1|4579267_4580382_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.9	2.5e-82
>prophage 42
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	4754216	4808717	5026592	tRNA,transposase	Tupanvirus(14.29%)	44	NA	NA
AXM41655.1|4754216_4755221_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AXM42249.1|4755683_4755878_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41656.1|4756628_4757204_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AXM41657.1|4757262_4758786_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.2e-97
AXM41658.1|4759476_4759947_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM42250.1|4759908_4760097_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42251.1|4760109_4761075_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM41659.1|4761157_4761424_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41660.1|4761697_4763830_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
AXM42252.1|4764291_4764678_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41661.1|4764679_4765531_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
AXM41662.1|4765583_4766465_+	TolB-like protein	NA	NA	NA	NA	NA
AXM41663.1|4767087_4769622_-	iron-uptake factor	NA	NA	NA	NA	NA
AXM41664.1|4769855_4770608_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.9	5.6e-22
AXM41665.1|4770735_4771650_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM41666.1|4772922_4773915_-	porphobilinogen synthase	NA	NA	NA	NA	NA
AXM41667.1|4774135_4774384_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41668.1|4774579_4775038_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41669.1|4775137_4776928_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
AXM41670.1|4777136_4779374_-	S9 family peptidase	NA	NA	NA	NA	NA
AXM41671.1|4779798_4780488_-	glutathione S-transferase	NA	NA	NA	NA	NA
AXM42253.1|4780877_4783892_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM41672.1|4784075_4784777_+	peptidase	NA	NA	NA	NA	NA
AXM41673.1|4784766_4785780_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
AXM41674.1|4785790_4787356_+	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	5.6e-40
AXM41675.1|4787495_4788518_+	energy transducer TonB	NA	NA	NA	NA	NA
AXM41676.1|4788927_4790121_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM41677.1|4790117_4790864_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.5e-19
AXM41678.1|4790895_4792497_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXM41679.1|4792557_4792758_-	transcriptional regulator	NA	NA	NA	NA	NA
AXM42254.1|4792754_4793342_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41680.1|4793827_4794100_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AXM41681.1|4794165_4795167_+	cation transporter	NA	NA	NA	NA	NA
AXM41682.1|4795251_4796013_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
AXM41683.1|4796115_4797111_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
AXM42255.1|4797128_4797920_+	ABC transporter permease	NA	NA	NA	NA	NA
AXM41684.1|4797922_4798672_+	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	4.3e-54
AXM42256.1|4798790_4799729_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AXM41685.1|4799728_4799911_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41686.1|4800155_4801391_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM41687.1|4801443_4802631_-|transposase	IS5-like element ISXoo14 family transposase	transposase	NA	NA	NA	NA
AXM41688.1|4805234_4806336_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	4.7e-41
AXM41689.1|4807096_4807859_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM41690.1|4807919_4808717_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 43
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	4817569	4869444	5026592	tRNA,transposase	Staphylococcus_prophage(33.33%)	38	NA	NA
AXM41699.1|4817569_4818001_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AXM41700.1|4818003_4818633_+	acyltransferase	NA	NA	NA	NA	NA
AXM41701.1|4819270_4821439_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
AXM41702.1|4821565_4823728_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AXM41703.1|4824554_4825520_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM42257.1|4827624_4827990_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
AXM41704.1|4827986_4829288_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AXM41705.1|4829468_4830245_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXM41706.1|4830373_4831137_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM41707.1|4831537_4832122_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42258.1|4832314_4835764_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AXM41708.1|4835904_4836105_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41709.1|4836511_4839154_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42259.1|4839257_4841657_-	NdvB protein	NA	NA	NA	NA	NA
AXM41710.1|4841659_4843042_-	MFS transporter	NA	NA	NA	NA	NA
AXM41711.1|4843199_4843784_+	gluconokinase	NA	NA	NA	NA	NA
AXM41712.1|4844662_4846417_+	polyvinylalcohol dehydrogenase	NA	A0A0M4JT37	Mollivirus	35.6	9.6e-81
AXM41713.1|4846724_4847030_-	hypothetical protein	NA	NA	NA	NA	NA
AXM42260.1|4846932_4847373_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AXM41714.1|4847392_4847821_-	hypothetical protein	NA	NA	NA	NA	NA
AXM42261.1|4849288_4850087_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM41715.1|4850257_4851583_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM41716.1|4852034_4853354_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM41717.1|4853466_4854423_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.7	3.4e-40
AXM41718.1|4855267_4856233_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM41719.1|4856250_4856808_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXM41720.1|4856826_4857114_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41721.1|4857498_4858293_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
AXM41722.1|4858292_4859042_+	ABC transporter permease	NA	NA	NA	NA	NA
AXM41723.1|4859053_4859605_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AXM41724.1|4859601_4860264_+	organic solvent ABC transporter	NA	NA	NA	NA	NA
AXM41725.1|4860253_4860544_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AXM41726.1|4860554_4861613_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
AXM41727.1|4863411_4864175_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM41728.1|4864279_4865242_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM41729.1|4865438_4866395_+|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM41730.1|4866646_4867462_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
AXM42262.1|4868342_4869444_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.6	3.7e-38
>prophage 44
CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	4949991	4995671	5026592	protease,transposase	Fowlpox_virus(12.5%)	34	NA	NA
AXM42266.1|4949991_4950957_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM42267.1|4951132_4952548_-	amino acid permease	NA	NA	NA	NA	NA
AXM41791.1|4952764_4952974_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41792.1|4953038_4955363_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
AXM42268.1|4955768_4956131_+	hypothetical protein	NA	NA	NA	NA	NA
AXM42269.1|4956508_4957054_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
AXM41793.1|4958715_4960035_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM41794.1|4960307_4961435_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
AXM42270.1|4961398_4962133_-	2OG-Fe(II) oxygenase	NA	V5UTP7	Synechococcus_phage	47.6	2.6e-16
AXM41795.1|4962353_4963694_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41796.1|4963910_4964603_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXM42271.1|4964719_4965040_+	DUF1820 family protein	NA	NA	NA	NA	NA
AXM41797.1|4965039_4966032_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.4	8.5e-10
AXM41798.1|4966338_4967862_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.7e-25
AXM41799.1|4967966_4969202_-	peptidase M23	NA	NA	NA	NA	NA
AXM41800.1|4969362_4970019_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41801.1|4970169_4971981_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
AXM41802.1|4972128_4972479_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AXM41803.1|4972657_4973977_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM41804.1|4975389_4976571_-	hypothetical protein	NA	NA	NA	NA	NA
AXM41805.1|4976668_4980100_-	ATP-binding protein	NA	NA	NA	NA	NA
AXM41806.1|4980247_4980946_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
AXM41807.1|4980929_4982402_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
AXM41808.1|4982398_4982986_-	DUF4276 family protein	NA	NA	NA	NA	NA
AXM41809.1|4982985_4984182_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AXM41810.1|4984255_4984885_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.9	1.2e-46
AXM41811.1|4985565_4986093_+	TolC family protein	NA	NA	NA	NA	NA
AXM41812.1|4986089_4986656_+	FUSC family protein	NA	NA	NA	NA	NA
AXM41813.1|4986931_4988293_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.9	8.3e-32
AXM42272.1|4989088_4990123_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM41814.1|4990195_4991410_+	phospholipase	NA	NA	NA	NA	NA
AXM41815.1|4991659_4991866_+	hypothetical protein	NA	NA	NA	NA	NA
AXM41816.1|4991852_4992965_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXM41817.1|4994714_4995671_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.4	2.1e-42
