The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031653	Escherichia coli strain UK_Dog_Liverpool chromosome, complete genome	4869482	160225	198185	4869482	transposase,integrase,tRNA	Stx2-converting_phage(33.33%)	45	191366:191425	201860:202659
AXP24754.1|160225_161137_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AXP24755.1|161146_163216_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AXP24756.1|163516_164885_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
AXP24757.1|164985_165144_+	protein hok	NA	NA	NA	NA	NA
AXP24758.1|165363_165594_+	hypothetical protein	NA	NA	NA	NA	NA
AXP24759.1|166064_166352_+	hypothetical protein	NA	NA	NA	NA	NA
AXP24760.1|166361_167291_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.8	6.5e-44
AXP24761.1|167587_168190_-	lytic transglycosylase	NA	NA	NA	NA	NA
AXP24762.1|168510_168894_+	relaxosome protein TraM	NA	NA	NA	NA	NA
AXP24763.1|169080_169770_+	protein TraJ	NA	NA	NA	NA	NA
AXP29058.1|169868_170264_+	relaxosome protein TraY	NA	NA	NA	NA	NA
AXP24764.1|170296_170662_+	pilin	NA	NA	NA	NA	NA
AXP24765.1|170676_170988_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AXP24766.1|171009_171576_+	protein TraE	NA	NA	NA	NA	NA
AXP29060.1|171619_172291_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
AXP29059.1|172401_176061_+	conjugative transfer relaxase/helicase TraI	NA	V5UQN3	Mycobacterium_phage	31.5	4.3e-06
AXP24767.1|176080_176827_+	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
AXP24768.1|176881_177442_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
AXP24769.1|177575_177788_+	hypothetical protein	NA	NA	NA	NA	NA
AXP24770.1|178088_178271_-	hypothetical protein	NA	U5P0U6	Shigella_phage	100.0	8.5e-09
AXP24771.1|178232_178910_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AXP24772.1|178909_179257_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AXP24773.1|179276_180848_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
AXP24774.1|181551_181785_+	hypothetical protein	NA	NA	NA	NA	NA
AXP24775.1|181730_181973_-	hypothetical protein	NA	NA	NA	NA	NA
AXP29061.1|182028_182178_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AXP24776.1|182461_182719_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
AXP29063.1|182754_182871_-	replication protein RepA	NA	NA	NA	NA	NA
AXP29062.1|182954_183029_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
AXP24777.1|184788_186009_+	arginine deiminase	NA	NA	NA	NA	NA
AXP24778.1|186019_186931_+	carbamate kinase	NA	NA	NA	NA	NA
AXP24779.1|187015_188020_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AXP24780.1|188067_189471_+	YfcC family protein	NA	NA	NA	NA	NA
AXP24781.1|189551_190031_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
AXP24782.1|190387_190609_-	hypothetical protein	NA	NA	NA	NA	NA
AXP24783.1|190639_190990_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AXP24784.1|190986_191370_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	89.2	7.0e-37
191366:191425	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AXP24785.1|191428_192133_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXP24786.1|192166_193054_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.2	9.2e-56
AXP24787.1|193198_193696_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AXP24788.1|193807_194098_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AXP24789.1|194103_194895_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AXP24790.1|195058_195406_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXP24791.1|195399_196239_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AXP24792.1|196643_198185_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
201860:202659	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATC	NA	NA	NA	NA
>prophage 2
CP031653	Escherichia coli strain UK_Dog_Liverpool chromosome, complete genome	4869482	1151491	1164674	4869482		Escherichia_phage(50.0%)	12	NA	NA
AXP25690.1|1151491_1152253_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
AXP25691.1|1152246_1152873_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AXP25692.1|1153012_1154152_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AXP25693.1|1154214_1155207_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AXP25694.1|1155300_1156665_-	GntP family transporter	NA	NA	NA	NA	NA
