The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	7692	78816	4867200	transposase,protease	Ralstonia_phage(30.0%)	55	NA	NA
AXM15660.1|7692_8529_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXM15661.1|8715_9522_+	M48 family peptidase	NA	NA	NA	NA	NA
AXM15662.1|9798_10992_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AXM15663.1|11145_11817_+	energy transducer TonB	NA	NA	NA	NA	NA
AXM15664.1|11901_12663_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
AXM15665.1|12709_13132_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXM15666.1|13135_13549_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXM15667.1|13844_14612_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AXM15668.1|14622_14892_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15669.1|14966_16427_-	cardiolipin synthase	NA	NA	NA	NA	NA
AXM15670.1|17073_18084_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
AXM15671.1|18355_19558_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AXM15672.1|19699_21838_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
AXM19023.1|22048_22342_+	hypothetical protein	NA	NA	NA	NA	NA
AXM15673.1|22458_23004_+	hypothetical protein	NA	NA	NA	NA	NA
AXM15674.1|23117_24098_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	56.2	5.3e-89
AXM15675.1|24145_25312_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AXM15676.1|25458_26025_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
AXM15677.1|27499_28708_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
AXM15678.1|29335_30358_-	sugar kinase	NA	NA	NA	NA	NA
AXM15679.1|31180_32149_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXM15680.1|33595_34477_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.5e-05
AXM15681.1|35078_36455_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
AXM15682.1|39467_39710_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15683.1|39651_39975_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15684.1|40105_40492_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15685.1|40440_41421_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
AXM15686.1|41780_42032_+	hypothetical protein	NA	NA	NA	NA	NA
AXM15687.1|42039_43329_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
AXM15688.1|43768_44104_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15689.1|44378_44810_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15690.1|45158_46568_-	FAD-binding protein	NA	NA	NA	NA	NA
AXM15691.1|47885_48146_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15692.1|48162_48495_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15693.1|48494_48953_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15694.1|49312_50527_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
AXM15695.1|51047_51845_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM15696.1|53560_54526_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM15697.1|54522_54723_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15698.1|54944_56264_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM15699.1|56381_57428_+	methylamine utilization protein	NA	NA	NA	NA	NA
AXM15700.1|58229_58862_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AXM15701.1|58878_61041_-	glycogen debranching enzyme GlgX	NA	NA	NA	NA	NA
AXM15702.1|61155_61341_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
AXM15703.1|61363_63967_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
AXM19024.1|63963_65853_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AXM15704.1|65909_67667_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
AXM15705.1|67669_69904_-	glycogen-branching enzyme	NA	NA	NA	NA	NA
AXM15706.1|69900_71484_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
AXM15707.1|71957_73586_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXM15708.1|73582_74947_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
AXM15709.1|75139_76081_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AXM15710.1|76098_76311_+	hypothetical protein	NA	NA	NA	NA	NA
AXM15711.1|76321_78046_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
AXM15712.1|78052_78816_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	109332	135584	4867200	transposase,holin	Ralstonia_phage(50.0%)	24	NA	NA
AXM15739.1|109332_110301_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM15740.1|110513_111833_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM15741.1|112021_113005_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
AXM15742.1|113726_116135_+	serine kinase	NA	NA	NA	NA	NA
AXM19027.1|117010_118639_+	type III secretion system effector XopAE	NA	NA	NA	NA	NA
AXM15743.1|119196_119580_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15744.1|119576_120062_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AXM15745.1|120065_120428_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15746.1|120544_121981_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
AXM15747.1|122222_123074_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
AXM15748.1|123533_123851_-	ATP-binding protein	NA	NA	NA	NA	NA
AXM15749.1|124156_125044_-	TIGR01777 family protein	NA	NA	NA	NA	NA
AXM15750.1|125750_126701_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
AXM15751.1|126814_127000_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15752.1|127091_127364_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15753.1|127404_127686_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15754.1|127824_128883_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM15755.1|129023_129971_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
AXM15756.1|130225_130537_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15757.1|131809_131992_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15758.1|132003_132474_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AXM15759.1|132643_133336_+	hypothetical protein	NA	NA	NA	NA	NA
AXM15760.1|133427_133826_+	host attachment protein	NA	NA	NA	NA	NA
AXM15761.1|134627_135584_+|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 3
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	170311	222936	4867200	transposase,tRNA,protease	Acidithiobacillus_phage(28.57%)	27	NA	NA
AXM19031.1|170311_171277_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM19032.1|172712_173511_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM15780.1|173749_175132_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	4.7e-75
AXM15781.1|176533_177601_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM19033.1|177556_177754_+	hypothetical protein	NA	NA	NA	NA	NA
AXM15782.1|177735_177831_-	xylosidase	NA	NA	NA	NA	NA
AXM15783.1|177806_178334_-	xylosidase	NA	NA	NA	NA	NA
AXM15784.1|179156_181340_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
AXM15785.1|181351_184702_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
AXM15786.1|184698_187815_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
AXM15787.1|194959_196279_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM15788.1|196435_197956_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AXM15789.1|197972_198251_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19034.1|198440_198779_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
AXM15790.1|199391_201377_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AXM15791.1|202296_203109_+	hypothetical protein	NA	NA	NA	NA	NA
AXM15792.1|203301_203913_+	hypothetical protein	NA	NA	NA	NA	NA
AXM15793.1|204329_205187_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
AXM15794.1|205424_207311_+	arginine decarboxylase	NA	NA	NA	NA	NA
AXM15795.1|207876_209253_+|transposase	IS5-like element ISXoo4 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	7.8e-78
AXM15796.1|209657_212381_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.0	5.3e-70
AXM19035.1|212448_214602_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.5	2.0e-27
AXM15797.1|214598_216290_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM15798.1|216286_216550_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	4.4e-06
AXM15799.1|216611_218813_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
AXM15800.1|218809_220498_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM15801.1|221031_222936_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 4
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	278747	338801	4867200	transposase	Bacillus_phage(25.0%)	40	NA	NA
AXM15839.1|278747_279716_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM15840.1|279969_282132_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
AXM15841.1|282679_283984_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
AXM15842.1|284043_284646_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
AXM15843.1|284642_286547_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
AXM15844.1|295865_296681_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
AXM15845.1|297027_297990_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM15846.1|298094_298857_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM15847.1|300656_301715_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
AXM15848.1|301725_302016_-	STAS domain-containing protein	NA	NA	NA	NA	NA
AXM15849.1|302005_302668_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
AXM15850.1|302664_303216_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AXM15851.1|303227_303977_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM15852.1|303976_304771_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
AXM15853.1|305155_305443_+	hypothetical protein	NA	NA	NA	NA	NA
AXM15854.1|305461_306019_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXM15855.1|306036_307002_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM15856.1|307846_308803_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
AXM15857.1|308874_309637_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM15858.1|309676_310475_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM15859.1|310606_311821_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
AXM15860.1|311880_312711_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM15861.1|312873_314109_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXM15862.1|315507_315936_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19038.1|315955_316396_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AXM15863.1|316298_316604_+	hypothetical protein	NA	NA	NA	NA	NA
AXM15864.1|316911_318666_-	polyvinylalcohol dehydrogenase	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
AXM15865.1|319565_320328_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM15866.1|320381_320966_-	gluconokinase	NA	NA	NA	NA	NA
AXM15867.1|321123_322506_+	MFS transporter	NA	NA	NA	NA	NA
AXM19039.1|322508_324908_+	NdvB protein	NA	NA	NA	NA	NA
AXM15868.1|325011_327654_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15869.1|328060_328261_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19040.1|328401_331851_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AXM15870.1|332043_332628_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15871.1|333104_333881_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXM15872.1|334061_335363_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AXM19041.1|335359_335725_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
AXM15873.1|336161_337643_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
AXM19042.1|337835_338801_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	345354	411484	4867200	transposase,tRNA	Bathycoccus_sp._RCC1105_virus(14.29%)	51	NA	NA
AXM15877.1|345354_345786_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AXM15878.1|345878_346421_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
AXM15879.1|346516_347269_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AXM15880.1|347493_347883_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM15881.1|347996_349670_-	ubiquinone biosynthesis protein UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
AXM15882.1|349666_350311_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
AXM15883.1|350320_350515_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15884.1|353995_354280_+	hypothetical protein	NA	NA	NA	NA	NA
AXM15885.1|354631_355430_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM15886.1|355489_356253_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19043.1|360206_361172_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM15887.1|362232_363339_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM15888.1|364950_365133_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19044.1|365132_366071_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AXM15889.1|366189_366939_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	5.6e-54
AXM15890.1|366941_367733_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM15891.1|367750_368746_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
AXM15892.1|368848_369610_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
AXM15893.1|369694_370684_-	cation transporter	NA	NA	NA	NA	NA
AXM15894.1|370749_371022_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AXM19045.1|371507_372095_+	hypothetical protein	NA	NA	NA	NA	NA
AXM15895.1|372091_372292_+	transcriptional regulator	NA	NA	NA	NA	NA
AXM15896.1|372352_373954_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXM15897.1|373985_374732_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
AXM15898.1|374728_375922_+	ABC transporter permease	NA	NA	NA	NA	NA
AXM15899.1|376331_377354_-	energy transducer TonB	NA	NA	NA	NA	NA
AXM15900.1|377493_379059_-	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
AXM15901.1|379069_380083_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
AXM15902.1|380072_380774_-	peptidase	NA	NA	NA	NA	NA
AXM19046.1|380957_383972_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM15903.1|384145_384908_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM15904.1|385177_385867_+	glutathione S-transferase	NA	NA	NA	NA	NA
AXM15905.1|386291_388529_+	S9 family peptidase	NA	NA	NA	NA	NA
AXM15906.1|388737_390528_+	DUF885 domain-containing protein	NA	NA	NA	NA	NA
AXM15907.1|390627_391086_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15908.1|391750_392743_+	porphobilinogen synthase	NA	NA	NA	NA	NA
AXM15909.1|394015_394930_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM15910.1|395057_395810_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.9	5.6e-22
AXM15911.1|396043_398578_+	iron-uptake factor	NA	NA	NA	NA	NA
AXM15912.1|399234_400116_-	TolB-like protein	NA	NA	NA	NA	NA
AXM15913.1|400168_401020_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AXM19047.1|401021_401408_+	hypothetical protein	NA	NA	NA	NA	NA
AXM15914.1|401869_404002_+	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
AXM15915.1|404275_404542_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19048.1|404624_405590_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM15916.1|405602_405791_-	hypothetical protein	NA	NA	NA	NA	NA
AXM15917.1|405752_406223_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM15918.1|406913_408437_+	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.2e-97
AXM15919.1|408495_409071_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AXM19049.1|409821_410016_+	hypothetical protein	NA	NA	NA	NA	NA
AXM15920.1|410479_411484_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 6
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	567532	617030	4867200	integrase,transposase,tRNA	Stenotrophomonas_phage(25.0%)	45	575683:575699	613818:613834
AXM16038.1|567532_568498_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM16039.1|568965_570285_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM16040.1|570814_571330_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXM16041.1|571732_573955_-	primosomal protein N'	NA	NA	NA	NA	NA
AXM16042.1|574423_575449_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16043.1|575432_576035_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
575683:575699	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
AXM16044.1|576365_577310_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16045.1|577269_577551_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16046.1|577828_579205_+	MATE family efflux transporter	NA	NA	NA	NA	NA
AXM16047.1|579289_581191_+	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
AXM16048.1|581376_581592_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16049.1|581698_582475_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXM16050.1|582636_583311_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AXM16051.1|583307_584081_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AXM16052.1|584304_584868_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AXM16053.1|584878_587371_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
AXM16054.1|587553_588828_-	RDD family protein	NA	NA	NA	NA	NA
AXM16055.1|588869_589592_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
AXM16056.1|589632_590106_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AXM16057.1|590148_591291_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AXM16058.1|591362_592499_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
AXM16059.1|592631_593144_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
AXM16060.1|593537_594461_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
AXM16061.1|594460_595774_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
AXM16062.1|595824_597546_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AXM16063.1|597710_598988_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
AXM16064.1|599185_600010_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AXM16065.1|600010_601069_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
AXM16066.1|601234_602701_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19067.1|602697_603201_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16067.1|603310_604444_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
AXM16068.1|604686_605208_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXM16069.1|605407_606322_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
AXM16070.1|606422_606863_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AXM16071.1|606971_608846_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
AXM16072.1|609038_609359_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16073.1|609987_611262_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.4e-110
AXM16074.1|611174_611438_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	71.4	7.2e-17
AXM16075.1|611395_611602_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16076.1|611598_611871_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19068.1|611867_612113_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16077.1|614048_615284_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
613818:613834	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
