The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031571	Enterobacter hormaechei strain S5 chromosome, complete genome	4843622	410129	471090	4843622	head,lysis,tRNA,integrase,plate,tail,capsid,portal	Salmonella_phage(66.0%)	75	409883:409932	464962:465011
409883:409932	attL	ATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGTC	NA	NA	NA	NA
AXO38951.1|410129_411446_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.0	9.2e-36
AXO38952.1|411599_412166_+	hypothetical protein	NA	NA	NA	NA	NA
AXO38953.1|412222_412624_+	hypothetical protein	NA	NA	NA	NA	NA
AXO38954.1|412862_412982_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
AXO38955.1|412978_413125_-	hypothetical protein	NA	NA	NA	NA	NA
AXO38956.1|413276_414065_+	hypothetical protein	NA	NA	NA	NA	NA
AXO38957.1|414278_414515_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXO38958.1|414647_416060_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AXO38959.1|416281_416905_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AXO38960.1|416977_418585_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	41.1	1.5e-101
AXO38961.1|418581_419754_-	anticodon nuclease	NA	NA	NA	NA	NA
AXO38962.1|419750_421049_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	23.3	1.0e-10
AXO38963.1|421045_421231_-	hypothetical protein	NA	NA	NA	NA	NA
AXO38964.1|421230_424203_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.5	1.6e-19
AXO38965.1|424293_424464_-	hypothetical protein	NA	NA	NA	NA	NA
AXO38966.1|424678_425542_+	GTPase family protein	NA	NA	NA	NA	NA
AXO38967.1|425637_426462_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.0	8.9e-45
AXO38968.1|426670_427384_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AXO38969.1|427674_428541_+	hypothetical protein	NA	NA	NA	NA	NA
AXO38970.1|428974_429433_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.6	2.2e-13
AXO38971.1|429442_429661_+	hypothetical protein	NA	NA	NA	NA	NA
AXO38972.1|429703_430183_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AXO38973.1|430191_430413_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
AXO38974.1|430430_430748_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AXO38975.1|430768_431110_+	toxin	NA	NA	NA	NA	NA
AXO38976.1|431429_432443_-|integrase	integrase	integrase	F1BUS9	Erwinia_phage	60.2	4.8e-117
AXO38977.1|432448_432994_-	hypothetical protein	NA	NA	NA	NA	NA
AXO38978.1|433019_433670_-	phage repressor protein	NA	F1BUN8	Cronobacter_phage	33.5	1.5e-26
AXO38979.1|433757_433994_+	regulator	NA	NA	NA	NA	NA
AXO38980.1|434028_434538_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	93.5	1.0e-83
AXO42830.1|434545_434746_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
AXO38981.1|434709_435051_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	86.7	2.6e-51
AXO38982.1|435118_435352_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	79.2	2.7e-23
AXO38983.1|435351_435579_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	90.7	3.3e-34
AXO38984.1|436429_438838_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.1	0.0e+00
AXO38985.1|438999_439188_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	4.6e-26
AXO38986.1|439199_439433_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	90.9	6.4e-33
AXO38987.1|439570_440329_-	hypothetical protein	NA	NA	NA	NA	NA
AXO42831.1|440816_441791_+	hypothetical protein	NA	A4PE73	Ralstonia_virus	42.5	5.5e-54
AXO38988.1|441790_442129_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
AXO38989.1|442173_443226_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	79.6	5.4e-156
AXO38990.1|443225_444989_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	87.7	3.2e-312
AXO38991.1|445138_445966_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	56.0	7.7e-73
AXO38992.1|445981_447130_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	67.6	3.2e-133
AXO38993.1|447133_447787_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	56.1	5.2e-56
AXO38994.1|447885_448353_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
AXO38995.1|448352_448556_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AXO38996.1|448559_448775_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
AXO38997.1|448755_449271_+	lysozyme	NA	E5G6N1	Salmonella_phage	75.3	6.9e-72
AXO38998.1|449267_449696_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	85.0	4.0e-57
AXO38999.1|449625_449829_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	91.0	1.8e-28
AXO39000.1|449791_450223_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	88.1	1.3e-68
AXO39001.1|450215_450662_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	79.7	3.4e-59
AXO39002.1|450730_451309_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.4	2.0e-104
AXO39003.1|451305_451665_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	88.1	4.2e-52
AXO39004.1|451651_452560_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	2.0e-143
AXO39005.1|452552_453158_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	94.0	8.1e-112