AXP25695.1|1156753_1157530_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AXP25696.1|1157534_1158173_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AXP25697.1|1158169_1159432_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AXP25698.1|1159428_1160337_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AXP25699.1|1160532_1161300_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AXP25700.1|1161350_1162007_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
AXP25701.1|1162112_1164674_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 3
CP031653	Escherichia coli strain UK_Dog_Liverpool chromosome, complete genome	4869482	1253604	1275611	4869482	tail,lysis	Enterobacteria_phage(46.43%)	31	NA	NA
AXP25781.1|1253604_1254504_-	DNA adenine methylase	NA	A0A0C5AMX6	Cyanophage	23.2	2.5e-08
AXP29104.1|1254583_1256317_-	AAA family ATPase	NA	NA	NA	NA	NA
AXP25782.1|1256375_1257542_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.2	1.8e-147
AXP25783.1|1257502_1257709_-	excisionase	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
AXP25784.1|1257768_1257984_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
AXP25785.1|1257980_1258343_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.5	1.5e-65
AXP25786.1|1258333_1258870_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	98.9	4.1e-99
AXP25787.1|1258998_1259823_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	4.3e-148
AXP25788.1|1259888_1260251_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AXP25789.1|1260639_1260894_-	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	2.7e-13
AXP25790.1|1260973_1261666_-	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
AXP29105.1|1261639_1261792_+	amino acid permease	NA	NA	NA	NA	NA
AXP25791.1|1261763_1262024_+	XRE family transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
AXP25792.1|1262016_1262568_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	98.4	4.9e-100
AXP25793.1|1262564_1263716_+	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	97.4	1.1e-210
AXP25794.1|1263712_1263937_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
AXP25795.1|1263933_1264752_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	1.2e-121
AXP25796.1|1264754_1265243_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	3.4e-84
AXP25797.1|1265209_1265569_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	99.1	2.3e-53
AXP25798.1|1265565_1265955_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8SBE7	Shigella_phage	100.0	7.1e-69
AXP25799.1|1265974_1266784_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	100.0	6.0e-155
AXP25800.1|1266791_1267781_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	9.5e-195
AXP25801.1|1267794_1268547_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	100.0	2.8e-138
AXP25802.1|1268799_1269003_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
AXP25803.1|1269153_1270206_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	1.0e-207
AXP25804.1|1270273_1270489_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AXP25805.1|1270493_1270844_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.9e-36
AXP25806.1|1270907_1273535_+|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	57.1	7.1e-197
AXP25807.1|1273534_1274119_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	7.0e-105
AXP25808.1|1274231_1275179_-	hypothetical protein	NA	NA	NA	NA	NA
AXP25809.1|1275416_1275611_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	87.5	1.7e-23
>prophage 4
CP031653	Escherichia coli strain UK_Dog_Liverpool chromosome, complete genome	4869482	1796944	1806386	4869482		Enterobacteria_phage(85.71%)	10	NA	NA
AXP26273.1|1796944_1797871_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AXP26274.1|1797875_1798607_+	ABC transporter permease	NA	NA	NA	NA	NA
AXP26275.1|1798587_1798695_-	protein YohO	NA	NA	NA	NA	NA
AXP26276.1|1798754_1799486_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AXP26277.1|1799707_1801393_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AXP26278.1|1801389_1802109_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXP26279.1|1802155_1802626_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AXP26280.1|1802666_1803128_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AXP26281.1|1803252_1805253_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