AXM16078.1|615352_615742_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16079.1|615738_615942_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19069.1|616064_617030_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 7
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	764458	800777	4867200	transposase,tRNA	Enterobacteria_phage(36.36%)	33	NA	NA
AXM16205.1|764458_765778_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM19082.1|766093_767278_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
AXM16206.1|767807_769121_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
AXM16207.1|769110_769929_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM16208.1|770151_771093_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
AXM16209.1|771092_771839_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
AXM16210.1|772064_773120_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
AXM16211.1|773175_774063_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
AXM16212.1|774059_774617_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
AXM16213.1|774613_775522_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
AXM16214.1|775638_777042_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
AXM16215.1|777088_778435_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
AXM16216.1|778568_779300_+	CoA transferase subunit A	NA	NA	NA	NA	NA
AXM16217.1|779299_779929_+	CoA transferase subunit B	NA	NA	NA	NA	NA
AXM16218.1|779986_782074_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19083.1|782070_783720_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AXM16219.1|783835_784444_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
AXM16220.1|784837_785068_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16221.1|784994_785639_-	ABC transporter	NA	NA	NA	NA	NA
AXM16222.1|785635_786562_-	MCE family protein	NA	NA	NA	NA	NA
AXM16223.1|786564_787407_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	7.0e-13
AXM16224.1|787492_788605_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM16225.1|788774_790034_+	threonine/serine exporter	NA	NA	NA	NA	NA
AXM16226.1|790095_790557_-	DNA-binding protein	NA	NA	NA	NA	NA
AXM16227.1|790699_792394_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AXM16228.1|792505_792910_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AXM16229.1|793041_793815_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AXM16230.1|793825_794293_+	alanine acetyltransferase	NA	NA	NA	NA	NA
AXM19084.1|794298_794772_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AXM16231.1|795330_796650_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM16232.1|796807_798127_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM16233.1|798339_799308_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AXM16234.1|799457_800777_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	867967	912025	4867200	transposase,protease	Ralstonia_phage(25.0%)	40	NA	NA
AXM16275.1|867967_868933_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM16276.1|869323_869899_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AXM16277.1|870011_870521_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
AXM16278.1|870619_870814_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AXM16279.1|870903_871881_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AXM16280.1|872110_872551_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
AXM16281.1|872828_873773_+	[acyl-carrier-protein] S-malonyltransferase	NA	NA	NA	NA	NA
AXM16282.1|873855_874599_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
AXM16283.1|874803_875043_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
AXM16284.1|875184_876420_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AXM16285.1|876590_877946_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
AXM16286.1|878006_879080_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
AXM16287.1|879076_880036_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
AXM16288.1|880032_880386_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AXM19088.1|880909_881383_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19089.1|882403_882730_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16289.1|882965_884564_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
AXM16290.1|884709_885606_+	methylisocitrate lyase	NA	NA	NA	NA	NA
AXM16291.1|885681_886836_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
AXM16292.1|887016_889608_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
AXM16293.1|889930_890068_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXM16294.1|890151_890349_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16295.1|890340_891540_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
AXM16296.1|891989_892958_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM16297.1|893199_895416_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM16298.1|895494_896493_+	nucleoside hydrolase	NA	NA	NA	NA	NA
AXM16299.1|896602_896785_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16300.1|897764_900752_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM16301.1|900926_901874_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
AXM16302.1|902199_902421_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16303.1|902377_902914_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16304.1|902984_904304_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM16305.1|904648_905611_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.7e-42
AXM16306.1|905744_906305_-	bacterioferritin	NA	NA	NA	NA	NA
AXM16307.1|906347_906830_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
AXM16308.1|906992_907469_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXM16309.1|907879_908779_+	J domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
AXM16310.1|909018_909405_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
AXM19090.1|910034_911162_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
AXM16311.1|911161_912025_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 9
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	917325	1080687	4867200	integrase,transposase,protease	Ralstonia_phage(21.43%)	116	1008861:1008879	1077798:1077816
AXM16315.1|917325_918108_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM19091.1|918218_919595_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	4.3e-76
AXM16316.1|919838_920474_+	transcriptional regulator	NA	NA	NA	NA	NA
AXM16317.1|921100_921634_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16318.1|921759_921957_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AXM16319.1|921966_923079_+	glycosyltransferase	NA	NA	NA	NA	NA
AXM16320.1|923059_924394_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
AXM16321.1|924627_925548_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
AXM16322.1|925624_926941_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AXM16323.1|927213_928593_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16324.1|928613_929270_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
AXM16325.1|929398_930052_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM16326.1|930322_930784_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19092.1|931843_932728_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM16327.1|932848_934297_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AXM16328.1|934364_935012_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AXM16329.1|935828_936902_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AXM16330.1|937232_938795_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
AXM16331.1|938791_939916_-	threonine dehydratase	NA	NA	NA	NA	NA
AXM16332.1|939991_940249_-	acetolactate synthase	NA	NA	NA	NA	NA
AXM16333.1|940232_941954_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
AXM16334.1|941997_942999_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AXM16335.1|944275_946153_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
AXM16336.1|946578_948930_+	biopolymer transporter Tol	NA	NA	NA	NA	NA
AXM16337.1|949040_949934_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXM16338.1|949979_952949_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
AXM16339.1|953563_954679_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
AXM16340.1|954825_955362_-	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
AXM16341.1|955558_956041_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16342.1|958316_959282_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM19093.1|959278_959452_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16343.1|959736_960228_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16344.1|961907_963164_-	6-phosphofructokinase	NA	NA	NA	NA	NA
AXM16345.1|963323_963887_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
AXM19094.1|964253_965612_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
AXM16346.1|965611_966208_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AXM16347.1|966354_967239_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16348.1|969220_969835_+	glutathione S-transferase	NA	NA	NA	NA	NA
AXM16349.1|969917_970904_-	malate dehydrogenase	NA	NA	NA	NA	NA
AXM16350.1|971019_971514_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
AXM16351.1|971758_973588_+	translational GTPase TypA	NA	NA	NA	NA	NA
AXM16352.1|973606_974077_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
AXM16353.1|974999_976127_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AXM16354.1|976227_977610_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
AXM16355.1|977857_979981_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM16356.1|980509_981028_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AXM16357.1|981734_982836_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
AXM16358.1|983351_984587_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM19095.1|985200_986091_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16359.1|989880_991116_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM16360.1|992098_993418_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM19096.1|994163_995087_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
AXM19097.1|996149_997115_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM16361.1|997416_998994_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16362.1|999061_999825_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM16363.1|1002493_1003462_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM16364.1|1003464_1003746_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16365.1|1003722_1004184_-	cell wall hydrolase	NA	NA	NA	NA	NA
AXM16366.1|1004732_1004975_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
AXM16367.1|1004968_1005732_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM16368.1|1005764_1006496_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
AXM16369.1|1008315_1009068_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1008861:1008879	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
AXM16370.1|1009069_1010035_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM16371.1|1010298_1011306_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
AXM16372.1|1011449_1012211_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16373.1|1016912_1017539_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
AXM16374.1|1017663_1018950_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
AXM16375.1|1019093_1021565_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
AXM16376.1|1021778_1022051_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
AXM16377.1|1022882_1024853_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXM16378.1|1025565_1026744_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AXM16379.1|1026740_1027508_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AXM16380.1|1027520_1028177_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16381.1|1028204_1028657_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
AXM16382.1|1028665_1029400_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
AXM16383.1|1029835_1030540_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
AXM16384.1|1031365_1031995_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16385.1|1032886_1033087_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16386.1|1033482_1036206_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	2.8e-71
AXM19098.1|1036273_1038424_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
AXM16387.1|1038420_1040118_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM16388.1|1040437_1042642_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
AXM16389.1|1042638_1044333_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM16390.1|1044329_1044593_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
AXM16391.1|1044654_1046862_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
AXM16392.1|1046858_1048538_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM16393.1|1048534_1048798_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
AXM16394.1|1048859_1049417_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19099.1|1049499_1050465_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM19100.1|1050563_1051250_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
AXM16395.1|1051360_1051765_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
AXM16396.1|1051975_1053025_-	lipopolysaccharide heptosyltransferase family protein	NA	NA	NA	NA	NA
AXM16397.1|1053045_1053795_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
AXM16398.1|1053794_1054544_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
AXM16399.1|1054543_1055575_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
AXM16400.1|1055592_1055952_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AXM16401.1|1055976_1056474_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AXM16402.1|1056470_1056716_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
AXM16403.1|1056712_1057159_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
AXM16404.1|1057720_1059817_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
AXM16405.1|1059823_1060144_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AXM16406.1|1060241_1060835_+	recombination protein RecR	NA	NA	NA	NA	NA
AXM16407.1|1060936_1061287_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AXM16408.1|1061406_1061940_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16409.1|1061936_1063889_-	DUF3488 domain-containing protein	NA	NA	NA	NA	NA
AXM16410.1|1063881_1064838_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
AXM16411.1|1064843_1065797_-	MoxR family ATPase	NA	NA	NA	NA	NA
AXM16412.1|1065835_1067704_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AXM16413.1|1069219_1069735_+	peptide deformylase	NA	NA	NA	NA	NA
AXM16414.1|1070251_1071010_+	cellulase	NA	NA	NA	NA	NA
AXM19101.1|1071482_1072229_+	cellulase	NA	NA	NA	NA	NA
AXM16415.1|1072845_1074447_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
AXM16416.1|1075435_1076671_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM16417.1|1077499_1078468_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
1077798:1077816	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
AXM16418.1|1078935_1079286_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
AXM16419.1|1079367_1080687_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 10
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	1119417	1161864	4867200	transposase	Leptospira_phage(25.0%)	40	NA	NA
AXM19103.1|1119417_1120519_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
AXM16449.1|1121949_1122573_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
AXM16450.1|1122596_1122836_+	rubredoxin	NA	NA	NA	NA	NA
AXM16451.1|1122885_1123767_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19104.1|1123916_1124366_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
AXM16452.1|1124516_1125164_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
AXM16453.1|1125255_1125726_-	EVE domain-containing protein	NA	NA	NA	NA	NA
AXM16454.1|1125722_1126313_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AXM16455.1|1126921_1127221_-	cell division protein ZapA	NA	NA	NA	NA	NA
AXM19106.1|1127217_1127439_-	TIGR02449 family protein	NA	NA	NA	NA	NA
AXM19105.1|1127674_1128217_+	YecA family protein	NA	NA	NA	NA	NA
AXM16456.1|1128227_1129568_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AXM16457.1|1130275_1131039_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19107.1|1131271_1132597_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
AXM16458.1|1132795_1133143_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
AXM16459.1|1133139_1135548_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
AXM16460.1|1135726_1136884_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
AXM16461.1|1136899_1137499_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
AXM16462.1|1137495_1137891_-	glyoxalase	NA	NA	NA	NA	NA
AXM16463.1|1137887_1138613_-	ribonuclease PH	NA	NA	NA	NA	NA
AXM16464.1|1138722_1139583_+	YicC family protein	NA	NA	NA	NA	NA
AXM16465.1|1139699_1140311_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
AXM16466.1|1140491_1141289_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM16467.1|1141437_1141737_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AXM16468.1|1141865_1144037_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
AXM16469.1|1144116_1144497_+	RidA family protein	NA	NA	NA	NA	NA
AXM16470.1|1144517_1146671_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AXM16471.1|1146796_1147735_+	nucleoside hydrolase	NA	NA	NA	NA	NA
AXM16472.1|1147806_1148049_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AXM19108.1|1148262_1149552_+	citrate synthase	NA	NA	NA	NA	NA
AXM16473.1|1149929_1150580_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16474.1|1150889_1153412_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
AXM16475.1|1153534_1154593_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
AXM16476.1|1154592_1155351_+	fimbrial protein	NA	NA	NA	NA	NA
AXM16477.1|1155347_1156013_+	fimbrial protein	NA	NA	NA	NA	NA
AXM16478.1|1156009_1156543_+	fimbrial protein	NA	NA	NA	NA	NA
AXM16479.1|1156562_1158512_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
AXM16480.1|1158582_1159381_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM16481.1|1159523_1160759_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXM16482.1|1160829_1161864_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	1201081	1232967	4867200	transposase	Feldmannia_irregularis_virus(16.67%)	25	NA	NA
AXM16508.1|1201081_1201844_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM16509.1|1201933_1202899_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM16510.1|1203008_1204328_-	sensor histidine kinase	NA	NA	NA	NA	NA
AXM16511.1|1204790_1205468_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
AXM19114.1|1205547_1205937_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19115.1|1206150_1207038_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