AXO39006.1|453154_454537_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	72.2	1.3e-144
AXO39007.1|454538_454976_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	55.9	2.5e-38
AXO42832.1|454956_455373_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	54.7	7.4e-16
AXO39008.1|455375_456164_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	54.0	2.9e-37
AXO39009.1|456222_456810_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	84.6	1.4e-84
AXO39010.1|457333_458506_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	92.8	9.5e-210
AXO39011.1|458515_459031_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	93.0	7.6e-87
AXO39012.1|459085_459388_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	91.0	3.7e-41
AXO39013.1|459402_459522_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	89.7	5.7e-14
AXO39014.1|459514_462958_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	72.2	0.0e+00
AXO39015.1|462957_463443_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	88.2	1.7e-72
AXO39016.1|463439_464540_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	91.0	1.5e-180
AXO42833.1|464609_464828_+	DNA-binding transcriptional regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.6e-25
AXO39017.1|465164_465671_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
464962:465011	attR	ATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGTC	NA	NA	NA	NA
AXO39018.1|465772_467617_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AXO39019.1|467766_469509_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.4	2.9e-69
AXO39020.1|469624_469840_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXO39021.1|470076_471090_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.4e-108
>prophage 2
CP031571	Enterobacter hormaechei strain S5 chromosome, complete genome	4843622	963879	978539	4843622	tail	Cronobacter_phage(36.36%)	11	NA	NA
AXO39451.1|963879_965034_+	DUF4102 domain-containing protein	NA	H6WRW7	Salmonella_phage	98.4	1.8e-224
AXO39452.1|966084_966396_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.0	1.8e-35
AXO39453.1|966392_966707_+	hypothetical protein	NA	I6PD79	Cronobacter_phage	65.0	8.6e-17
AXO39454.1|966703_969616_+|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	37.9	2.0e-152
AXO39455.1|969690_970044_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	98.3	6.0e-59
AXO39456.1|970100_970448_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	63.5	7.5e-38
AXO39457.1|970444_971200_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	76.8	2.2e-114
AXO39458.1|971201_971912_+	peptidase P60	NA	K7PJX1	Enterobacterial_phage	96.2	1.7e-140
AXO42853.1|971945_972575_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.4	1.6e-54
AXO39459.1|972627_976206_+	DUF1983 domain-containing protein	NA	K7P840	Enterobacteria_phage	80.7	0.0e+00
AXO39460.1|978041_978539_+	hypothetical protein	NA	K7P6I4	Enterobacteria_phage	82.6	2.5e-74
>prophage 3
CP031571	Enterobacter hormaechei strain S5 chromosome, complete genome	4843622	1442345	1450611	4843622		Escherichia_phage(25.0%)	8	NA	NA
AXO39843.1|1442345_1443737_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	2.2e-19
AXO39844.1|1443911_1444808_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.9	2.0e-42
AXO39845.1|1445167_1446253_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	52.0	4.4e-100
AXO39846.1|1446252_1447152_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.5	3.0e-30
AXO39847.1|1447204_1448083_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	3.9e-107
AXO39848.1|1448086_1448647_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.9	6.4e-47
AXO39849.1|1448643_1449564_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	27.3	7.4e-16
AXO39850.1|1449564_1450611_+	glycosyltransferase	NA	A0A1V0SL50	Klosneuvirus	25.0	5.3e-10
>prophage 4
CP031571	Enterobacter hormaechei strain S5 chromosome, complete genome	4843622	1564804	1613684	4843622	head,holin,terminase	Salmonella_phage(29.03%)	71	NA	NA
AXO39940.1|1564804_1566100_-	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	68.3	2.1e-178
AXO39941.1|1566145_1566391_-	excisionase	NA	S4TND0	Salmonella_phage	61.2	4.6e-26
AXO39942.1|1566399_1566600_-	hypothetical protein	NA	G8C7S1	Escherichia_phage	71.2	2.4e-20
AXO39943.1|1566791_1567409_-	Eac protein	NA	A0A220NQT7	Salmonella_phage	76.6	3.0e-90
AXO39944.1|1567418_1567658_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	44.9	3.9e-09
AXO39945.1|1567620_1568313_-	AP2 domain-containing protein	NA	A0A2I7R856	Vibrio_phage	47.3	2.9e-33
AXO39946.1|1568314_1568530_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.5	4.1e-10
AXO39947.1|1568621_1568813_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	67.8	8.3e-15
AXO39948.1|1568809_1569517_-	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	49.5	6.3e-23
AXO39949.1|1569513_1569732_-	hypothetical protein	NA	NA	NA	NA	NA
AXO39950.1|1569734_1572017_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	47.1	8.7e-191