AXP26282.1|1805249_1806386_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 5
CP031653	Escherichia coli strain UK_Dog_Liverpool chromosome, complete genome	4869482	2387623	2416226	4869482	tail,integrase	Enterobacteria_phage(30.0%)	33	2388688:2388702	2412466:2412480
AXP26794.1|2387623_2390050_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
2388688:2388702	attL	CGCCGTCGCGGATTG	NA	NA	NA	NA
AXP26795.1|2390248_2390554_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AXP29151.1|2390661_2391372_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AXP26796.1|2391374_2391935_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AXP26797.1|2391969_2392311_-	DUF1283 family protein	NA	NA	NA	NA	NA
AXP26798.1|2392445_2392772_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AXP26799.1|2392808_2392997_+	hypothetical protein	NA	NA	NA	NA	NA
AXP26800.1|2392977_2394192_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AXP26801.1|2394203_2395223_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AXP26802.1|2395280_2395391_+	transporter	NA	NA	NA	NA	NA
AXP26803.1|2395410_2396706_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	6.7e-156
AXP26804.1|2396725_2396977_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AXP26805.1|2397049_2399521_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
AXP26806.1|2399614_2399806_-	DUF1482 family protein	NA	NA	NA	NA	NA
AXP26807.1|2399802_2399991_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AXP26808.1|2400074_2400317_+	hypothetical protein	NA	NA	NA	NA	NA
AXP26809.1|2400243_2401263_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	1.0e-58
AXP26810.1|2401303_2401726_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
AXP26811.1|2401855_2402800_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
AXP26812.1|2403347_2404697_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
AXP26813.1|2405014_2405617_+|integrase	integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
AXP26814.1|2405976_2406957_+	hypothetical protein	NA	NA	NA	NA	NA
AXP26815.1|2407326_2407470_+	hypothetical protein	NA	NA	NA	NA	NA
AXP26816.1|2407628_2407841_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
AXP26817.1|2408056_2408308_+	hypothetical protein	NA	NA	NA	NA	NA
AXP26818.1|2408374_2408653_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
AXP26819.1|2408654_2409704_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
AXP26820.1|2409716_2410091_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
AXP26821.1|2410087_2410909_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
AXP26822.1|2411654_2413817_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
2412466:2412480	attR	CGCCGTCGCGGATTG	NA	NA	NA	NA
AXP26823.1|2413887_2414283_+	hypothetical protein	NA	A5LH44	Enterobacteria_phage	97.4	6.1e-60
AXP26824.1|2414648_2416046_+	chaperone of endosialidase	NA	K7PGT9	Enterobacteria_phage	85.2	1.4e-204
AXP26825.1|2416100_2416226_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	1.5e-12
>prophage 6
CP031653	Escherichia coli strain UK_Dog_Liverpool chromosome, complete genome	4869482	2817473	2828251	4869482	integrase	Enterobacteria_phage(40.0%)	11	2815446:2815469	2826954:2826977
2815446:2815469	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
AXP27180.1|2817473_2819429_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
AXP27181.1|2821793_2822333_-	regulator	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
AXP27182.1|2822515_2822827_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
AXP27183.1|2822823_2823504_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
AXP29171.1|2823500_2823659_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
AXP27184.1|2823655_2824720_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
AXP27185.1|2824873_2825092_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
AXP27186.1|2825139_2825379_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
AXP27187.1|2825518_2825755_+	excisionase	NA	NA	NA	NA	NA
AXP27188.1|2825744_2826887_+|integrase	integrase	integrase	O21929	Phage_21	99.7	8.1e-206
AXP27189.1|2827000_2828251_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2826954:2826977	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 7