AXM16512.1|1207471_1208456_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	6.3e-98
AXM16513.1|1208630_1210718_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AXM16514.1|1210869_1211529_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AXM16515.1|1211609_1212407_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM16516.1|1212429_1212609_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16517.1|1212627_1213032_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
AXM16518.1|1213065_1213425_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
AXM16519.1|1213668_1214541_-	ion transporter	NA	NA	NA	NA	NA
AXM16520.1|1214613_1215840_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
AXM16521.1|1216085_1216703_-	hydrolase	NA	NA	NA	NA	NA
AXM16522.1|1218263_1219847_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
AXM16523.1|1219843_1220269_+	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
AXM16524.1|1220293_1220797_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16525.1|1222239_1222689_+	azurin	NA	NA	NA	NA	NA
AXM16526.1|1225935_1227225_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AXM16527.1|1229235_1230690_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16528.1|1231186_1232056_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
AXM16529.1|1232077_1232749_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
AXM16530.1|1232745_1232967_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 12
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	1452532	1589614	4867200	transposase,tRNA	uncultured_Caudovirales_phage(16.0%)	107	NA	NA
AXM16681.1|1452532_1453498_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM16682.1|1453877_1454555_+	HAD family hydrolase	NA	NA	NA	NA	NA
AXM16683.1|1455092_1455317_-	putative selenoprotein	NA	NA	NA	NA	NA
AXM16684.1|1455316_1457389_-	carbon starvation protein A	NA	NA	NA	NA	NA
AXM16685.1|1457620_1458478_+	pirin family protein	NA	NA	NA	NA	NA
AXM19133.1|1459513_1461916_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
AXM16686.1|1461970_1462831_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM16687.1|1462791_1463478_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM19134.1|1463467_1464880_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AXM16688.1|1464889_1467313_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	2.4e-37
AXM16689.1|1467309_1468257_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM19135.1|1469250_1469799_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM19136.1|1470193_1470751_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM16690.1|1470800_1472909_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AXM16691.1|1472930_1474832_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.9e-30
AXM16692.1|1474886_1475747_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM16693.1|1475707_1476394_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM16694.1|1476857_1477091_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM19137.1|1477311_1477878_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM16695.1|1478080_1478668_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM19138.1|1478975_1479455_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM16696.1|1479451_1481860_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AXM16697.1|1482204_1482666_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16698.1|1482912_1483803_-	pirin family protein	NA	NA	NA	NA	NA
AXM16699.1|1483980_1484256_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19139.1|1484570_1485284_-	endonuclease V	NA	NA	NA	NA	NA
AXM16700.1|1485387_1486137_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AXM16701.1|1486497_1486749_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19140.1|1486933_1487968_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM16702.1|1488197_1490255_+	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.2e-79
AXM19141.1|1492202_1493324_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AXM16703.1|1493338_1494166_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AXM16704.1|1494149_1495433_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AXM16705.1|1495459_1495975_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM16706.1|1495985_1498142_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
AXM16707.1|1498209_1500207_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AXM16708.1|1500225_1500555_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
AXM16709.1|1501044_1504509_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AXM16710.1|1504911_1505454_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXM19142.1|1505865_1506774_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AXM16711.1|1507119_1507918_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM16712.1|1508061_1508781_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AXM16713.1|1508936_1509971_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM16714.1|1509991_1510804_-	peptidase C1	NA	NA	NA	NA	NA
AXM16715.1|1511539_1511923_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16716.1|1512045_1513215_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
AXM16717.1|1513209_1514268_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
AXM19143.1|1514328_1515141_-	peptidase C1	NA	NA	NA	NA	NA
AXM16718.1|1515656_1516040_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16719.1|1516189_1517353_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
AXM16720.1|1517383_1518196_-	peptidase C1	NA	NA	NA	NA	NA
AXM16721.1|1518426_1519014_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AXM16722.1|1519312_1520269_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM19144.1|1520342_1521074_+	nitrilase	NA	NA	NA	NA	NA
AXM16723.1|1521095_1522199_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
AXM16724.1|1522267_1523671_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AXM16725.1|1523684_1524191_+	transcriptional repressor	NA	NA	NA	NA	NA
AXM16726.1|1524596_1525055_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM16727.1|1525832_1526036_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16728.1|1527597_1528083_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
AXM16729.1|1528310_1528526_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
AXM16730.1|1528776_1529256_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AXM16731.1|1529387_1529816_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16732.1|1529888_1530719_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
AXM16733.1|1530780_1531548_-	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
AXM16734.1|1531547_1531763_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16735.1|1531908_1532700_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AXM19145.1|1532857_1534021_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXM16736.1|1536254_1536893_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AXM16737.1|1537068_1539009_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
AXM16738.1|1539225_1539780_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
AXM16739.1|1540001_1541432_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
AXM16740.1|1541498_1542953_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	5.7e-47
AXM19146.1|1543180_1543360_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16741.1|1543369_1544095_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
AXM16742.1|1544193_1544604_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXM16743.1|1544655_1545612_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
AXM16744.1|1545855_1548237_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM19147.1|1550884_1551295_+	MerC domain-containing protein	NA	NA	NA	NA	NA
AXM16745.1|1551594_1551777_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
AXM16746.1|1551909_1552950_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AXM16747.1|1553022_1554468_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
AXM16748.1|1555998_1556967_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM16749.1|1557317_1557863_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
AXM16750.1|1557859_1559323_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
AXM16751.1|1560783_1561038_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16752.1|1561440_1561974_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
AXM16753.1|1561999_1562401_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16754.1|1562369_1562750_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16755.1|1562746_1562989_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
AXM19148.1|1563025_1563679_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16756.1|1564355_1566260_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
AXM16757.1|1566523_1568920_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
AXM16758.1|1569069_1569792_+	pseudouridine synthase	NA	NA	NA	NA	NA
AXM16759.1|1572711_1573212_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
AXM16760.1|1573153_1574830_+	serine hydrolase	NA	NA	NA	NA	NA
AXM16761.1|1574976_1576242_+	cation:proton antiporter	NA	NA	NA	NA	NA
AXM16762.1|1576300_1577494_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
AXM16763.1|1577490_1578180_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
AXM19149.1|1578285_1579755_+	outer membrane channel protein	NA	NA	NA	NA	NA
AXM16764.1|1579774_1580611_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
AXM16765.1|1580636_1581740_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM16766.1|1581736_1584793_+	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AXM16767.1|1584858_1585449_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AXM16768.1|1585580_1587413_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
AXM16769.1|1587488_1588252_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM16770.1|1588294_1589614_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 13
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	1720428	1786289	4867200	transposase,tRNA	Bacillus_phage(20.0%)	43	NA	NA
AXM16857.1|1720428_1721664_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM16858.1|1721714_1722478_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM16859.1|1722544_1723921_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
AXM16860.1|1724299_1724974_+	7-cyano-7-deazaguanine synthase	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
AXM16861.1|1725604_1726009_-	response regulator	NA	NA	NA	NA	NA
AXM16862.1|1726087_1726585_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16863.1|1726723_1728520_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
AXM16864.1|1728632_1728860_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16865.1|1729075_1729621_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
AXM16866.1|1729722_1733844_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
AXM16867.1|1734064_1736707_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM16868.1|1738148_1739663_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
AXM16869.1|1739833_1740596_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM16870.1|1740907_1741420_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16871.1|1741482_1742601_-	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
AXM16872.1|1742597_1742876_-	pyrroloquinoline quinone biosynthesis protein PqqD	NA	NA	NA	NA	NA
AXM16873.1|1742872_1743625_-	pyrroloquinoline-quinone synthase	NA	NA	NA	NA	NA
AXM16874.1|1743621_1744521_-	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
AXM16875.1|1744604_1744685_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
AXM16876.1|1744974_1747161_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
AXM19156.1|1747457_1748900_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16877.1|1749232_1751335_-	glycosyltransferase	NA	NA	NA	NA	NA
AXM16878.1|1751576_1754021_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
AXM16879.1|1754034_1754559_+	hypothetical protein	NA	NA	NA	NA	NA
AXM16880.1|1754758_1756786_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
AXM16881.1|1756799_1757519_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AXM16882.1|1757515_1758430_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.5	1.2e-63
AXM16883.1|1758724_1759600_-	energy transducer TonB	NA	NA	NA	NA	NA
AXM16884.1|1759596_1760547_-	glutathione synthase	NA	NA	NA	NA	NA
AXM16885.1|1760796_1761198_+	response regulator	NA	NA	NA	NA	NA
AXM16886.1|1761215_1761578_+	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
AXM16887.1|1761577_1762108_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM16888.1|1762147_1764184_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
AXM16889.1|1764297_1771224_+	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
AXM16890.1|1771231_1772434_+	chemotaxis protein	NA	NA	NA	NA	NA
AXM16891.1|1772467_1772944_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM16892.1|1773194_1773818_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM19157.1|1773829_1774912_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM16893.1|1779533_1780598_+	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
AXM16894.1|1780594_1781326_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AXM16895.1|1781350_1783309_-	hypothetical protein	NA	NA	NA	NA	NA
AXM16896.1|1783450_1784554_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
AXM16897.1|1785053_1786289_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 14
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	1953075	2025315	4867200	coat,transposase,tRNA,protease	Emiliania_huxleyi_virus(20.0%)	59	NA	NA
AXM17016.1|1953075_1953838_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM17017.1|1954229_1956794_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
AXM17018.1|1957774_1958122_+	RidA family protein	NA	NA	NA	NA	NA
AXM17019.1|1958283_1959354_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM17020.1|1959371_1960154_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
AXM17021.1|1960150_1960696_-	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
AXM17022.1|1960692_1961988_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	3.9e-39
AXM17023.1|1961984_1962944_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
AXM17024.1|1962868_1964119_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXM19167.1|1964115_1965114_-	acyl-CoA desaturase	NA	G4YAW5	Emiliania_huxleyi_virus	30.6	2.3e-18
AXM17025.1|1965339_1966185_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17026.1|1966169_1966733_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXM17027.1|1966791_1967160_-	DUF4345 domain-containing protein	NA	NA	NA	NA	NA
AXM17028.1|1967245_1968028_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17029.1|1968251_1968434_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17030.1|1968646_1969075_-	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
AXM17031.1|1969076_1969673_-	HAD family hydrolase	NA	NA	NA	NA	NA
AXM17032.1|1969880_1971965_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
AXM17033.1|1972189_1972639_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
AXM17034.1|1973402_1974461_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM17035.1|1974731_1976129_+	S-methylmethionine permease	NA	NA	NA	NA	NA
AXM17036.1|1976125_1977103_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AXM17037.1|1977284_1979222_-	DUF885 family protein	NA	NA	NA	NA	NA
AXM17038.1|1979642_1980419_-	VUT family protein	NA	R4TNY5	Halovirus	27.2	1.9e-09
AXM19168.1|1980423_1981098_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
AXM19169.1|1982728_1984105_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
AXM17039.1|1984144_1984540_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
AXM17040.1|1984582_1986058_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
AXM19170.1|1987285_1987456_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
AXM17041.1|1991150_1991714_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19171.1|1992186_1993503_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
AXM17042.1|1993670_1994273_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM19172.1|1994346_1994793_+	CopD family protein	NA	NA	NA	NA	NA
AXM17043.1|1994870_1995137_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17044.1|1995126_1995342_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17045.1|1995958_1997302_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
AXM17046.1|1997238_1998651_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
AXM17047.1|1998647_1999385_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
AXM17048.1|1999384_2001565_-	ligand-gated channel	NA	NA	NA	NA	NA
AXM17049.1|2002404_2003364_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
AXM17050.1|2003539_2007130_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
AXM17051.1|2007587_2008328_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
AXM19173.1|2008324_2009581_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AXM17052.1|2009619_2010411_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AXM17053.1|2010434_2010896_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AXM17054.1|2010892_2011906_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AXM17055.1|2012305_2014759_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AXM17056.1|2014755_2016102_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AXM17057.1|2016128_2017319_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AXM17058.1|2017321_2018149_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AXM17059.1|2018145_2018907_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
AXM17060.1|2018924_2019482_-	ribosome recycling factor	NA	NA	NA	NA	NA
AXM17061.1|2019662_2020385_-	UMP kinase	NA	NA	NA	NA	NA
AXM17062.1|2020441_2020819_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
AXM17063.1|2020946_2021825_-	elongation factor Ts	NA	NA	NA	NA	NA
AXM17064.1|2021994_2022798_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AXM17065.1|2023173_2023899_-	molecular chaperone	NA	NA	NA	NA	NA
AXM17066.1|2023901_2024234_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17067.1|2024280_2025315_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 15
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	2080200	2200690	4867200	transposase,tRNA	Ralstonia_phage(17.39%)	90	NA	NA
AXM17105.1|2080200_2081520_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM17106.1|2081854_2082781_-	multidrug transporter	NA	NA	NA	NA	NA
AXM17107.1|2082910_2083516_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM17108.1|2083854_2085624_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
AXM19177.1|2085620_2086214_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
AXM17109.1|2086481_2087075_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
AXM17110.1|2087273_2088710_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