AXO39951.1|1572174_1572603_-	regulator	NA	M9NYX4	Enterobacteria_phage	95.8	8.9e-73
AXO39952.1|1572611_1573094_-	hypothetical protein	NA	G8C7S9	Escherichia_phage	97.5	1.2e-78
AXO39953.1|1573090_1574005_-	DNA recombinase	NA	G8C7T0	Escherichia_phage	98.7	2.6e-170
AXO39954.1|1574014_1574299_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	97.9	1.2e-49
AXO39955.1|1574371_1574581_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	91.3	3.7e-32
AXO42873.1|1574732_1575011_-	antitoxin	NA	NA	NA	NA	NA
AXO39956.1|1575137_1575827_-	hypothetical protein	NA	A0A2H4J4Q4	uncultured_Caudovirales_phage	52.5	2.7e-39
AXO42874.1|1576226_1576979_-	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	64.0	9.2e-73
AXO39957.1|1577020_1577254_+	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	62.3	2.6e-18
AXO39958.1|1577271_1577817_+	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	96.7	6.2e-95
AXO39959.1|1578045_1578945_+	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	55.0	1.4e-80
AXO39960.1|1578934_1580368_+	helicase DnaB	NA	Q716D2	Shigella_phage	86.2	8.6e-229
AXO39961.1|1580367_1580712_+	ArsR family transcriptional regulator	NA	G8C7U7	Escherichia_phage	93.8	2.5e-54
AXO39962.1|1580708_1580957_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXO39963.1|1580953_1581304_+	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	47.9	5.8e-14
AXO42875.1|1581584_1581980_+	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	72.6	2.9e-17
AXO39964.1|1581983_1582475_+	hypothetical protein	NA	G8C7V0	Escherichia_phage	92.6	9.2e-74
AXO39965.1|1582508_1582691_+	hypothetical protein	NA	NA	NA	NA	NA
AXO39966.1|1582690_1582939_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	91.2	4.2e-35
AXO39967.1|1582935_1583178_+	hypothetical protein	NA	NA	NA	NA	NA
AXO39968.1|1583356_1583806_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.2	2.5e-33
AXO39969.1|1583798_1583969_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	82.1	2.1e-17
AXO39970.1|1583961_1584606_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	72.4	1.0e-80
AXO39971.1|1584602_1584719_+	hypothetical protein	NA	NA	NA	NA	NA
AXO39972.1|1584715_1585393_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	9.2e-56
AXO39973.1|1585389_1585875_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	53.8	7.3e-39
AXO39974.1|1586144_1586462_+|holin	holin	holin	E7C9S8	Salmonella_phage	86.7	8.9e-46
AXO39975.1|1586448_1586889_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	72.5	3.6e-53
AXO39976.1|1586885_1587272_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	39.5	9.3e-13
AXO39977.1|1587252_1587441_+	rz1 lytic protein	NA	U5P461	Shigella_phage	56.1	3.2e-11
AXO39978.1|1587535_1587742_+	hypothetical protein	NA	NA	NA	NA	NA
AXO39979.1|1587745_1588165_+|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	90.5	5.8e-61
AXO39980.1|1588161_1589415_+|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	96.4	9.8e-213
AXO39981.1|1589507_1589717_+	hypothetical protein	NA	NA	NA	NA	NA
AXO39982.1|1589789_1591139_+	DUF1073 domain-containing protein	NA	I6R9A1	Salmonella_phage	87.3	2.1e-229
AXO39983.1|1591098_1592025_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	92.2	4.5e-162
AXO42876.1|1592142_1593351_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	90.3	9.2e-208
AXO39984.1|1593363_1593813_+	hypothetical protein	NA	H6WRT3	Salmonella_phage	86.6	2.5e-65
AXO39985.1|1593830_1594907_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	90.5	1.9e-188
AXO39986.1|1594916_1595210_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	91.8	7.7e-44
AXO39987.1|1595272_1595674_+	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	81.5	9.2e-56
AXO39988.1|1595673_1595844_+	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	48.2	3.8e-11
AXO39989.1|1595847_1596084_+	hypothetical protein	NA	NA	NA	NA	NA
AXO39990.1|1596087_1596438_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	1.2e-38
AXO39991.1|1596440_1596809_+	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	65.6	1.6e-38
AXO39992.1|1596805_1597189_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	62.2	2.6e-39
AXO39993.1|1597252_1597996_+	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	85.3	6.3e-74
AXO39994.1|1598055_1598739_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	61.1	1.3e-78
AXO39995.1|1598797_1602313_+	hypothetical protein	NA	R9TMK1	Aeromonas_phage	58.7	3.0e-235
AXO39996.1|1602312_1602810_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.9	1.8e-88
AXO39997.1|1602809_1603280_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	94.2	8.2e-80
AXO39998.1|1603242_1603659_+	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	88.2	8.9e-70
AXO39999.1|1603645_1606123_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	92.5	0.0e+00
AXO40000.1|1606180_1607818_+	hypothetical protein	NA	B1GS50	Salmonella_phage	68.4	6.2e-58
AXO40001.1|1608421_1610059_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	36.4	1.9e-86