CP031653	Escherichia coli strain UK_Dog_Liverpool chromosome, complete genome	4869482	3283362	3310566	4869482	terminase,lysis,capsid,tail,integrase	Enterobacteria_phage(47.06%)	52	3285278:3285292	3310640:3310654
AXP27594.1|3283362_3284652_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
AXP27595.1|3284710_3285187_+	kinase inhibitor	NA	NA	NA	NA	NA
AXP27596.1|3285101_3285281_+	hypothetical protein	NA	NA	NA	NA	NA
3285278:3285292	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
AXP27597.1|3285932_3287264_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
AXP27598.1|3287337_3287514_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
AXP29197.1|3287705_3288332_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXP27599.1|3288276_3288414_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AXP27600.1|3289222_3289783_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
AXP27601.1|3289922_3290066_-	DNA-packaging protein	NA	NA	NA	NA	NA
AXP27602.1|3290171_3290405_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
AXP27603.1|3290461_3290872_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AXP27604.1|3290917_3291082_+	hypothetical protein	NA	NA	NA	NA	NA
AXP27605.1|3291223_3291376_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
AXP27606.1|3291363_3291831_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
AXP27607.1|3291827_3292325_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
AXP27608.1|3292324_3292540_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
AXP27609.1|3292727_3293315_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXP27610.1|3293323_3293458_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXP27611.1|3293809_3294769_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AXP27612.1|3294961_3295486_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
AXP27613.1|3295641_3296019_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
AXP27614.1|3296104_3296245_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
AXP27615.1|3296241_3296604_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
AXP27616.1|3296600_3296891_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
AXP27617.1|3296883_3297054_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AXP27618.1|3297053_3297509_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
AXP27619.1|3297505_3297607_-	hypothetical protein	NA	NA	NA	NA	NA
AXP27620.1|3297699_3298152_-	hypothetical protein	NA	NA	NA	NA	NA
AXP27621.1|3298148_3298709_-	UDP-N-acetylglucosamine acyltransferase	NA	NA	NA	NA	NA
AXP27622.1|3298965_3299157_+	hypothetical protein	NA	NA	NA	NA	NA
AXP27623.1|3299193_3299487_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
AXP27624.1|3299483_3300185_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
AXP27625.1|3300181_3301201_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.7e-109
AXP27626.1|3301197_3301737_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
AXP27627.1|3301806_3302037_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AXP27628.1|3302075_3302831_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AXP27629.1|3302953_3303703_+	hypothetical protein	NA	NA	NA	NA	NA
AXP27630.1|3303699_3304527_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AXP27631.1|3305035_3305242_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AXP27632.1|3305317_3305614_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AXP27633.1|3305619_3306405_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AXP27634.1|3306401_3307082_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
AXP29198.1|3307078_3307261_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
AXP27635.1|3307233_3307425_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
AXP27636.1|3307435_3307717_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
AXP27637.1|3307815_3308037_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
AXP27638.1|3308247_3308778_-	hypothetical protein	NA	NA	NA	NA	NA
AXP27639.1|3308668_3308920_-	hypothetical protein	NA	NA	NA	NA	NA
AXP27640.1|3308974_3309160_-	hypothetical protein	NA	NA	NA	NA	NA
AXP27641.1|3309092_3309260_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
AXP27642.1|3309299_3309518_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AXP27643.1|3309495_3310566_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3310640:3310654	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 8