AXM17111.1|2088951_2090154_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AXM17112.1|2090196_2093025_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
AXM17113.1|2093205_2094138_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM17114.1|2094134_2095634_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM19178.1|2095971_2096235_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
AXM17115.1|2096514_2097015_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
AXM17116.1|2097256_2098624_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
AXM17117.1|2101647_2102410_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19179.1|2103862_2105266_+	class II fumarate hydratase	NA	NA	NA	NA	NA
AXM17118.1|2105388_2105811_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17119.1|2106443_2107280_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17120.1|2107289_2108276_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM17121.1|2108272_2109148_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
AXM17122.1|2109144_2109507_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXM17123.1|2109509_2109758_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17124.1|2109893_2110451_+	glutathione peroxidase	NA	NA	NA	NA	NA
AXM17125.1|2110542_2111508_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXM17126.1|2111533_2112883_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
AXM17127.1|2112875_2113112_+	protein SlyX	NA	NA	NA	NA	NA
AXM17128.1|2113112_2113865_+	DUF2058 family protein	NA	NA	NA	NA	NA
AXM17129.1|2114198_2115044_+	transporter	NA	NA	NA	NA	NA
AXM19180.1|2115184_2116360_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM17130.1|2116373_2117684_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AXM17131.1|2117608_2118667_+	carbohydrate kinase	NA	NA	NA	NA	NA
AXM17132.1|2118663_2119869_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
AXM17133.1|2120255_2123009_-	methionine synthase	NA	NA	NA	NA	NA
AXM17134.1|2123151_2124291_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
AXM17135.1|2124287_2125283_-	methyltransferase domain-containing protein	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
AXM19181.1|2125404_2126553_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXM17136.1|2126552_2126693_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXM19182.1|2126886_2127111_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17137.1|2127064_2128510_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
AXM17138.1|2129076_2131605_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
AXM17139.1|2131815_2132614_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM17140.1|2133684_2134452_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AXM17141.1|2134453_2134801_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17142.1|2134959_2135928_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM19183.1|2137280_2138246_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM19184.1|2138690_2139875_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXM17143.1|2139929_2141405_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
AXM17144.1|2141726_2141909_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
AXM17145.1|2142057_2143257_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AXM17146.1|2144117_2145086_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM17147.1|2145277_2146246_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXM17148.1|2147422_2148525_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
AXM19185.1|2148711_2149179_-	energy transducer TonB	NA	NA	NA	NA	NA
AXM17149.1|2149539_2150304_-	energy transducer TonB	NA	NA	NA	NA	NA
AXM17150.1|2150310_2151660_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
AXM17151.1|2151809_2152608_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM17152.1|2153047_2154367_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM17153.1|2154579_2155548_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXM17154.1|2155611_2156196_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AXM17155.1|2156295_2157309_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM19186.1|2158509_2158605_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17156.1|2158678_2162278_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AXM17157.1|2162417_2162717_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
AXM17158.1|2162720_2162915_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
AXM17159.1|2163183_2166906_-	avirulence protein	NA	NA	NA	NA	NA
AXM17160.1|2170173_2174301_-	avirulence protein	NA	NA	NA	NA	NA
AXM17161.1|2174589_2175909_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM17162.1|2177740_2178826_-	peptidase C13	NA	NA	NA	NA	NA
AXM17163.1|2179153_2179852_-	acireductone synthase	NA	NA	NA	NA	NA
AXM17164.1|2179854_2180421_-	acireductone dioxygenase	NA	NA	NA	NA	NA
AXM17165.1|2180432_2181110_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
AXM17166.1|2181198_2182629_-	amino acid permease	NA	NA	NA	NA	NA
AXM17167.1|2182705_2184187_-	amino acid permease	NA	NA	NA	NA	NA
AXM17168.1|2184323_2184911_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AXM17169.1|2185066_2186308_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
AXM17170.1|2186516_2187935_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXM17171.1|2187969_2188269_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
AXM17172.1|2188265_2190137_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
AXM17173.1|2190426_2191446_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AXM19187.1|2191439_2191850_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
AXM17174.1|2191867_2192470_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AXM19188.1|2192462_2194400_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
AXM17175.1|2194568_2195039_-	cytochrome c biogenesis protein CcmE	NA	NA	NA	NA	NA
AXM17176.1|2195035_2195206_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
AXM17177.1|2195202_2195955_-	heme ABC transporter permease	NA	NA	NA	NA	NA
AXM17178.1|2196049_2196745_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
AXM17179.1|2196741_2197386_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
AXM17180.1|2197612_2198761_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AXM17181.1|2198900_2199704_+	amidohydrolase	NA	NA	NA	NA	NA
AXM19189.1|2199724_2200690_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 16
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	2256251	2386174	4867200	transposase,tRNA,protease	Staphylococcus_prophage(15.79%)	105	NA	NA
AXM17221.1|2256251_2256764_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	40.4	2.9e-06
AXM17222.1|2256836_2257421_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	36.2	9.1e-20
AXM17223.1|2257632_2258619_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AXM17224.1|2258618_2261012_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	2.0e-174
AXM19193.1|2261153_2261975_+	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AXM17225.1|2262180_2262690_+	DUF1249 domain-containing protein	NA	NA	NA	NA	NA
AXM17226.1|2262774_2263263_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
AXM17227.1|2263659_2263851_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17228.1|2263971_2264379_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17229.1|2264554_2265523_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXM17230.1|2265619_2266939_+|transposase	IS701-like element ISXo15 family transposase	transposase	NA	NA	NA	NA
AXM17231.1|2267480_2268239_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
AXM19194.1|2268389_2268986_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AXM17232.1|2269041_2270268_+	class III poly(R)-hydroxyalkanoic acid synthase subunit PhaE	NA	NA	NA	NA	NA
AXM17233.1|2270264_2271341_+	class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC	NA	NA	NA	NA	NA
AXM17234.1|2271455_2271653_+	PspC domain-containing protein	NA	NA	NA	NA	NA
AXM19195.1|2271793_2272138_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17235.1|2272095_2273307_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXM19196.1|2273496_2273724_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17236.1|2273826_2276187_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AXM17237.1|2277508_2278075_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXM17238.1|2278071_2279301_-	sensor histidine kinase	NA	NA	NA	NA	NA
AXM17239.1|2279418_2280684_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
AXM17240.1|2280664_2281402_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AXM17241.1|2281542_2282706_-	MFS transporter	NA	NA	NA	NA	NA
AXM17242.1|2282868_2283825_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	2.4e-41
AXM17243.1|2284384_2284519_-	aspartate racemase	NA	NA	NA	NA	NA
AXM17244.1|2284515_2284674_-	pyridoxal phosphate biosynthetic protein	NA	NA	NA	NA	NA
AXM19197.1|2284709_2285579_-	DMT family transporter	NA	NA	NA	NA	NA
AXM17245.1|2285614_2286667_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
AXM17246.1|2286663_2287719_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AXM17247.1|2287724_2288498_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM17248.1|2288494_2288779_-	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
AXM17249.1|2289367_2290900_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AXM17250.1|2292203_2294711_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
AXM17251.1|2294707_2295676_+	homoserine kinase	NA	NA	NA	NA	NA
AXM19198.1|2298611_2298926_-	EthD family reductase	NA	NA	NA	NA	NA
AXM17252.1|2299087_2300392_+	threonine synthase	NA	NA	NA	NA	NA
AXM17253.1|2300494_2301238_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17254.1|2302502_2303915_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
AXM17255.1|2304420_2305219_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM17256.1|2305532_2305859_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM17257.1|2305868_2306783_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
AXM17258.1|2306779_2308075_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
AXM17259.1|2310293_2310515_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AXM17260.1|2310511_2311183_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
AXM17261.1|2312437_2313394_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM17262.1|2313808_2314777_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM17263.1|2314921_2315887_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM17264.1|2315864_2319965_-	RHS repeat protein	NA	NA	NA	NA	NA
AXM19199.1|2320273_2321458_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXM17265.1|2321508_2322408_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
AXM17266.1|2322574_2323081_+	glyoxalase	NA	NA	NA	NA	NA
AXM17267.1|2323555_2324188_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AXM17268.1|2324187_2326044_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
AXM17269.1|2326040_2327540_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17270.1|2327482_2327947_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AXM17271.1|2327943_2328723_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AXM17272.1|2329014_2330055_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AXM17273.1|2330051_2331821_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
AXM17274.1|2331817_2332282_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXM17275.1|2332285_2332948_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
AXM17276.1|2332976_2335385_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
AXM17277.1|2335638_2336604_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM17278.1|2337814_2337997_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17279.1|2337997_2338732_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
AXM17280.1|2338724_2339966_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
AXM17281.1|2339989_2340442_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17282.1|2340392_2340641_-	succinate dehydrogenase assembly factor 2 family protein	NA	NA	NA	NA	NA
AXM17283.1|2340751_2341534_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AXM17284.1|2341550_2341760_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17285.1|2341763_2343554_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AXM17286.1|2343588_2343975_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
AXM17287.1|2343971_2344367_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
AXM17288.1|2344426_2344693_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
AXM17289.1|2344636_2345509_+	folate-binding protein	NA	NA	NA	NA	NA
AXM17290.1|2345637_2346735_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
AXM17291.1|2347164_2348595_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
AXM17292.1|2348591_2349599_+	glucokinase	NA	NA	NA	NA	NA
AXM17293.1|2349595_2350315_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AXM17294.1|2350417_2352334_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AXM17295.1|2352389_2353049_+	keto-hydroxyglutarate-aldolase/keto-deoxy- phosphogluconate aldolase	NA	NA	NA	NA	NA
AXM17296.1|2354675_2354879_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17297.1|2355894_2356275_+	response regulator	NA	NA	NA	NA	NA
AXM17298.1|2356489_2359885_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
AXM17299.1|2361450_2362213_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM17300.1|2364108_2364342_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17301.1|2364508_2365483_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
AXM19200.1|2366246_2367128_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17302.1|2368828_2369962_+	phospholipase	NA	NA	NA	NA	NA
AXM17303.1|2370390_2370843_-	glutathione S-transferase	NA	NA	NA	NA	NA
AXM17304.1|2371161_2372679_-	fumarate hydratase	NA	NA	NA	NA	NA
AXM17305.1|2373012_2374893_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
AXM17306.1|2375081_2375861_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
AXM17307.1|2376011_2376497_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
AXM17308.1|2376474_2376723_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17309.1|2378953_2379193_-	HTH domain-containing protein	NA	NA	NA	NA	NA
AXM17310.1|2379444_2380158_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17311.1|2381682_2382183_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXM19201.1|2382344_2382923_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17312.1|2383014_2383515_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXM17313.1|2383581_2384415_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19202.1|2384465_2384780_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXM17314.1|2384963_2385152_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17315.1|2385565_2386174_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 17
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	2476287	2524383	4867200	transposase,tRNA	Moumouvirus(16.67%)	44	NA	NA
AXM17364.1|2476287_2477682_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
AXM17365.1|2477683_2477941_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17366.1|2477937_2478243_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17367.1|2478239_2478566_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17368.1|2479292_2479955_+	carbonate dehydratase	NA	NA	NA	NA	NA
AXM19212.1|2480043_2480574_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
AXM17369.1|2482797_2484069_+	kynureninase	NA	NA	NA	NA	NA
AXM17370.1|2484240_2485608_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
AXM17371.1|2485911_2487357_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AXM17372.1|2487353_2488040_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
AXM17373.1|2488012_2489032_+	aldo/keto reductase	NA	NA	NA	NA	NA
AXM17374.1|2489073_2489634_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
AXM17375.1|2489654_2490611_-	5'-nucleotidase	NA	NA	NA	NA	NA
AXM19213.1|2490778_2491555_-	NAD(+) kinase	NA	NA	NA	NA	NA
AXM17376.1|2492038_2494174_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AXM17377.1|2494170_2494362_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17378.1|2496136_2496643_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXM17379.1|2496683_2497211_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXM17380.1|2497207_2497699_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AXM17381.1|2497722_2498298_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AXM17382.1|2498374_2499328_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
AXM17383.1|2499416_2500289_-	sulfurtransferase	NA	NA	NA	NA	NA
AXM19214.1|2500285_2501053_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
AXM17384.1|2501243_2501942_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXM17385.1|2502105_2502888_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AXM17386.1|2502896_2503277_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17387.1|2503273_2503984_+	endonuclease III	NA	NA	NA	NA	NA
AXM17388.1|2505294_2505843_-	carbonic anhydrase	NA	NA	NA	NA	NA
AXM17389.1|2506014_2506983_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXM17390.1|2507587_2508823_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM17391.1|2509386_2509707_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17392.1|2510046_2511297_+	porin	NA	NA	NA	NA	NA
AXM19215.1|2511431_2512505_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.4	5.0e-48
AXM17393.1|2512692_2513784_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
AXM17394.1|2513896_2514871_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AXM17395.1|2514870_2515740_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
AXM17396.1|2515762_2516593_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
AXM17397.1|2516721_2517432_+	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AXM17398.1|2517564_2517972_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17399.1|2518249_2518891_+	ribonuclease T	NA	NA	NA	NA	NA
AXM17400.1|2518961_2520281_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM17401.1|2520517_2521579_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19216.1|2521629_2522814_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXM17402.1|2523063_2524383_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 18
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	2531102	2603429	4867200	transposase,tRNA,protease	uncultured_Mediterranean_phage(33.33%)	54	NA	NA
AXM17407.1|2531102_2532248_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
AXM17408.1|2532317_2533388_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AXM17409.1|2533574_2534006_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AXM17410.1|2534129_2535626_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AXM17411.1|2535585_2535900_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17412.1|2535970_2536678_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17413.1|2540053_2541175_-	phytase	NA	NA	NA	NA	NA