AXO40002.1|1610059_1610977_-	glycosyltransferase	NA	U5P087	Shigella_phage	91.8	1.5e-162
AXO40003.1|1610973_1611336_-	GtrA family protein	NA	U5P0S6	Shigella_phage	83.3	2.6e-49
AXO40004.1|1611446_1611752_+	hypothetical protein	NA	I6PCW5	Cronobacter_phage	40.6	6.0e-15
AXO40005.1|1611751_1613020_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.0	6.4e-228
AXO40006.1|1613012_1613684_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	6.9e-80
>prophage 5
CP031571	Enterobacter hormaechei strain S5 chromosome, complete genome	4843622	1681010	1765513	4843622	head,tRNA,holin,tail,terminase,protease,capsid,portal	Enterobacteria_phage(31.48%)	96	NA	NA
AXO40069.1|1681010_1682744_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	36.8	2.0e-86
AXO40070.1|1682982_1683543_+	VOC family protein	NA	NA	NA	NA	NA
AXO40071.1|1683621_1684365_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AXO40072.1|1684345_1684585_+	hypothetical protein	NA	NA	NA	NA	NA
AXO40073.1|1684539_1685511_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AXO40074.1|1685507_1686251_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1S6L2V9	Erwinia_phage	30.2	1.8e-28
AXO40075.1|1686291_1686687_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40076.1|1686738_1687512_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.1	2.3e-58
AXO40077.1|1687490_1688804_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	86.5	2.9e-223
AXO40078.1|1688859_1689105_-	excisionase	NA	Q8W657	Enterobacteria_phage	86.8	1.9e-35
AXO40079.1|1689097_1689523_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40080.1|1689525_1690269_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	94.7	4.6e-133
AXO40081.1|1690314_1691142_-	SPFH/Band 7/PHB domain protein	NA	Q8W654	Enterobacteria_phage	84.7	2.9e-112
AXO40082.1|1691138_1691333_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40083.1|1691332_1691740_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	52.2	2.3e-25
AXO40084.1|1691736_1691958_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	66.7	1.1e-18
AXO40085.1|1691929_1692337_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	80.3	8.0e-47
AXO40086.1|1692329_1692554_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40087.1|1692660_1693047_-	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	60.8	1.7e-38
AXO40088.1|1693120_1693414_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40089.1|1693585_1694278_-	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	65.4	4.3e-85
AXO42880.1|1694431_1694647_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	50.0	2.4e-10
AXO40090.1|1694648_1694846_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AXO40091.1|1694842_1695775_+	hypothetical protein	NA	C5IHL2	Burkholderia_virus	37.0	2.2e-36
AXO40092.1|1695882_1697754_+	toprim domain-containing protein	NA	Q5G8S8	Enterobacteria_phage	59.4	1.2e-222
AXO40093.1|1697757_1698540_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.4	8.3e-109
AXO40094.1|1699083_1699485_+	hypothetical protein	NA	NA	NA	NA	NA
AXO40095.1|1699481_1699757_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	7.6e-09
AXO40096.1|1699759_1700302_+	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	70.4	2.7e-74
AXO40097.1|1700298_1700571_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	62.5	6.8e-18
AXO40098.1|1700527_1700722_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	84.1	2.6e-16
AXO40099.1|1701059_1701587_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40100.1|1701710_1703168_+	glycosyltransferase family 2 protein	NA	S4TSQ9	Salmonella_phage	86.2	2.6e-257
AXO40101.1|1703180_1703390_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AXO40102.1|1703336_1703600_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
AXO42881.1|1703763_1704354_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	80.1	7.4e-94
AXO40103.1|1704385_1704565_-	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	57.6	3.3e-13
AXO40104.1|1704666_1705017_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	78.4	1.9e-49
AXO40105.1|1705174_1705648_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.1	3.8e-85
AXO40106.1|1705647_1707384_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	100.0	0.0e+00
AXO40107.1|1707383_1708688_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.3	3.1e-233
AXO40108.1|1708701_1709550_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.8	1.2e-137
AXO40109.1|1709559_1710771_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	86.3	4.4e-194
AXO40110.1|1711071_1711398_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	97.2	1.7e-55
AXO40111.1|1711407_1711746_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	2.7e-40
AXO40112.1|1711742_1712192_+	HK97 gp10 family phage protein	NA	K7PH84	Enterobacterial_phage	97.3	2.5e-73
AXO40113.1|1712188_1712536_+	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	100.0	5.9e-59
AXO40114.1|1712590_1713061_+|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	98.7	4.4e-81