CP031653	Escherichia coli strain UK_Dog_Liverpool chromosome, complete genome	4869482	3809734	3835453	4869482	integrase,lysis	Shigella_phage(37.5%)	39	3829862:3829876	3833542:3833556
AXP28099.1|3809734_3810316_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	60.7	2.6e-51
AXP28100.1|3810374_3810578_-	hypothetical protein	NA	NA	NA	NA	NA
AXP28101.1|3810590_3811829_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	35.0	4.1e-62
AXP28102.1|3812985_3813477_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
AXP28103.1|3813466_3813694_-	hypothetical protein	NA	NA	NA	NA	NA
AXP28104.1|3813814_3814717_-	S49 family peptidase	NA	NA	NA	NA	NA
AXP28105.1|3814720_3814921_-	hypothetical protein	NA	NA	NA	NA	NA
AXP28106.1|3815291_3815828_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	93.3	2.6e-74
AXP28107.1|3815827_3816394_-	lysozyme	NA	K7P7Q3	Enterobacteria_phage	85.6	1.5e-91
AXP28108.1|3816393_3816609_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AXP28109.1|3816676_3817729_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	1.0e-207
AXP28110.1|3817878_3818073_-	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	95.3	5.7e-27
AXP28111.1|3818343_3819213_+	hypothetical protein	NA	NA	NA	NA	NA
AXP28112.1|3819230_3819479_+	hypothetical protein	NA	NA	NA	NA	NA
AXP28113.1|3819921_3820290_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	3.8e-56
AXP28114.1|3820304_3821294_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	97.9	3.4e-192
AXP28115.1|3821301_3822111_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	98.1	1.4e-148
AXP28116.1|3822130_3822520_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
AXP28117.1|3822516_3822843_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
AXP28118.1|3822839_3823493_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	8.1e-126
AXP28119.1|3823492_3823987_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	8.1e-86
AXP28120.1|3823983_3824925_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	5.6e-144
AXP28121.1|3824914_3825094_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AXP28122.1|3825269_3825827_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.1	9.7e-96
AXP28123.1|3825819_3826080_-	XRE family transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
AXP28124.1|3826051_3826204_-	amino acid permease	NA	NA	NA	NA	NA
AXP28125.1|3826177_3826870_+	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
AXP28126.1|3826925_3827204_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	3.0e-13
AXP28127.1|3827305_3827500_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	96.9	7.1e-30
AXP29211.1|3827572_3827935_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AXP28128.1|3828000_3828825_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AXP28129.1|3828952_3829489_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
AXP28130.1|3829479_3829842_+	hypothetical protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
AXP28131.1|3829841_3830147_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
3829862:3829876	attL	AGAACTGATTAAAGA	NA	NA	NA	NA
AXP28132.1|3830146_3830497_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
AXP29212.1|3830598_3831537_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.4	2.3e-182
AXP28133.1|3831741_3832995_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
AXP28134.1|3833006_3834110_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
3833542:3833556	attR	TCTTTAATCAGTTCT	NA	NA	NA	NA
AXP28135.1|3834397_3835453_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 9
CP031653	Escherichia coli strain UK_Dog_Liverpool chromosome, complete genome	4869482	4221061	4227620	4869482	transposase	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
AXP28480.1|4221061_4222018_+	iron-dicitrate ABC transporter permease FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AXP28481.1|4222018_4222786_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AXP28482.1|4223343_4223757_-	hypothetical protein	NA	NA	NA	NA	NA
AXP28483.1|4224652_4225804_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
AXP28484.1|4225723_4226074_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