AXM19217.1|2543447_2543873_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM19218.1|2544065_2544698_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AXM17414.1|2545094_2545857_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM17415.1|2546137_2547169_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM17416.1|2547175_2548969_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AXM17417.1|2548965_2549250_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
AXM19219.1|2549240_2549423_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19220.1|2549481_2549967_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17418.1|2550025_2550532_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
AXM17419.1|2550528_2551149_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AXM17420.1|2551389_2553294_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
AXM17421.1|2553381_2554439_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM17422.1|2554536_2555856_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM17423.1|2556089_2557247_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
AXM19221.1|2557523_2558489_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM17424.1|2558466_2559942_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
AXM17425.1|2561758_2562727_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM17426.1|2563641_2564610_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM17427.1|2564877_2565117_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17428.1|2566991_2568212_-	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AXM17429.1|2568526_2569924_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AXM17430.1|2569934_2571155_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AXM17431.1|2571151_2571790_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17432.1|2571860_2572721_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXM17433.1|2572717_2573506_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
AXM17434.1|2573516_2574722_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
AXM17435.1|2574740_2575166_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
AXM17436.1|2575385_2576018_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM17437.1|2576042_2578415_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
AXM17438.1|2578572_2579778_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
AXM17439.1|2580098_2581430_+	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
AXM17440.1|2581426_2581777_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17441.1|2581808_2582216_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
AXM17442.1|2582212_2582539_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19222.1|2582570_2583947_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
AXM17443.1|2584183_2588350_+	type III effector	NA	NA	NA	NA	NA
AXM19223.1|2588462_2589092_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
AXM17444.1|2589198_2591127_-	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
AXM17445.1|2591289_2593650_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
AXM17446.1|2593933_2594902_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
AXM17447.1|2594959_2596081_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXM19224.1|2597508_2598261_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXM19225.1|2598341_2598560_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXM17448.1|2598840_2601123_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
AXM17449.1|2601266_2601587_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
AXM17450.1|2601837_2602296_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AXM17451.1|2602292_2603429_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 19
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	2685167	2710805	4867200	transposase	Bacillus_phage(50.0%)	17	NA	NA
AXM17519.1|2685167_2686487_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM17520.1|2686636_2687605_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXM17521.1|2689370_2689562_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17522.1|2697833_2698226_+	cytochrome c	NA	NA	NA	NA	NA
AXM17523.1|2698234_2698696_+	cytochrome c	NA	NA	NA	NA	NA
AXM17524.1|2699200_2699461_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17525.1|2699536_2699779_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17526.1|2700021_2700207_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17527.1|2700249_2700456_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19229.1|2701218_2702184_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM17528.1|2702190_2703489_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM17529.1|2703657_2705343_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
AXM19230.1|2705339_2707076_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
AXM17530.1|2707490_2707682_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17531.1|2707675_2708632_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
AXM17532.1|2709434_2709698_+	cytochrome D ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AXM19231.1|2709839_2710805_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 20
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	2727683	2788285	4867200	transposase,tRNA,protease	Moumouvirus(10.0%)	54	NA	NA
AXM17548.1|2727683_2729114_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
AXM17549.1|2729611_2730049_+	SufE family protein	NA	NA	NA	NA	NA
AXM17550.1|2730045_2731296_+	MFS transporter	NA	NA	NA	NA	NA
AXM17551.1|2731363_2732425_-	peptidase S41	NA	NA	NA	NA	NA
AXM17552.1|2732567_2733608_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AXM17553.1|2733698_2733980_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
AXM17554.1|2733976_2735326_+	dihydroorotase	NA	NA	NA	NA	NA
AXM17555.1|2735265_2736165_+	M23 family peptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.6e-13
AXM17556.1|2737063_2737826_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM17557.1|2737852_2738116_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17558.1|2738487_2738976_-	general stress protein	NA	NA	NA	NA	NA
AXM17559.1|2739199_2740519_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM17560.1|2740655_2741624_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM17561.1|2741823_2743140_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM17562.1|2743499_2744681_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
AXM17563.1|2744748_2744988_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17564.1|2746269_2747940_+	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
AXM17565.1|2748156_2748846_-	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
AXM19232.1|2748874_2749579_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AXM17566.1|2749652_2750372_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
AXM17567.1|2750402_2751752_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
AXM19233.1|2751759_2752596_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17568.1|2752754_2753321_-	elongation factor P	NA	NA	NA	NA	NA
AXM17569.1|2753422_2754451_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
AXM17570.1|2754669_2756787_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXM19234.1|2756783_2757704_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXM17571.1|2757764_2758529_-	RNA methyltransferase	NA	NA	NA	NA	NA
AXM17572.1|2758647_2759481_+	inositol monophosphatase	NA	NA	NA	NA	NA
AXM17573.1|2759733_2760345_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
AXM17574.1|2760599_2761040_+	ribonuclease	NA	NA	NA	NA	NA
AXM17575.1|2761036_2761462_+	barnase inhibitor	NA	NA	NA	NA	NA
AXM17576.1|2761910_2763806_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.4e-48
AXM17577.1|2763895_2765272_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	2.1e-54
AXM17578.1|2765374_2765935_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	1.6e-29
AXM17579.1|2766032_2767589_-	YdiU family protein	NA	NA	NA	NA	NA
AXM17580.1|2767872_2768748_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXM17581.1|2768948_2769647_-	glutathione S-transferase	NA	NA	NA	NA	NA
AXM17582.1|2769817_2770027_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	62.3	2.8e-16
AXM17583.1|2770296_2770782_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
AXM17584.1|2770852_2771401_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17585.1|2771397_2772579_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXM17586.1|2772802_2774872_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXM17587.1|2774971_2775850_-|protease	protease HtpX	protease	NA	NA	NA	NA
AXM17588.1|2775947_2776847_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AXM17589.1|2776934_2777675_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AXM19235.1|2777834_2778410_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
AXM17590.1|2778583_2779555_-	TraB/GumN family protein	NA	NA	NA	NA	NA
AXM17591.1|2779588_2780530_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
AXM17592.1|2780529_2782407_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
AXM17593.1|2782544_2784278_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
AXM17594.1|2784330_2784831_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AXM17595.1|2784827_2786315_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AXM17596.1|2786339_2787407_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AXM17597.1|2787521_2788285_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 21
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	2791480	2864489	4867200	transposase,tRNA,protease	Bacillus_phage(18.18%)	56	NA	NA
AXM17600.1|2791480_2792228_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM17601.1|2792544_2794380_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
AXM17602.1|2794651_2795743_+	ribonuclease D	NA	NA	NA	NA	NA
AXM17603.1|2795818_2796208_-	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
AXM17604.1|2796071_2796422_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17605.1|2796835_2797237_+	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AXM17606.1|2797743_2797878_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19236.1|2798100_2798280_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17607.1|2798881_2799172_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXM17608.1|2799159_2799438_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AXM19237.1|2799922_2800111_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AXM19238.1|2800883_2802068_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
AXM19239.1|2802648_2803614_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM17609.1|2808106_2808523_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
AXM17610.1|2808733_2809060_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17611.1|2809092_2809533_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
AXM17612.1|2809611_2810247_-	stringent starvation protein A	NA	NA	NA	NA	NA
AXM19240.1|2810640_2811384_-	cytochrome c1	NA	NA	NA	NA	NA
AXM17613.1|2811391_2812651_-	cytochrome b	NA	NA	NA	NA	NA
AXM17614.1|2812650_2813295_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AXM17615.1|2813824_2814811_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
AXM17616.1|2816746_2818201_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AXM17617.1|2818624_2819611_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
AXM17618.1|2820022_2820685_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17619.1|2820739_2821225_+	endoribonuclease YbeY	NA	NA	NA	NA	NA
AXM17620.1|2821224_2821743_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17621.1|2821837_2822716_+	CBS domain-containing protein	NA	NA	NA	NA	NA
AXM17622.1|2822712_2823993_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
AXM17623.1|2824008_2825010_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
AXM19241.1|2825161_2826526_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXM19242.1|2826780_2827191_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17624.1|2827346_2828177_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AXM17625.1|2828192_2828555_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
AXM17626.1|2828490_2829738_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
AXM17627.1|2829883_2831395_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17628.1|2831381_2832968_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AXM17629.1|2832964_2834167_-	HlyD family secretion protein	NA	NA	NA	NA	NA
AXM17630.1|2834673_2836062_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM17631.1|2836295_2837681_-	glutamine synthetase	NA	NA	NA	NA	NA
AXM17632.1|2838588_2839968_+	glutamine synthetase	NA	NA	NA	NA	NA
AXM17633.1|2839967_2841284_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXM17634.1|2841420_2842665_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.5e-19
AXM17635.1|2842972_2844253_-	MFS transporter	NA	NA	NA	NA	NA
AXM17636.1|2844558_2844867_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17637.1|2844826_2847175_-	CbbBc protein	NA	NA	NA	NA	NA
AXM17638.1|2847171_2848017_-	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AXM17639.1|2848023_2849733_-	MFS transporter	NA	NA	NA	NA	NA
AXM17640.1|2849875_2850058_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17641.1|2850090_2850853_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM17642.1|2851078_2852431_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AXM19243.1|2852491_2855629_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17643.1|2855795_2856650_+	plasmid replication/partition related protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
AXM17644.1|2856820_2858125_+	DUF445 family protein	NA	NA	NA	NA	NA
AXM17645.1|2858266_2862361_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.1e-55
AXM17646.1|2862394_2863381_+	two-component system response regulator	NA	W8CYM9	Bacillus_phage	26.8	2.8e-05
AXM17647.1|2863505_2864489_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.4e-97
>prophage 22
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	2876376	2961009	4867200	transposase	uncultured_Caudovirales_phage(50.0%)	56	NA	NA
AXM19244.1|2876376_2877342_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM17653.1|2878048_2879044_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM17654.1|2879204_2881721_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
AXM17655.1|2881717_2882674_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
AXM17656.1|2882832_2884575_+	PTS fructose transporter subunit EIIBC	NA	NA	NA	NA	NA
AXM19245.1|2884893_2886030_+	carbohydrate porin	NA	NA	NA	NA	NA
AXM19246.1|2886364_2887399_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM17657.1|2887812_2888781_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM17658.1|2889075_2891421_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19247.1|2891438_2892170_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17659.1|2892201_2894544_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17660.1|2894568_2895297_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17661.1|2895325_2897668_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19248.1|2897692_2898436_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17662.1|2898466_2901301_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17663.1|2901297_2902227_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM17664.1|2902235_2904998_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.2	1.5e-43
AXM17665.1|2909882_2910272_-	type VI secretion protein	NA	NA	NA	NA	NA
AXM17666.1|2910426_2911386_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM17667.1|2911318_2911633_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
AXM17668.1|2911860_2913180_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM17669.1|2914284_2914701_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
AXM17670.1|2914697_2915006_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19249.1|2914947_2915325_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17671.1|2915386_2916022_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17672.1|2916521_2917490_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM17673.1|2918068_2919037_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM19250.1|2920115_2923157_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM17674.1|2923523_2923712_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
AXM17675.1|2924206_2924659_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17676.1|2924913_2926719_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM17677.1|2926867_2927068_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17678.1|2927143_2927851_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
AXM17679.1|2928002_2928395_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM19251.1|2928417_2928933_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM17680.1|2928929_2929283_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17681.1|2929371_2930112_+	flagellar motor protein	NA	NA	NA	NA	NA
AXM17682.1|2930118_2931093_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
AXM17683.1|2931094_2931877_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
AXM17684.1|2931873_2932896_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM17685.1|2932996_2933305_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AXM17686.1|2933301_2933667_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
AXM17687.1|2933700_2935710_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
AXM19252.1|2937810_2938500_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	8.3e-12
AXM17688.1|2938815_2939577_+	transporter	NA	NA	NA	NA	NA
AXM17689.1|2939590_2941933_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	4.5e-09
AXM17690.1|2942429_2943395_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM17691.1|2943634_2945881_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	2.9e-13
AXM19253.1|2946609_2948721_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.2e-14
AXM17692.1|2949405_2951481_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
AXM17693.1|2952073_2954335_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
AXM17694.1|2954728_2956990_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
AXM17695.1|2957668_2957878_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17696.1|2957947_2958745_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AXM17697.1|2958880_2959363_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM17698.1|2960211_2961009_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 23
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	3040184	3051959	4867200	tRNA	Escherichia_phage(22.22%)	14	NA	NA
AXM17758.1|3040184_3040484_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