AXO40115.1|1713115_1713517_+|tail	phage tail protein	tail	K7P7C2	Enterobacteria_phage	98.5	3.6e-68
AXO40116.1|1713540_1713804_+	DUF4035 domain-containing protein	NA	K7P7L5	Enterobacteria_phage	97.7	4.2e-41
AXO40117.1|1713838_1717120_+|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	95.8	0.0e+00
AXO40118.1|1717122_1717461_+|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	100.0	6.6e-63
AXO40119.1|1717457_1718216_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	99.6	1.1e-147
AXO40120.1|1718217_1718928_+	peptidase P60	NA	K7PGV2	Enterobacterial_phage	97.0	1.9e-144
AXO40121.1|1718960_1719308_+	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	47.3	9.0e-07
AXO40122.1|1719314_1719650_+	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	47.7	7.3e-22
AXO40123.1|1719705_1720305_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	75.2	1.1e-76
AXO40124.1|1720358_1724186_+	DUF1983 domain-containing protein	NA	Q9MCR7	Enterobacteria_phage	82.4	0.0e+00
AXO40125.1|1724187_1725153_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	39.7	2.2e-58
AXO40126.1|1725215_1726517_+|tail	phage tail protein	tail	K7PH95	Enterobacterial_phage	54.0	3.5e-112
AXO40127.1|1726610_1726877_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	95.5	2.8e-40
AXO40128.1|1727241_1727808_-	hydrolase	NA	NA	NA	NA	NA
AXO40129.1|1728070_1729843_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AXO40130.1|1729844_1730288_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AXO40131.1|1730315_1731056_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXO40132.1|1731090_1731612_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
AXO40133.1|1731692_1732307_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AXO40134.1|1733377_1734163_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AXO40135.1|1734159_1734915_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	8.8e-15
AXO40136.1|1734977_1735937_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AXO40137.1|1735952_1737272_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
AXO40138.1|1737389_1738361_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AXO40139.1|1738404_1739847_-	pyruvate kinase	NA	NA	NA	NA	NA
AXO40140.1|1739961_1740831_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AXO40141.1|1741187_1742663_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	6.0e-76
AXO40142.1|1742896_1744708_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AXO40143.1|1744747_1745389_+	keto-hydroxyglutarate-aldolase/keto-deoxy- phosphogluconate aldolase	NA	NA	NA	NA	NA
AXO40144.1|1745463_1746642_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AXO40145.1|1746813_1747464_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
AXO40146.1|1747539_1749615_+	oligopeptidase B	NA	NA	NA	NA	NA
AXO40147.1|1749596_1750259_-	exodeoxyribonuclease X	NA	NA	NA	NA	NA
AXO40148.1|1750283_1750934_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AXO40149.1|1751045_1751276_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
AXO40150.1|1751413_1751785_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AXO40151.1|1751786_1752656_+	hypothetical protein	NA	NA	NA	NA	NA
AXO40152.1|1752672_1753011_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AXO40153.1|1753136_1753334_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40154.1|1753379_1754360_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AXO40155.1|1754527_1755172_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.3	5.6e-55
AXO40156.1|1755206_1755446_-	DUF1480 family protein	NA	NA	NA	NA	NA
AXO40157.1|1755552_1757016_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AXO42882.1|1759673_1760957_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AXO40158.1|1761089_1761587_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AXO40159.1|1761683_1762370_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
AXO40160.1|1762389_1764438_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.6	1.0e-81
AXO40161.1|1764631_1765513_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 6
CP031571	Enterobacter hormaechei strain S5 chromosome, complete genome	4843622	2326463	2377339	4843622	transposase	uncultured_Caudovirales_phage(43.75%)	47	NA	NA
AXO40624.1|2326463_2327387_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	2.4e-176
AXO40625.1|2327575_2329195_+	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
AXO40626.1|2329271_2329748_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AXO40627.1|2329960_2331310_-	sensor histidine kinase	NA	NA	NA	NA	NA
AXO40628.1|2331285_2331954_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXO40629.1|2332147_2333173_-	AAA family ATPase	NA	NA	NA	NA	NA
AXO40630.1|2334065_2334770_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
AXO40631.1|2336112_2336445_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXO40632.1|2336441_2337164_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.4	3.9e-97
AXO40633.1|2337221_2337650_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