AXP28485.1|4226174_4226747_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
AXP28486.1|4226795_4227620_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
>prophage 1
CP031654	Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_01, complete sequence	89643	0	89325	89643	portal,terminase,head,holin,plate,lysis,tail	Escherichia_phage(61.8%)	94	NA	NA
AXP29252.1|0_861_+	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
AXP29253.1|1418_2615_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AXP29254.1|2631_3633_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.4	1.1e-177
AXP29255.1|3858_5565_+	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.2	6.3e-311
AXP29256.1|5625_7215_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.5	2.4e-301
AXP29257.1|7224_8040_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	2.6e-113
AXP29258.1|8075_8657_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
AXP29259.1|8668_9178_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
AXP29260.1|9261_9558_+	hypothetical protein	NA	Q1MVK0	Enterobacteria_phage	100.0	9.2e-53
AXP29261.1|9724_10189_-	oxidoreductase	NA	Q1MVK1	Enterobacteria_phage	98.7	4.3e-89
AXP29262.1|10188_10893_-	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	99.6	1.3e-134
AXP29263.1|11061_11907_-	Replication protein repL	NA	Q1MVK3	Enterobacteria_phage	97.9	1.2e-150
AXP29264.1|11936_12737_-	DNA-binding protein	NA	Q1MVK4	Enterobacteria_phage	99.6	1.6e-147
AXP29265.1|12900_13935_-	phage antirepressor Ant	NA	A0A077SLI1	Escherichia_phage	99.1	4.5e-187
AXP29266.1|13931_14153_-	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	100.0	1.3e-38
AXP29267.1|14772_15285_+	hypothetical protein	NA	A0A077SK39	Escherichia_phage	100.0	4.5e-55
AXP29268.1|15288_15828_+	hypothetical protein	NA	A0A077SL46	Escherichia_phage	100.0	1.8e-46
AXP29269.1|15908_16475_+	hypothetical protein	NA	A0A077SK12	Escherichia_phage	99.5	6.6e-100
AXP29270.1|16485_17097_+|tail	phage tail protein	tail	Q71TN8	Escherichia_phage	99.5	2.9e-109
AXP29271.1|17111_17993_+	morphogenetic protein	NA	A0A1B0VBL3	Salmonella_phage	99.7	3.7e-174
AXP29272.1|18074_21815_+	lytic transglycosylase domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	87.4	0.0e+00
AXP29273.1|21814_22171_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
AXP29274.1|22167_23601_+	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.4	3.4e-270
AXP29275.1|23600_24437_+|tail	phage tail protein	tail	A0A077SLH5	Escherichia_phage	99.6	1.5e-153
AXP29276.1|24515_24950_+|tail	phage tail protein	tail	A0A077SLL3	Escherichia_phage	98.6	2.8e-74
AXP29277.1|24961_29662_+	hypothetical protein	NA	Q71TP5	Escherichia_phage	57.9	4.1e-296
AXP29278.1|29661_30072_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	80.3	1.6e-23
AXP29279.1|30490_30772_+	hypothetical protein	NA	A0A1B0VBS6	Salmonella_phage	90.3	9.1e-42
AXP29280.1|30839_31169_+|holin	holin	holin	Q37876	Escherichia_phage	99.1	3.0e-52
AXP29281.1|31165_31609_+|lysis	lysis protein	lysis	A0A077SK09	Escherichia_phage	98.0	2.0e-80
AXP29282.1|31595_32198_+	odaE	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
AXP29283.1|32199_34119_+	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	95.6	0.0e+00
AXP29284.1|34115_34481_+	ddrA	NA	A0A077SK35	Escherichia_phage	98.3	6.7e-45
AXP29285.1|34493_37481_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	98.4	0.0e+00
AXP29286.1|37470_37788_+	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	88.6	7.6e-45
AXP29287.1|37817_38612_-	hypothetical protein	NA	Q71TF1	Escherichia_phage	96.6	8.0e-144
AXP29288.1|38814_39303_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	99.4	1.1e-87
AXP29289.1|39471_40029_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
AXP29290.1|40164_40341_+|holin	antiholin	holin	Q71TR5	Escherichia_phage	89.7	6.3e-25
AXP29291.1|40320_41340_-|head	head processing protein	head	Q71TR6	Escherichia_phage	95.9	1.9e-177
AXP29292.1|41332_43042_-|portal	phage portal protein	portal	Q71TR7	Escherichia_phage	99.6	0.0e+00
AXP29293.1|43118_49886_+	helicase	NA	Q1MVN7	Enterobacteria_phage	98.6	0.0e+00
AXP29294.1|49919_50360_+	peptide-binding protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
AXP29295.1|50356_50605_+	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AXP29296.1|50663_51173_-	hypothetical protein	NA	NA	NA	NA	NA