AXM17759.1|3040526_3040757_-	hypothetical protein	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
AXM17760.1|3041000_3041750_-	isopentenyl transferase	NA	NA	NA	NA	NA
AXM17761.1|3041754_3042450_-	DNA helicase	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
AXM17762.1|3042385_3042613_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19261.1|3042635_3042935_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17763.1|3043322_3043850_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	57.4	1.5e-34
AXM17764.1|3044452_3044665_-	carbon storage regulator	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
AXM17765.1|3044804_3047453_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
AXM17766.1|3047554_3048043_-	recombination regulator RecX	NA	NA	NA	NA	NA
AXM17767.1|3048093_3048297_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17768.1|3048345_3049380_-	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
AXM17769.1|3049552_3050194_-	LexA repressor 2	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
AXM19262.1|3050282_3051959_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 24
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	3092276	3160705	4867200	transposase,protease	Xanthomonas_phage(50.0%)	50	NA	NA
AXM17803.1|3092276_3093233_+|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM17804.1|3093331_3094444_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AXM17805.1|3094440_3095571_-	glycosyltransferase	NA	NA	NA	NA	NA
AXM17806.1|3095692_3096391_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM19269.1|3096387_3097623_-	amidohydrolase	NA	NA	NA	NA	NA
AXM17807.1|3097635_3098478_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM17808.1|3098758_3099610_-	chain-length determining protein	NA	NA	NA	NA	NA
AXM19270.1|3099655_3100789_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17809.1|3100785_3101736_-	glycosyltransferase	NA	NA	NA	NA	NA
AXM17810.1|3101732_3102986_-	O-antigen translocase	NA	NA	NA	NA	NA
AXM17811.1|3102982_3104095_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	28.4	1.4e-29
AXM17812.1|3104094_3105027_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM17813.1|3105013_3105967_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17814.1|3105970_3106642_-	sugar O-acyltransferase	NA	NA	NA	NA	NA
AXM17815.1|3106638_3107070_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
AXM19271.1|3107464_3107995_+	cytochrome b	NA	NA	NA	NA	NA
AXM17816.1|3108078_3109419_+	cytochrome C	NA	NA	NA	NA	NA
AXM17817.1|3109444_3109837_+	cytochrome c family protein	NA	NA	NA	NA	NA
AXM19272.1|3110279_3111068_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19273.1|3111131_3111713_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXM17818.1|3111604_3112366_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
AXM17819.1|3112362_3113688_+|protease	serine protease	protease	A0A217EQY2	Bacillus_phage	39.2	2.4e-23
AXM17820.1|3113698_3114457_+	heme ABC transporter permease	NA	NA	NA	NA	NA
AXM17821.1|3114453_3114660_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
AXM17822.1|3114656_3115127_+	cytochrome c-type biogenesis protein CcmE 1	NA	NA	NA	NA	NA
AXM17823.1|3115190_3117179_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
AXM17824.1|3117175_3117718_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AXM19274.1|3117717_3118215_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
AXM17825.1|3118214_3118919_+	C-type cytochrome biogenesis protein	NA	NA	NA	NA	NA
AXM17826.1|3119127_3122847_+	avirulence protein	NA	NA	NA	NA	NA
AXM17827.1|3123115_3123310_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
AXM17828.1|3123313_3123613_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
AXM17829.1|3123836_3128288_+	avirulence protein	NA	NA	NA	NA	NA
AXM17830.1|3128556_3128751_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
AXM17831.1|3128754_3129054_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
AXM17832.1|3129277_3133927_+	avirulence protein	NA	NA	NA	NA	NA
AXM17833.1|3134989_3136465_-|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	5.4e-101
AXM17834.1|3136547_3139136_-	hydrophobe/amphiphile efflux-1 family RND transporter	NA	NA	NA	NA	NA
AXM17835.1|3139192_3140305_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM17836.1|3140429_3141008_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM17837.1|3142494_3144582_+	type III effector	NA	NA	NA	NA	NA
AXM17838.1|3144967_3146065_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM17839.1|3146481_3149562_+	histidine kinase	NA	NA	NA	NA	NA
AXM19275.1|3152597_3153305_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXM17840.1|3153301_3154294_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AXM17841.1|3154290_3156750_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
AXM17842.1|3156863_3157844_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM17843.1|3157852_3158881_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AXM17844.1|3159047_3159845_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM17845.1|3159907_3160705_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 25
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	3170131	3232232	4867200	transposase,plate	Ralstonia_phage(85.71%)	49	NA	NA
AXM17852.1|3170131_3171469_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXM17853.1|3171465_3172857_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AXM17854.1|3172853_3173393_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17855.1|3173401_3175339_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
AXM17856.1|3175603_3176062_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17857.1|3176448_3176775_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17858.1|3177008_3177506_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17859.1|3177694_3180400_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	4.3e-80
AXM17860.1|3180432_3181443_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXM17861.1|3181406_3183284_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXM17862.1|3183287_3183791_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXM17863.1|3183778_3184612_-	ImpE protein	NA	NA	NA	NA	NA
AXM17864.1|3184647_3185151_-	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
AXM17865.1|3185250_3186765_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AXM19276.1|3186757_3187264_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AXM17866.1|3188622_3189591_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM17867.1|3189726_3191043_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM17868.1|3191213_3192449_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM17869.1|3192634_3193603_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM17870.1|3193654_3195571_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17871.1|3195595_3196333_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17872.1|3196363_3198706_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19277.1|3198723_3199470_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17873.1|3199498_3202333_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17874.1|3202990_3204820_-	transmembrane repetitive protein	NA	NA	NA	NA	NA
AXM17875.1|3204833_3205433_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
AXM17876.1|3205520_3205877_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AXM17877.1|3205873_3206296_+	energy transducer TonB	NA	NA	NA	NA	NA
AXM17878.1|3206311_3206545_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AXM17879.1|3206571_3206832_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AXM17880.1|3207180_3208965_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AXM17881.1|3208997_3209984_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AXM17882.1|3210394_3214108_+	ribonuclease E/G	NA	NA	NA	NA	NA
AXM17883.1|3214633_3215397_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM17884.1|3215500_3216148_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXM17885.1|3216369_3217131_-	sulfurtransferase	NA	NA	NA	NA	NA
AXM17886.1|3217288_3218257_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM17887.1|3218390_3218756_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17888.1|3218814_3219246_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXM17889.1|3219257_3220520_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
AXM17890.1|3220503_3221796_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
AXM17891.1|3222165_3222936_+	phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AXM17892.1|3223692_3224928_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXM19278.1|3226227_3226485_-	stress-induced protein	NA	NA	NA	NA	NA
AXM17893.1|3226924_3227908_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
AXM17894.1|3228223_3229192_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM17895.1|3229320_3230283_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM17896.1|3230722_3230902_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17897.1|3231266_3232232_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 26
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	3241276	3309202	4867200	transposase	Acinetobacter_phage(33.33%)	44	NA	NA
AXM19279.1|3241276_3241483_-|transposase	transposase	transposase	NA	NA	NA	NA
AXM17904.1|3241531_3242767_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM19280.1|3243604_3244639_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM17905.1|3245314_3247690_-	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
AXM19281.1|3249900_3251085_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	8.5e-41
AXM19282.1|3251012_3251606_-	hypothetical protein	NA	A0A0P0I887	Acinetobacter_phage	33.0	1.6e-11
AXM17906.1|3251590_3252022_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM17907.1|3252266_3252479_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17908.1|3252518_3254864_-	S9 family peptidase	NA	NA	NA	NA	NA
AXM17909.1|3255185_3256772_-	glycosyl hydrolase family 43	NA	NA	NA	NA	NA
AXM17910.1|3256768_3261133_-	carbohydrate-binding protein	NA	NA	NA	NA	NA
AXM17911.1|3261371_3264209_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	3.2e-49
AXM17912.1|3264709_3267067_-	Tat pathway signal protein	NA	NA	NA	NA	NA
AXM17913.1|3267530_3269102_+	peptidase S53	NA	A0A1V0SLL0	Klosneuvirus	37.4	6.8e-70
AXM17914.1|3269308_3269605_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17915.1|3269601_3269946_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17916.1|3269949_3270540_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17917.1|3270581_3270788_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17918.1|3271034_3271322_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17919.1|3271318_3273658_-	S9 family peptidase	NA	NA	NA	NA	NA
AXM17920.1|3273647_3275234_-	amino acid permease	NA	NA	NA	NA	NA
AXM17921.1|3275296_3277162_-	DUF885 family protein	NA	NA	NA	NA	NA
AXM17922.1|3277158_3278991_-	DUF885 family protein	NA	NA	NA	NA	NA
AXM17923.1|3279108_3280308_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
AXM17924.1|3280304_3281921_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AXM17925.1|3282131_3283040_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AXM17926.1|3283036_3284371_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXM17927.1|3284342_3284588_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AXM17928.1|3284584_3285847_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXM17929.1|3285846_3286785_-	hydroxyproline-2-epimerase	NA	NA	NA	NA	NA
AXM17930.1|3286942_3287659_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXM17931.1|3287863_3289480_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
AXM17932.1|3289958_3291032_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AXM17933.1|3291055_3291334_+	Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
AXM17934.1|3291698_3293321_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AXM17935.1|3296233_3296722_-	hypothetical protein	NA	NA	NA	NA	NA
AXM17936.1|3298233_3298476_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19283.1|3299202_3299412_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17937.1|3299491_3300415_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AXM17938.1|3300411_3301011_-	transcriptional regulator	NA	NA	NA	NA	NA
AXM17939.1|3301345_3301666_+	hypothetical protein	NA	NA	NA	NA	NA
AXM17940.1|3302254_3303286_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM19284.1|3304792_3305329_+	hypothetical protein	NA	A0A2I2L3Z7	Orpheovirus	33.8	4.0e-14
AXM19285.1|3308119_3309202_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 27
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	3385749	3446125	4867200	transposase,tRNA,protease	Burkholderia_virus(14.29%)	52	NA	NA
AXM18002.1|3385749_3386513_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM18003.1|3387536_3389903_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXM19292.1|3389899_3390574_-	methylamine utilization protein	NA	NA	NA	NA	NA
AXM18004.1|3390783_3391722_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
AXM18005.1|3391844_3393194_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AXM18006.1|3393190_3394078_-	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AXM18007.1|3394395_3395202_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AXM18008.1|3395647_3396865_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AXM18009.1|3396970_3397939_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
AXM18010.1|3398281_3398950_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AXM18011.1|3398946_3399720_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AXM19293.1|3400293_3402360_-	ferrous iron transporter B	NA	NA	NA	NA	NA
AXM18012.1|3402926_3403952_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXM18013.1|3404036_3405110_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
AXM18014.1|3405102_3406206_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
AXM18015.1|3406216_3407143_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AXM18016.1|3407223_3407874_+	SCO family protein	NA	NA	NA	NA	NA
AXM18017.1|3407870_3408719_+	phosphatidylserine decarboxylase proenzyme	NA	NA	NA	NA	NA
AXM18018.1|3409269_3410853_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
AXM19294.1|3410772_3410958_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18019.1|3412275_3413493_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXM18020.1|3413453_3413675_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19295.1|3413851_3414358_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
AXM18021.1|3414479_3415880_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AXM18022.1|3416142_3416718_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
AXM18023.1|3416714_3417149_+	HIT family protein	NA	NA	NA	NA	NA
AXM18024.1|3417176_3417344_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18025.1|3417307_3417511_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18026.1|3418058_3418244_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18027.1|3418278_3418848_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
AXM18028.1|3418940_3419792_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AXM18029.1|3421179_3423195_+	M13 family peptidase	NA	NA	NA	NA	NA
AXM18030.1|3423465_3424164_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXM18031.1|3424204_3424612_-	cysteine methyltransferase	NA	NA	NA	NA	NA
AXM18032.1|3425049_3426012_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM18033.1|3427295_3428546_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXM18034.1|3428553_3429798_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
AXM18035.1|3430025_3430505_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXM19296.1|3430615_3431152_+	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
AXM18036.1|3431261_3432011_+	NlpC/P60 family protein	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
AXM18037.1|3432218_3432710_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AXM18038.1|3433823_3435143_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AXM18039.1|3435286_3436993_+	alkaline phosphatase	NA	NA	NA	NA	NA
AXM18040.1|3437026_3438331_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AXM18041.1|3438362_3438623_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AXM18042.1|3438624_3439500_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
AXM19297.1|3441334_3441799_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
AXM18043.1|3441850_3442039_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18044.1|3442011_3442332_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19298.1|3442328_3443696_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AXM18045.1|3443841_3444423_+	ribosome-associated protein	NA	NA	NA	NA	NA
AXM18046.1|3444679_3446125_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 28
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	3465225	3513927	4867200	transposase,integrase,tRNA	Ralstonia_phage(33.33%)	41	3488044:3488103	3504714:3505377
AXM18059.1|3465225_3467868_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
AXM18060.1|3467940_3468552_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
AXM18061.1|3468756_3469614_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
AXM18062.1|3469869_3470319_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AXM19299.1|3470618_3471584_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM18063.1|3471708_3472471_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM18064.1|3472528_3472717_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18065.1|3473081_3473375_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18066.1|3473848_3474082_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
AXM18067.1|3474115_3475129_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXM18068.1|3475096_3475288_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18069.1|3475378_3476698_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM18070.1|3476785_3478000_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
AXM18071.1|3478145_3478673_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18072.1|3478669_3479635_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM18073.1|3479875_3480638_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM18074.1|3480940_3483073_+	glycogen debranching enzyme GlgX	NA	NA	NA	NA	NA
AXM18075.1|3483623_3484592_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXM18076.1|3484783_3485752_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM19300.1|3485896_3486862_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM18077.1|3486827_3487241_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AXM18078.1|3487237_3488001_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3488044:3488103	attL	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTC	NA	NA	NA	NA