AXO40634.1|2339078_2339432_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
AXO40635.1|2339915_2341394_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
AXO40636.1|2341412_2342240_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.3	4.9e-51
AXO40637.1|2342311_2343508_-	MFS transporter	NA	NA	NA	NA	NA
AXO40638.1|2344036_2344411_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
AXO40639.1|2344685_2345834_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
AXO40640.1|2346187_2346520_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AXO40641.1|2346651_2347209_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	8.4e-39
AXO40642.1|2351337_2351718_+	hypothetical protein	NA	NA	NA	NA	NA
AXO40643.1|2351775_2352399_+	hypothetical protein	NA	NA	NA	NA	NA
AXO40644.1|2352444_2353425_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
AXO40645.1|2353463_2353586_-	ABC transporter	NA	NA	NA	NA	NA
AXO40646.1|2353700_2354156_+	hypothetical protein	NA	NA	NA	NA	NA
AXO40647.1|2354196_2354433_+	hypothetical protein	NA	NA	NA	NA	NA
AXO40648.1|2354458_2354752_+	hypothetical protein	NA	NA	NA	NA	NA
AXO40649.1|2354929_2355334_+	DNA-binding protein	NA	NA	NA	NA	NA
AXO40650.1|2355675_2355879_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40651.1|2355940_2356798_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	38.7	1.8e-11
AXO40652.1|2356813_2357122_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40653.1|2357316_2358153_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AXO40654.1|2358152_2358956_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
AXO40655.1|2359062_2360192_-|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
AXO40656.1|2360256_2360871_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
AXO40657.1|2360996_2363882_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
AXO40658.1|2364380_2364806_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40659.1|2365058_2365874_-	HNH endonuclease	NA	NA	NA	NA	NA
AXO40660.1|2365886_2366297_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40661.1|2366397_2366604_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40662.1|2366664_2367990_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AXO42903.1|2367994_2368288_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXO40663.1|2368688_2370077_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40664.1|2370081_2370579_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40665.1|2370781_2371438_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40666.1|2371806_2372118_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40667.1|2372096_2372489_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40668.1|2373409_2374396_+	hypothetical protein	NA	NA	NA	NA	NA
AXO40669.1|2376334_2377339_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 7
CP031571	Enterobacter hormaechei strain S5 chromosome, complete genome	4843622	2682239	2725900	4843622	tRNA,holin,integrase,tail,terminase,protease,portal	Enterobacterial_phage(40.38%)	61	2683194:2683208	2728001:2728015
AXO40947.1|2682239_2683523_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
2683194:2683208	attL	AGCGCCCTGAAGCTG	NA	NA	NA	NA
AXO40948.1|2683649_2683970_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	86.8	1.1e-48
AXO40949.1|2683969_2684209_-	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	91.1	6.7e-38
AXO40950.1|2684295_2684562_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	89.8	1.8e-36
AXO40951.1|2684655_2685957_-|tail	phage tail protein	tail	K7PH95	Enterobacterial_phage	53.6	3.0e-111
AXO40952.1|2686017_2686983_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.5	5.7e-59
AXO40953.1|2686984_2690854_-	DUF1983 domain-containing protein	NA	Q9MCR7	Enterobacteria_phage	82.0	0.0e+00
AXO40954.1|2690907_2691501_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	81.2	9.1e-84
AXO40955.1|2691563_2691980_-	hypothetical protein	NA	K7PLY8	Enterobacterial_phage	39.9	5.9e-21
AXO40956.1|2692009_2692720_-	peptidase P60	NA	K7PGV2	Enterobacterial_phage	97.9	1.7e-145
AXO40957.1|2692721_2693477_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	90.4	1.9e-134
AXO40958.1|2693473_2693821_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	81.7	1.5e-49
AXO40959.1|2693826_2696346_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	84.7	0.0e+00
AXO40960.1|2696323_2696644_-|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	91.4	5.5e-51
AXO40961.1|2696652_2697075_-|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	77.1	2.1e-50
AXO40962.1|2697110_2697848_-|tail	phage tail protein	tail	O64327	Escherichia_phage	87.3	2.7e-117
AXO40963.1|2697855_2698254_-|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	68.2	3.5e-47
AXO40964.1|2698250_2698805_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	81.6	1.2e-66
AXO40965.1|2698813_2699089_-	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	67.5	4.9e-24