AXP29297.1|51172_52213_-	hypothetical protein	NA	NA	NA	NA	NA
AXP29298.1|52303_52945_-	maturation control protein	NA	A0A077SK30	Escherichia_phage	96.2	4.2e-111
AXP29299.1|53134_53695_-	recombinase	NA	Q71TG3	Escherichia_phage	96.8	3.6e-98
AXP29300.1|53941_54253_-	lysogeny establishment protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	6.3e-44
AXP29301.1|54303_55335_-	recombinase	NA	A0A077SLE7	Escherichia_phage	99.4	6.4e-194
AXP29302.1|55342_55564_-	creatininase	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
AXP29303.1|55966_56080_+	peptidase	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
AXP29304.1|56098_56194_+	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AXP29305.1|56159_56369_+	c1 repressor inactivator	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
AXP29306.1|56479_57331_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	4.0e-157
AXP29307.1|57356_58841_-|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
AXP29308.1|58840_60034_-|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	88.7	7.2e-181
AXP29309.1|60119_60572_-	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
AXP29310.1|60660_61704_-	DUF968 domain-containing protein	NA	Q1MVE3	Enterobacteria_phage	99.7	1.8e-207
AXP29311.1|61731_61911_-	PdcA protein	NA	Q71TH5	Escherichia_phage	100.0	7.1e-24
AXP29312.1|61915_62296_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
AXP29313.1|62295_62517_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AXP29314.1|62589_62979_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	100.0	8.3e-70
AXP29315.1|64315_66172_-	acyltransferase	NA	B5WZU0	Pseudomonas_phage	38.2	8.3e-75
AXP29316.1|67067_67262_-	hypothetical protein	NA	NA	NA	NA	NA
AXP29317.1|67494_68757_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.3	1.7e-233
AXP29318.1|68758_68977_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AXP29319.1|69058_69760_-	hypothetical protein	NA	Q71TJ0	Escherichia_phage	99.6	1.0e-142
AXP29320.1|69756_70434_-	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	97.3	3.3e-130
AXP29321.1|70430_71057_-	norphogenetic protein	NA	Q71T82	Escherichia_phage	99.0	4.0e-122
AXP29322.1|70954_71617_-	norphogenetic protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
AXP29323.1|71558_71714_-	norphogenetic protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
AXP29324.1|71780_72359_-	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	99.5	4.4e-107
AXP29325.1|72361_72607_-	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
AXP29326.1|72753_73131_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
AXP29327.1|73140_74358_+|tail	phage tail protein	tail	A0A077SL53	Escherichia_phage	99.5	4.1e-224
AXP29328.1|74361_75090_+|tail	phage tail protein	tail	Q71TJ9	Escherichia_phage	100.0	4.2e-139
AXP29329.1|75076_75862_+|plate	baseplate	plate	A0A1B0V7N6	Salmonella_phage	99.2	1.4e-143
AXP29330.1|75863_76880_+|tail	phage tail tape measure protein	tail	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
AXP29331.1|76872_77505_+|plate	baseplate protein	plate	Q1MVH8	Enterobacteria_phage	99.4	7.7e-89
AXP29332.1|77551_78526_-	hypothetical protein	NA	A0A077SL52	Escherichia_phage	98.1	5.5e-187
AXP29333.1|78522_78825_-	hypothetical protein	NA	NA	NA	NA	NA
AXP29334.1|78824_80189_-	replicative DNA helicase	NA	O80281	Escherichia_phage	99.6	1.8e-252
AXP29335.1|80179_80395_+	hypothetical protein	NA	NA	NA	NA	NA
AXP29336.1|80661_80826_-	DUF3927 domain-containing protein	NA	Q1MVI2	Enterobacteria_phage	98.1	6.9e-18
AXP29337.1|80825_81260_-	tellurite resistance protein	NA	Q1MVI3	Enterobacteria_phage	100.0	8.1e-74
AXP29345.1|81456_81648_+	hypothetical protein	NA	Q71T98	Escherichia_phage	100.0	6.0e-29
AXP29338.1|82822_85864_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	86.5	0.0e+00
AXP29339.1|85860_86766_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
AXP29340.1|86758_87043_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	97.9	2.5e-47
AXP29341.1|87316_87496_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
AXP29342.1|87504_88293_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	96.6	1.4e-116
AXP29343.1|88332_88755_+	ppfA	NA	A0A1B0VCB0	Salmonella_phage	86.4	1.1e-46
AXP29344.1|88932_89325_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