AXM18079.1|3488872_3489670_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM18080.1|3489703_3490096_-	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AXM18081.1|3490186_3490579_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19301.1|3492917_3493337_+|integrase	integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
AXM18082.1|3494564_3494789_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18083.1|3495053_3496838_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
AXM18084.1|3497028_3497229_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AXM18085.1|3497764_3498559_+	thiazole synthase	NA	NA	NA	NA	NA
AXM18086.1|3498551_3498845_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18087.1|3498860_3499619_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AXM18088.1|3499694_3501557_+	SLC13 family permease	NA	NA	NA	NA	NA
AXM19302.1|3501614_3501956_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AXM18089.1|3502215_3502491_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18090.1|3505537_3506251_+	FAA hydrolase family protein	NA	NA	NA	NA	NA
3504714:3505377	attR	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTCAGCACAAGCCCAAACGCGGATGACGGCGTACAACGGCGGCCACACGCAGCTGGGTGCCGGAGGAGTTGCGGATTGTGCATCGCCCCGAAGAAGTGCAGACGCGCTTGGTCCCAGGTCATTGGGAAGGCGACTTGATCAAGGGCGCATTCAATCGTTCTTGCGTGGGCACGTTGGTGGAACGCAAGACGCGCTTTGTCGTGCTGTGCCGCATGGATGGCTGCACGGCCGCAGATGCGCTGGAAGGGTTTACCCGGCAAATGAAGAAACTGCCGGCCTCAATGCGGACAAGTCTGACCTACGATCGCGGTACCGAGCTCACGTGCTACGCCGAGCTGATGCAAGGATTGAACATCGACGTGTGGTTCGCTGATCCACATGCGCCGTGGCAGCGGGGAAGTAACGAGAACACCAACGGCCTGCTGCGCCAATTCCTGCCCAAGGGCGCCGACCTGTCCACTGTCAGCCAAGAGTATCTCAATCACATCGCACTGCTGATGAATACCCGCCCTCGTCAGACGCTCGGATGGAAGACACCAAGCGAGGCAATGGAGGAAGAAATCGCAGCACTCAAATCACGTGTTGCACTTGAATCTTGAGACTGCCC	NA	NA	NA	NA
AXM18091.1|3506311_3506734_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
AXM18092.1|3506865_3507629_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM18093.1|3510702_3511614_-	RNA methyltransferase	NA	NA	NA	NA	NA
AXM19303.1|3512129_3512267_-	acetyltransferase	NA	NA	NA	NA	NA
AXM19304.1|3512961_3513927_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 29
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	3561377	3603316	4867200	transposase,protease	Ralstonia_phage(44.44%)	32	NA	NA
AXM18122.1|3561377_3562346_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXM19307.1|3563366_3564401_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM18123.1|3564784_3565510_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXM18124.1|3565641_3566103_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19308.1|3569549_3571670_-	S9 family peptidase	NA	NA	NA	NA	NA
AXM18125.1|3571936_3572782_-	transporter	NA	NA	NA	NA	NA
AXM18126.1|3573038_3573401_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18127.1|3573773_3574742_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM18128.1|3575066_3577037_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
AXM18129.1|3577465_3578863_+|protease	serine protease	protease	NA	NA	NA	NA
AXM19309.1|3578975_3579794_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
AXM19310.1|3580104_3583302_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.0e-81
AXM19311.1|3583342_3583525_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18130.1|3583537_3584956_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
AXM19312.1|3584965_3585568_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
AXM18131.1|3585617_3586223_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
AXM18132.1|3586372_3586594_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXM18133.1|3586603_3587029_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
AXM18134.1|3587520_3588318_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM18135.1|3589395_3590175_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AXM18136.1|3590389_3591019_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM18137.1|3591079_3591835_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19313.1|3592163_3592940_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18138.1|3592936_3593179_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18139.1|3593348_3594923_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AXM19314.1|3595171_3595438_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18140.1|3595716_3598896_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	1.2e-73
AXM18141.1|3598961_3599930_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.3e-100
AXM18142.1|3600055_3600730_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18143.1|3600729_3601476_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18144.1|3601472_3602345_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AXM18145.1|3602347_3603316_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 30
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	3619580	3691822	4867200	transposase,plate	Ralstonia_phage(33.33%)	46	NA	NA
AXM18157.1|3619580_3620537_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
AXM18158.1|3620511_3622950_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18159.1|3622861_3623893_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18160.1|3623901_3625839_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18161.1|3625750_3626770_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18162.1|3626774_3628718_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18163.1|3628629_3629652_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18164.1|3631623_3632649_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18165.1|3632652_3635520_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18166.1|3635538_3636384_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM18167.1|3636385_3639148_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	9.6e-43
AXM18168.1|3639240_3639594_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18169.1|3639624_3642354_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
AXM18170.1|3642439_3643531_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXM18171.1|3643494_3645330_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXM18172.1|3645332_3645821_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXM18173.1|3645968_3646466_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AXM18174.1|3646607_3648104_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AXM18175.1|3648107_3648608_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AXM19317.1|3648654_3649143_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18176.1|3649529_3650138_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AXM18177.1|3650289_3651624_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXM18178.1|3651623_3652412_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AXM19318.1|3652518_3655140_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AXM18179.1|3655136_3656114_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18180.1|3656672_3658841_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AXM18181.1|3658865_3661760_+	calcium-binding protein	NA	A0A2D1GNI0	Pseudomonas_phage	27.5	7.5e-06
AXM18182.1|3662415_3663378_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM18183.1|3663674_3665108_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AXM18184.1|3666872_3667841_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM18185.1|3667843_3668527_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18186.1|3669088_3671341_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AXM18187.1|3671400_3672885_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18188.1|3673347_3673542_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18189.1|3673540_3674755_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	2.4e-54
AXM18190.1|3674781_3675321_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18191.1|3675429_3675735_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18192.1|3675731_3676811_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18193.1|3677795_3678584_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AXM18194.1|3680968_3681358_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
AXM18195.1|3681338_3683501_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AXM18196.1|3683569_3684166_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM18197.1|3684158_3684983_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM18198.1|3684979_3687649_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.3	6.6e-41
AXM18199.1|3688563_3689532_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM18200.1|3690853_3691822_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 31
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	4058485	4153609	4867200	transposase,tRNA	Ralstonia_phage(17.65%)	66	NA	NA
AXM19355.1|4058485_4060093_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM18496.1|4060290_4060518_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
AXM18497.1|4060522_4061182_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
AXM18498.1|4061368_4062733_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AXM18499.1|4062948_4063644_+	VIT family protein	NA	NA	NA	NA	NA
AXM18500.1|4064590_4065214_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AXM19356.1|4065415_4066156_+	cytochrome c4	NA	NA	NA	NA	NA
AXM18501.1|4066249_4066900_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
AXM18502.1|4066991_4067807_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
AXM19357.1|4067856_4068594_+	EEP domain-containing protein	NA	NA	NA	NA	NA
AXM18503.1|4070522_4071512_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
AXM18504.1|4071634_4074208_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
AXM18505.1|4074400_4075163_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM18506.1|4075236_4076205_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM18507.1|4076938_4077205_+|transposase	transposase	transposase	NA	NA	NA	NA
AXM18508.1|4078136_4078935_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19358.1|4080581_4081814_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	K4IEX3	Salmonella_phage	41.7	2.0e-72
AXM18509.1|4081853_4082816_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM18510.1|4082991_4083948_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM18511.1|4084159_4085128_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM18512.1|4085463_4086226_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM18513.1|4089636_4090602_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM18514.1|4091063_4091294_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18515.1|4091918_4093961_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
AXM18516.1|4093962_4095861_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
AXM18517.1|4095862_4097116_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
AXM18518.1|4097112_4097718_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
AXM18519.1|4098137_4099292_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AXM18520.1|4099294_4100323_-	SIS domain-containing protein	NA	NA	NA	NA	NA
AXM18521.1|4100319_4101396_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM18522.1|4101436_4102714_-	glucose/galactose MFS transporter	NA	NA	NA	NA	NA
AXM18523.1|4102758_4103526_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXM18524.1|4103740_4104907_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
AXM18525.1|4107450_4110348_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
AXM18526.1|4110498_4113189_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM18527.1|4113470_4114427_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.6e-42
AXM18528.1|4114460_4114673_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18529.1|4114917_4116153_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM18530.1|4117588_4118773_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM18531.1|4118840_4119578_+	pteridine reductase	NA	NA	NA	NA	NA
AXM18532.1|4119746_4120262_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AXM18533.1|4120353_4121856_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
AXM18534.1|4121859_4122300_-	response regulator	NA	NA	NA	NA	NA
AXM18535.1|4122296_4124108_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
AXM19359.1|4124393_4124756_-	BON domain-containing protein	NA	NA	NA	NA	NA
AXM18536.1|4124915_4125968_+	oxidoreductase	NA	NA	NA	NA	NA
AXM18537.1|4126307_4127249_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
AXM18538.1|4127269_4128607_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18539.1|4128778_4129159_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AXM18540.1|4129283_4130045_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
AXM18541.1|4132293_4133697_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
AXM18542.1|4133819_4134875_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
AXM19360.1|4135047_4135902_+	endonuclease	NA	NA	NA	NA	NA
AXM18543.1|4136193_4138377_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
AXM19361.1|4138875_4139871_-	restriction endonuclease	NA	NA	NA	NA	NA
AXM18544.1|4139966_4141778_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM18545.1|4142022_4143036_-	lipoyl synthase	NA	NA	NA	NA	NA
AXM18546.1|4143050_4143749_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
AXM18547.1|4143736_4144015_-	DUF493 family protein	NA	NA	NA	NA	NA
AXM18548.1|4145080_4146286_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
AXM18549.1|4146394_4146676_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18550.1|4146786_4148202_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
AXM18551.1|4148198_4149338_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AXM18552.1|4151077_4152352_-	DUF3380 domain-containing protein	NA	B3FJ91	Pseudomonas_phage	33.7	1.2e-21
AXM18553.1|4152351_4152570_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18554.1|4152646_4153609_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
>prophage 32
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	4179578	4262693	4867200	transposase,protease	Erwinia_phage(16.67%)	58	NA	NA
AXM18572.1|4179578_4180946_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
AXM18573.1|4181056_4181608_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AXM19363.1|4182123_4183041_-	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	27.7	2.2e-12
AXM18574.1|4183240_4183921_-	DUF484 family protein	NA	NA	NA	NA	NA
AXM18575.1|4183908_4184763_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
AXM18576.1|4184752_4184989_-	sugar transporter	NA	NA	NA	NA	NA
AXM18577.1|4185046_4185445_-	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AXM18578.1|4185817_4187953_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
AXM18579.1|4188076_4189261_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AXM19364.1|4189586_4190018_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18580.1|4190100_4192194_-	S9 family peptidase	NA	NA	NA	NA	NA
AXM18581.1|4192261_4192573_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18582.1|4192960_4193530_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18583.1|4193638_4194604_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
AXM18584.1|4195162_4195963_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
AXM18585.1|4196513_4197428_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AXM18586.1|4197458_4198196_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXM18587.1|4198226_4199279_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
AXM18588.1|4199283_4199952_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXM18589.1|4200103_4202041_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
AXM18590.1|4202767_4203530_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM18591.1|4203656_4203917_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18592.1|4203844_4205494_-	peptidase M20	NA	NA	NA	NA	NA
AXM18593.1|4206884_4208372_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	1.0e-123
AXM19365.1|4208579_4210034_+	endoglucanase	NA	H2DE45	Erwinia_phage	32.3	7.5e-47
AXM18594.1|4211268_4213893_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
AXM18595.1|4214148_4217019_+	insulinase family protein	NA	NA	NA	NA	NA
AXM18596.1|4217566_4218496_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AXM18597.1|4218534_4219539_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18598.1|4219781_4220545_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19366.1|4221592_4222378_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
AXM18599.1|4222400_4222607_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18600.1|4222631_4224305_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
AXM18601.1|4224848_4225295_-	autotransporter	NA	NA	NA	NA	NA
AXM18602.1|4225625_4225910_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18603.1|4226504_4227416_-	magnesium transporter	NA	NA	NA	NA	NA
AXM18604.1|4227661_4228657_+	type III secretion system effector protein	NA	NA	NA	NA	NA
AXM19367.1|4228750_4230127_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
AXM18605.1|4231293_4232994_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
AXM18606.1|4233402_4235175_+	cellulase	NA	NA	NA	NA	NA
AXM19368.1|4235450_4236335_-	DMT family transporter	NA	NA	NA	NA	NA
AXM19369.1|4236523_4237402_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM18607.1|4239441_4240533_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
AXM18608.1|4242435_4244760_+	S9 family peptidase	NA	NA	NA	NA	NA
AXM18609.1|4244955_4246902_-	S9 family peptidase	NA	NA	NA	NA	NA
AXM18610.1|4247276_4247468_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18611.1|4247858_4249442_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
AXM19370.1|4249789_4250386_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18612.1|4251734_4252583_-	threonine aldolase	NA	NA	NA	NA	NA
AXM18613.1|4252617_4254093_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
AXM18614.1|4254683_4255613_-	lipid kinase YegS	NA	NA	NA	NA	NA
AXM18615.1|4255847_4256339_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM19371.1|4256335_4257007_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AXM18616.1|4257401_4257731_-	J domain-containing protein	NA	NA	NA	NA	NA
AXM18617.1|4257933_4258866_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
AXM18618.1|4259492_4260449_+|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM18619.1|4260712_4261511_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19372.1|4261658_4262693_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 33
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	4283580	4325288	4867200	transposase,tRNA	Ralstonia_phage(50.0%)	38	NA	NA
AXM19373.1|4283580_4284546_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM18635.1|4285078_4285459_+	peptide-binding protein	NA	NA	NA	NA	NA
AXM18636.1|4285661_4286567_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18637.1|4286635_4287931_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
AXM19374.1|4288021_4288585_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18638.1|4289010_4290276_-	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