AXO42914.1|2699081_2699408_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	75.7	1.3e-39
AXO40966.1|2699491_2701570_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	87.2	0.0e+00
AXO40967.1|2701451_2702954_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	92.8	1.9e-271
AXO42915.1|2702950_2703166_-	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	90.1	2.0e-28
AXO40968.1|2703162_2705265_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	96.4	0.0e+00
AXO40969.1|2705264_2705753_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	98.1	6.5e-80
AXO42916.1|2705985_2706507_-	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	68.7	4.7e-52
AXO40970.1|2707034_2707229_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	87.8	3.7e-18
AXO42917.1|2707185_2707455_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	85.4	1.4e-31
AXO40971.1|2707462_2708092_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.1	2.3e-101
AXO40972.1|2708091_2708370_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	83.7	1.1e-36
AXO40973.1|2708359_2708749_-	hypothetical protein	NA	G8C7V8	Escherichia_phage	92.2	1.1e-58
AXO40974.1|2709473_2709629_-	DUF3927 domain-containing protein	NA	S4TRP5	Salmonella_phage	70.8	2.2e-10
AXO40975.1|2709625_2710051_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	84.4	6.6e-60
AXO40976.1|2710378_2711251_+	hypothetical protein	NA	NA	NA	NA	NA
AXO40977.1|2711250_2711508_+	hypothetical protein	NA	NA	NA	NA	NA
AXO40978.1|2711504_2711915_+	hypothetical protein	NA	NA	NA	NA	NA
AXO42918.1|2711931_2712297_-	DUF1133 family protein	NA	K7PGW2	Enterobacterial_phage	95.0	3.6e-59
AXO40979.1|2712311_2713301_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	89.4	7.3e-179
AXO40980.1|2713297_2713687_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	96.1	9.2e-69
AXO40981.1|2713683_2714004_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	77.4	1.4e-43
AXO40982.1|2714000_2714228_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40983.1|2714224_2714890_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	80.2	4.6e-100
AXO40984.1|2714894_2715647_-	hypothetical protein	NA	M1FN76	Enterobacteria_phage	90.0	9.9e-136
AXO40985.1|2715646_2716141_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40986.1|2716137_2717028_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	83.0	3.5e-39
AXO40987.1|2717017_2717197_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	3.3e-13
AXO40988.1|2717360_2717915_-	hypothetical protein	NA	S5FXP0	Shigella_phage	53.6	1.6e-45
AXO40989.1|2717937_2718153_-	cell division protein	NA	NA	NA	NA	NA
AXO40990.1|2718252_2718879_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.6e-46
AXO40991.1|2719167_2719368_-	hypothetical protein	NA	NA	NA	NA	NA
AXO40992.1|2719771_2720092_+	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	55.7	3.6e-26
AXO42919.1|2720140_2720554_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	84.7	4.7e-55
AXO40993.1|2720553_2721381_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	85.6	2.4e-122
AXO40994.1|2721377_2721818_+	hypothetical protein	NA	G9L6B1	Escherichia_phage	41.7	4.2e-09
AXO40995.1|2721814_2722096_+	hypothetical protein	NA	A0A2I7R567	Vibrio_phage	42.5	1.5e-07
AXO40996.1|2722092_2722335_+	hypothetical protein	NA	K7PLZ3	Enterobacterial_phage	47.2	4.5e-05
AXO42920.1|2723113_2723431_+	hypothetical protein	NA	K7P7P8	Enterobacteria_phage	92.3	7.3e-48
AXO40997.1|2723497_2723767_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	75.3	3.1e-31
AXO40998.1|2723799_2724063_+	hypothetical protein	NA	NA	NA	NA	NA
AXO40999.1|2724037_2725180_+|integrase	integrase	integrase	O21929	Phage_21	49.0	1.4e-93
AXO41000.1|2725399_2725900_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
2728001:2728015	attR	AGCGCCCTGAAGCTG	NA	NA	NA	NA
>prophage 8
CP031571	Enterobacter hormaechei strain S5 chromosome, complete genome	4843622	3585727	3598249	4843622	holin	Morganella_phage(20.0%)	13	NA	NA
AXO42951.1|3585727_3588502_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.2	2.2e-297
AXO41750.1|3588514_3589141_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.6	2.2e-24
AXO41751.1|3589137_3589359_-	hypothetical protein	NA	NA	NA	NA	NA
AXO41752.1|3589355_3589619_-|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
AXO42952.1|3589615_3590350_-	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	35.8	5.0e-07
AXO41753.1|3590390_3591233_-	antA/AntB antirepressor family protein	NA	A0A0P0ZG08	Escherichia_phage	48.0	1.3e-22
AXO41754.1|3591246_3591681_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	54.3	8.0e-29
AXO41755.1|3591680_3591878_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	45.3	3.0e-07
AXO41756.1|3592093_3592813_-	hypothetical protein	NA	NA	NA	NA	NA
AXO41757.1|3592956_3594171_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	56.5	1.4e-131
AXO41758.1|3594522_3595776_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.1	2.6e-96
AXO41759.1|3595787_3596891_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.3e-59