AXM18639.1|4290272_4291250_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18640.1|4291353_4292157_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AXM18641.1|4292332_4293142_+	glycosyl transferase	NA	NA	NA	NA	NA
AXM18642.1|4293149_4293948_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19375.1|4293990_4294638_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18643.1|4294732_4295308_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18644.1|4295519_4296839_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM18645.1|4296988_4297957_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM18646.1|4298082_4298835_-	HAD family hydrolase	NA	NA	NA	NA	NA
AXM18647.1|4298872_4299313_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
AXM19376.1|4299519_4299861_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
AXM18648.1|4300086_4300464_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19377.1|4300674_4300872_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
AXM18649.1|4301178_4301925_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
AXM18650.1|4302017_4302824_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AXM19378.1|4303047_4304460_+	NlpC-P60 family protein	NA	NA	NA	NA	NA
AXM18651.1|4304456_4305554_+	dipeptide epimerase	NA	NA	NA	NA	NA
AXM18652.1|4305708_4306507_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM18653.1|4306560_4307359_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM18654.1|4307578_4308541_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM18655.1|4308988_4309752_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM18656.1|4310033_4310810_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18657.1|4310806_4312123_+	amino acid permease	NA	NA	NA	NA	NA
AXM18658.1|4312639_4313875_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM18659.1|4314468_4314750_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18660.1|4315310_4315745_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18661.1|4315919_4317098_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
AXM18662.1|4317133_4317460_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18663.1|4318093_4319056_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM18664.1|4321389_4323561_-	beta-glucosidase	NA	NA	NA	NA	NA
AXM18665.1|4323788_4324145_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AXM18666.1|4324223_4325288_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
>prophage 34
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	4348238	4406753	4867200	transposase,tRNA	Acinetobacter_phage(33.33%)	46	NA	NA
AXM18686.1|4348238_4349217_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
AXM19380.1|4349296_4350262_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM18687.1|4350274_4350745_-	bacterioferritin	NA	NA	NA	NA	NA
AXM19381.1|4351087_4351303_-	bacterioferritin	NA	NA	NA	NA	NA
AXM18688.1|4351383_4352001_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AXM18689.1|4352549_4352942_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AXM18690.1|4352945_4353374_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AXM19382.1|4353559_4354213_+	demethoxyubiquinone hydroxylase family protein	NA	NA	NA	NA	NA
AXM18691.1|4354492_4354807_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AXM18692.1|4354966_4355761_-	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AXM18693.1|4355898_4356591_+	CRP-like protein Clp	NA	NA	NA	NA	NA
AXM18694.1|4356911_4357628_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
AXM18695.1|4357620_4358418_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
AXM18696.1|4358554_4359592_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
AXM18697.1|4359709_4360339_-	flavin reductase family protein	NA	NA	NA	NA	NA
AXM18698.1|4360335_4360494_-	molybdopterin biosynthesis protein	NA	NA	NA	NA	NA
AXM18699.1|4360490_4361072_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
AXM18700.1|4364206_4366438_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
AXM19383.1|4366627_4368340_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18701.1|4368488_4369865_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.4e-79
AXM18702.1|4372072_4372871_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM18703.1|4373855_4374824_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXM18704.1|4374990_4375962_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
AXM18705.1|4376154_4377339_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXM18706.1|4377806_4378622_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
AXM18707.1|4379380_4380697_-	amidohydrolase	NA	NA	NA	NA	NA
AXM18708.1|4380956_4382201_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM18709.1|4382293_4385542_+	acriflavine resistance protein B	NA	NA	NA	NA	NA
AXM18710.1|4385675_4388816_+	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AXM18711.1|4389105_4390473_-	VOC family protein	NA	NA	NA	NA	NA
AXM18712.1|4390482_4390692_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18713.1|4391217_4392183_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM18714.1|4392601_4393567_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM19384.1|4394029_4394500_+	thioesterase	NA	NA	NA	NA	NA
AXM18715.1|4394528_4394951_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18716.1|4395026_4395461_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AXM18717.1|4395570_4396086_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
AXM18718.1|4396101_4397127_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AXM18719.1|4397449_4398046_-	Ax21 family protein	NA	NA	NA	NA	NA
AXM18720.1|4398403_4400131_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AXM18721.1|4400180_4401623_+	sensor histidine kinase	NA	NA	NA	NA	NA
AXM18722.1|4401607_4402954_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXM18723.1|4403144_4403894_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18724.1|4403995_4404607_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18725.1|4404711_4405935_+	MFS transporter	NA	NA	NA	NA	NA
AXM18726.1|4406276_4406753_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 35
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	4419620	4477552	4867200	integrase,transposase	Leptospira_phage(25.0%)	38	4419504:4419523	4433563:4433582
4419504:4419523	attL	AGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
AXM18738.1|4419620_4420997_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
AXM18739.1|4421007_4421541_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXM18740.1|4421969_4423229_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
AXM18741.1|4423367_4424675_-	MFS transporter	NA	NA	NA	NA	NA
AXM19385.1|4426759_4427794_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM18742.1|4428144_4428690_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AXM19386.1|4428715_4428982_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AXM18743.1|4429156_4430995_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AXM18744.1|4431225_4432101_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
AXM19387.1|4433923_4434187_-	xanthomonadin biosynthesis protein	NA	NA	NA	NA	NA
4433563:4433582	attR	GGGGTTTTTCAGGGGCGACT	NA	NA	NA	NA
AXM18745.1|4434218_4435361_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
AXM18746.1|4436487_4437387_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AXM18747.1|4438334_4441136_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
AXM18748.1|4441212_4441503_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
AXM18749.1|4441860_4442963_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	9.4e-42
AXM18750.1|4444141_4444396_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18751.1|4444894_4447582_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AXM18752.1|4450903_4454833_+	avirulence protein	NA	NA	NA	NA	NA
AXM18753.1|4454898_4455099_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18754.1|4456521_4457034_-	hypothetical protein	NA	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
AXM18755.1|4457030_4457258_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18756.1|4457542_4457890_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18757.1|4458107_4460114_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
AXM18758.1|4460110_4460542_+	ATP-binding protein	NA	NA	NA	NA	NA
AXM18759.1|4460538_4460958_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
AXM18760.1|4461443_4462196_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AXM18761.1|4462406_4462997_-	nitroreductase family protein	NA	NA	NA	NA	NA
AXM19388.1|4463130_4464078_+	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
AXM18762.1|4464120_4464990_+	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
AXM18763.1|4464986_4465487_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18764.1|4468585_4469146_+	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	29.6	2.1e-13
AXM18765.1|4469241_4472067_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
AXM18766.1|4472228_4472747_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18767.1|4472746_4473667_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AXM18768.1|4474095_4474719_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18769.1|4474728_4474914_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18770.1|4475016_4475637_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19389.1|4476586_4477552_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 36
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	4555079	4613457	4867200	transposase,tRNA	Leptospira_phage(33.33%)	33	NA	NA
AXM18819.1|4555079_4556045_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM18820.1|4556145_4556571_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM18821.1|4556613_4557376_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM18822.1|4557438_4558470_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
AXM18823.1|4559830_4561087_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
AXM18824.1|4561083_4561974_+	allantoinase PuuE	NA	NA	NA	NA	NA
AXM18825.1|4561970_4562366_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
AXM19403.1|4562385_4562964_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
AXM18826.1|4563639_4565028_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM18827.1|4569813_4571898_-	S9 family peptidase	NA	NA	NA	NA	NA
AXM18828.1|4571997_4574025_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
AXM18829.1|4574267_4575878_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
AXM18830.1|4575888_4577052_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXM18831.1|4577180_4577801_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM18832.1|4578131_4578320_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18833.1|4578362_4578698_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
AXM18834.1|4580322_4580634_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
AXM18835.1|4581752_4582271_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
AXM18836.1|4582542_4584261_+	nuclease	NA	NA	NA	NA	NA
AXM18837.1|4584351_4584738_-	MerC domain-containing protein	NA	NA	NA	NA	NA
AXM18838.1|4584799_4586125_+	GTP-binding protein	NA	NA	NA	NA	NA
AXM18839.1|4586239_4587553_-	type III effector protein XopR	NA	NA	NA	NA	NA
AXM18840.1|4587651_4588377_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AXM19404.1|4588593_4589256_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AXM18841.1|4589334_4590429_+	cell division protein ZapE	NA	NA	NA	NA	NA
AXM18842.1|4591933_4594693_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	3.5e-146
AXM18843.1|4594945_4596535_-	sulfotransferase family protein	NA	NA	NA	NA	NA
AXM18844.1|4596534_4598772_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AXM18845.1|4599060_4599969_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AXM18846.1|4600058_4601873_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
AXM18847.1|4601994_4603314_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM19405.1|4603735_4612192_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18848.1|4612659_4613457_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 37
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	4623633	4665431	4867200	transposase,tRNA	Escherichia_phage(25.0%)	28	NA	NA
AXM18862.1|4623633_4624551_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
AXM18863.1|4624641_4625151_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18864.1|4625154_4626492_+	xylose isomerase	NA	NA	NA	NA	NA
AXM18865.1|4626717_4627785_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM18866.1|4627960_4630156_+	alpha-glucuronidase	NA	NA	NA	NA	NA
AXM18867.1|4630152_4632117_+	9-O-acetylesterase	NA	NA	NA	NA	NA
AXM18868.1|4632128_4633388_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
AXM19407.1|4633387_4635088_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
AXM18869.1|4635090_4637805_+	glucan 1,4-alpha-glucosidase	NA	NA	NA	NA	NA
AXM18870.1|4638027_4639500_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
AXM18871.1|4640477_4641533_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18872.1|4641760_4643179_-	glucuronate isomerase	NA	NA	NA	NA	NA
AXM18873.1|4643219_4644197_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
AXM18874.1|4645613_4647095_-	MFS transporter	NA	NA	NA	NA	NA
AXM19408.1|4647436_4650310_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM18875.1|4650408_4651896_+	MFS transporter	NA	NA	NA	NA	NA
AXM18876.1|4651927_4652962_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AXM18877.1|4653378_4654176_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM19409.1|4655052_4655190_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19410.1|4655482_4656439_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM18878.1|4657166_4657929_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM18879.1|4657946_4659047_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXM18880.1|4659112_4660234_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
AXM18881.1|4660243_4661338_-	ferredoxin reductase	NA	NA	NA	NA	NA
AXM18882.1|4661412_4662093_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
AXM18883.1|4662125_4662924_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM18884.1|4663052_4664372_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM18885.1|4664474_4665431_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
>prophage 38
CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	4782506	4855322	4867200	transposase,protease	Ralstonia_virus(20.0%)	56	NA	NA
AXM18967.1|4782506_4783742_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM19422.1|4784381_4784555_-	4-oxalomesaconate hydratase	NA	NA	NA	NA	NA
AXM18968.1|4784613_4785669_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
AXM18969.1|4785661_4786333_-	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
AXM18970.1|4786430_4787738_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM18971.1|4787754_4789173_+	cardiolipin synthase	NA	NA	NA	NA	NA
AXM18972.1|4789744_4791139_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AXM18973.1|4791138_4791477_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18974.1|4791486_4793673_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.7	2.2e-111
AXM18975.1|4793848_4794073_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19423.1|4794653_4795619_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM19424.1|4795794_4797210_-	amino acid permease	NA	NA	NA	NA	NA
AXM18976.1|4797426_4797636_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18977.1|4797700_4800025_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
AXM19425.1|4800430_4800793_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19426.1|4801170_4801716_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
AXM18978.1|4804968_4806096_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
AXM18979.1|4806951_4808292_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18980.1|4808508_4809201_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXM19427.1|4809317_4809638_+	DUF1820 family protein	NA	NA	NA	NA	NA
AXM18981.1|4809637_4810630_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.4	8.5e-10
AXM18982.1|4810936_4812460_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.7e-25
AXM18983.1|4812564_4813800_-	peptidase M23	NA	NA	NA	NA	NA
AXM18984.1|4813960_4814617_+	hypothetical protein	NA	NA	NA	NA	NA
AXM18985.1|4814767_4816579_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
AXM18986.1|4816726_4817077_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AXM18987.1|4817255_4818575_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM18988.1|4819987_4821169_-	hypothetical protein	NA	NA	NA	NA	NA
AXM18989.1|4821266_4824698_-	ATP-binding protein	NA	NA	NA	NA	NA
AXM18990.1|4824845_4825544_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
AXM18991.1|4825527_4827000_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
AXM18992.1|4826996_4827584_-	DUF4276 family protein	NA	NA	NA	NA	NA
AXM18993.1|4827583_4828780_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AXM18994.1|4828853_4829483_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.9	1.2e-46
AXM18995.1|4829631_4830075_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXM18996.1|4830330_4830954_+	transporter	NA	NA	NA	NA	NA
AXM18997.1|4830950_4831517_+	FUSC family protein	NA	NA	NA	NA	NA
AXM18998.1|4831792_4833154_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.9	8.3e-32
AXM18999.1|4833267_4833588_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19000.1|4835403_4835610_+	hypothetical protein	NA	NA	NA	NA	NA
AXM19001.1|4835596_4836709_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXM19002.1|4839060_4839813_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19003.1|4839809_4840517_-	hypothetical protein	NA	A4PE25	Ralstonia_virus	34.6	2.0e-08
AXM19004.1|4840530_4840872_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19005.1|4840852_4841362_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	4.8e-09
AXM19006.1|4841358_4841760_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AXM19007.1|4842151_4843471_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM19008.1|4844582_4844840_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19009.1|4844888_4845326_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19010.1|4845700_4845907_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19011.1|4846918_4848088_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	1.3e-41
AXM19428.1|4848113_4849424_-	MFS transporter	NA	NA	NA	NA	NA
AXM19012.1|4851337_4851658_-	hypothetical protein	NA	NA	NA	NA	NA
AXM19013.1|4851776_4852943_-	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
AXM19014.1|4853205_4854162_+	TerC family protein	NA	K4F9T9	Cronobacter_phage	29.9	8.4e-31
AXM19015.1|4854536_4855322_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