AXO41760.1|3597196_3598249_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
>prophage 1
CP031573	Enterobacter hormaechei strain S5 plasmid pIncAC2-1502262, complete sequence	164095	99676	113187	164095	integrase,transposase	Salmonella_phage(40.0%)	14	95147:95160	115374:115387
95147:95160	attL	ATCCGAGCTGGCGC	NA	NA	NA	NA
AXO43220.1|99676_100681_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXO43221.1|100759_103732_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AXO43222.1|103734_104292_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AXO43223.1|104329_104653_-|transposase	transposase	transposase	NA	NA	NA	NA
AXO43224.1|104597_105611_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXO43289.1|105756_106290_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AXO43225.1|106446_106794_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXO43226.1|106787_107627_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXO43227.1|108031_109573_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXO43228.1|109905_110562_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
AXO43229.1|110761_111601_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXO43230.1|111530_111710_-	hypothetical protein	NA	NA	NA	NA	NA
AXO43231.1|111728_112001_+	hypothetical protein	NA	NA	NA	NA	NA
AXO43232.1|112182_113187_-|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
115374:115387	attR	ATCCGAGCTGGCGC	NA	NA	NA	NA
>prophage 1
CP031572	Enterobacter hormaechei strain S5 plasmid pQnrS1-1502262, complete sequence	106689	0	4957	106689		Cronobacter_phage(33.33%)	6	NA	NA
AXO42990.1|942_1332_+	plasmid stability protein	NA	NA	NA	NA	NA
AXO42991.1|1335_2607_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	2.9e-156
AXO42992.1|2606_3035_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.6	1.3e-28
AXO43083.1|3165_3423_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
AXO42993.1|3400_3868_+	hypothetical protein	NA	NA	NA	NA	NA
AXO42994.1|4264_4957_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	36.7	5.7e-29
>prophage 2
CP031572	Enterobacter hormaechei strain S5 plasmid pQnrS1-1502262, complete sequence	106689	8080	11332	106689		Escherichia_phage(50.0%)	3	NA	NA
AXO43000.1|8080_8335_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	64.9	1.0e-20
AXO43085.1|9032_9278_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AXO43001.1|9346_11332_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.1	9.3e-32
>prophage 3
CP031572	Enterobacter hormaechei strain S5 plasmid pQnrS1-1502262, complete sequence	106689	15952	16216	106689		Klebsiella_phage(100.0%)	1	NA	NA
AXO43007.1|15952_16216_-	XRE family transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	55.4	2.9e-10
>prophage 4
CP031572	Enterobacter hormaechei strain S5 plasmid pQnrS1-1502262, complete sequence	106689	51463	55677	106689	integrase	Pseudomonas_phage(50.0%)	4	43552:43567	54206:54221
43552:43567	attL	TTTGCCCGTTTCTGAC	NA	NA	NA	NA
AXO43090.1|51463_52597_-|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	43.3	9.0e-48
AXO43033.1|53201_54539_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
54206:54221	attR	TTTGCCCGTTTCTGAC	NA	NA	NA	NA
AXO43034.1|54535_55210_-	prepilin peptidase	NA	NA	NA	NA	NA
AXO43091.1|55194_55677_-	pilus assembly protein	NA	A0A0A8J856	Ralstonia_phage	36.2	8.9e-05
>prophage 5
CP031572	Enterobacter hormaechei strain S5 plasmid pQnrS1-1502262, complete sequence	106689	73342	73912	106689		Ochrobactrum_phage(100.0%)	1	NA	NA
AXO43052.1|73342_73912_+	ATPase	NA	A0A219VHB7	Ochrobactrum_phage	55.8	8.6e-23
>prophage 6
CP031572	Enterobacter hormaechei strain S5 plasmid pQnrS1-1502262, complete sequence	106689	83834	84692	106689		Enterobacteria_phage(100.0%)	1	NA	NA
AXO43061.1|83834_84692_+	class A beta-lactamase LAP-2	NA	Q1MVP3	Enterobacteria_phage	61.1	2.0e-92
>prophage 7
CP031572	Enterobacter hormaechei strain S5 plasmid pQnrS1-1502262, complete sequence	106689	89152	89725	106689		Clostridium_phage(100.0%)	1	NA	NA
AXO43064.1|89152_89725_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
>prophage 8
CP031572	Enterobacter hormaechei strain S5 plasmid pQnrS1-1502262, complete sequence	106689	93256	96579	106689		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
AXO43069.1|93256_93928_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	57.7	1.8e-72
AXO43070.1|93894_94392_-	chromosome partitioning protein ParB	NA	A0A0R6PHV6	Moraxella_phage	36.0	3.3e-18
AXO43071.1|94557_96579_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	31.3	3.0e-38
>prophage 9
CP031572	Enterobacter hormaechei strain S5 plasmid pQnrS1-1502262, complete sequence	106689	104624	106419	106689	integrase	Macacine_betaherpesvirus(50.0%)	3	NA	NA
AXO43080.1|104624_105404_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	3.5e-51
AXO43081.1|105502_105781_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AXO43082.1|105780_106419_-	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	44.9	5.8e-44
