The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031689	Haemophilus influenzae strain P621-7028 chromosome, complete genome	1838740	156325	166505	1838740		Bacillus_phage(33.33%)	12	NA	NA
AXP37204.1|156325_157342_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	44.9	3.9e-74
AXP37205.1|157407_157821_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AXP37206.1|157871_158555_+	response regulator	NA	W8CYM9	Bacillus_phage	38.8	5.8e-34
AXP38719.1|158649_158997_+	hypothetical protein	NA	W8CYF6	Bacillus_phage	36.1	1.1e-09
AXP37207.1|159029_160001_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9L3L6	Tupanvirus	27.4	3.6e-29
AXP37208.1|160211_162011_+	fumarate reductase (quinol) flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	24.9	3.8e-16
AXP37209.1|162003_162774_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AXP37210.1|162784_163195_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
AXP37211.1|163207_163552_+	fumarate reductase subunit D	NA	NA	NA	NA	NA
AXP37212.1|163658_164399_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AXP37213.1|164385_164691_-	trp operon repressor	NA	NA	NA	NA	NA
AXP37214.1|164723_166505_-	lytic murein transglycosylase	NA	K4NWI2	Pseudomonas_phage	39.5	4.5e-17
>prophage 2
CP031689	Haemophilus influenzae strain P621-7028 chromosome, complete genome	1838740	744328	806119	1838740	tRNA,transposase,head,tail	Burkholderia_virus(23.08%)	60	NA	NA
AXP37747.1|744328_745771_+|tRNA	glutamate--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	35.2	1.7e-11
AXP37748.1|746071_746788_+	ribonuclease PH	NA	NA	NA	NA	NA
AXP37749.1|746811_747453_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
AXP37750.1|747531_748398_+	co-chaperone DjlA	NA	NA	NA	NA	NA
AXP37751.1|748397_749330_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
AXP37752.1|749369_750215_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.5	2.1e-41
AXP37753.1|750340_751366_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
AXP37754.1|751375_753079_-	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
AXP37755.1|753120_753720_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AXP37756.1|753802_754159_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AXP37757.1|754254_757017_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
AXP37758.1|757028_758726_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
AXP37759.1|758801_760961_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
AXP37760.1|761283_762327_-	ADP-heptose--LPS heptosyltransferase I	NA	NA	NA	NA	NA
AXP37761.1|762403_763129_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
AXP37762.1|763140_763728_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	31.8	9.8e-14
AXP37763.1|763807_764782_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
AXP37764.1|765218_765542_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AXP37765.1|765714_766362_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AXP37766.1|766472_767369_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AXP37767.1|767469_767937_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
AXP37768.1|768104_768557_+	biopolymer transporter ExbB	NA	NA	NA	NA	NA
AXP37769.1|768560_769004_+	TonB system transport protein ExbD	NA	NA	NA	NA	NA
AXP37770.1|769013_769808_+	energy transducer TonB	NA	NA	NA	NA	NA
AXP37771.1|769985_770492_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	57.5	8.7e-43
AXP37772.1|770645_773477_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
AXP37773.1|773795_777968_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	35.0	1.9e-87
AXP37774.1|778360_778855_-	ci repressor-like protein	NA	NA	NA	NA	NA
AXP37775.1|779236_781138_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	34.0	4.4e-79
AXP37776.1|781164_782082_+	DNA transposition protein	NA	A0A2I7S9C3	Vibrio_phage	43.4	4.0e-62
AXP37777.1|782081_782282_+	hypothetical protein	NA	NA	NA	NA	NA
AXP37778.1|783388_783925_+	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	42.8	3.0e-33
AXP37779.1|784596_784953_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXP37780.1|784952_785486_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AXP37781.1|785911_786097_+	hypothetical protein	NA	NA	NA	NA	NA
AXP37782.1|786117_786474_+	hypothetical protein	NA	NA	NA	NA	NA
AXP37783.1|786557_787109_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	68.2	4.2e-75
AXP37784.1|787111_787336_+	hypothetical protein	NA	NA	NA	NA	NA
AXP38730.1|787472_787709_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	74.6	1.8e-19
AXP37785.1|787665_787953_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
AXP37786.1|788390_788696_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	57.6	1.1e-24
AXP38731.1|789354_790842_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	61.5	1.6e-161
AXP37787.1|792262_793540_+|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	47.6	1.6e-53
AXP37788.1|793726_793915_+	hypothetical protein	NA	NA	NA	NA	NA
AXP37789.1|794117_794618_+	phage virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	34.6	4.3e-18
AXP37790.1|794860_795964_+	peptidase	NA	A4JWJ9	Burkholderia_virus	39.2	1.2e-65
AXP37791.1|795982_796909_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	47.9	3.0e-73
AXP37792.1|796974_797238_+	hypothetical protein	NA	NA	NA	NA	NA
AXP37793.1|797237_797672_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	36.4	4.4e-19
AXP37794.1|797683_798181_+	hypothetical protein	NA	NA	NA	NA	NA
AXP37795.1|798190_799576_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	44.1	1.3e-96
AXP37796.1|799586_800105_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	45.6	6.6e-38
AXP37797.1|800199_800475_+|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	36.8	1.0e-05
AXP37798.1|800495_800636_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AXP37799.1|800651_800885_-	hypothetical protein	NA	NA	NA	NA	NA
AXP37800.1|800921_803135_+|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	44.4	4.8e-69
AXP37801.1|803134_804067_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	29.9	1.6e-18
AXP37802.1|804047_804278_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	46.3	4.7e-12
AXP38732.1|805167_805587_-	hypothetical protein	NA	A0A0R6PHZ9	Moraxella_phage	33.6	6.3e-07
AXP37803.1|805633_806119_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	32.8	3.3e-07
>prophage 3
CP031689	Haemophilus influenzae strain P621-7028 chromosome, complete genome	1838740	1352721	1358246	1838740		Mannheimia_phage(50.0%)	8	NA	NA
AXP38266.1|1352721_1352973_-	phage antirepressor Ant	NA	A0A0M3LQ72	Mannheimia_phage	72.7	2.3e-28
AXP38267.1|1353622_1353793_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AXP38268.1|1354142_1355114_-	SppA protein	NA	NA	NA	NA	NA
AXP38269.1|1355168_1355825_-	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	57.9	2.1e-65
AXP38270.1|1355955_1356162_+	XRE family transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	67.7	1.9e-17
AXP38271.1|1356182_1356479_+	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	70.4	3.4e-31
AXP38272.1|1356526_1357195_+	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	52.1	2.0e-55
AXP38273.1|1358069_1358246_+	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	93.1	8.5e-22
>prophage 4
CP031689	Haemophilus influenzae strain P621-7028 chromosome, complete genome	1838740	1425765	1520705	1838740	integrase,terminase,tRNA,portal,holin,tail	Haemophilus_phage(12.07%)	110	1437881:1437903	1480442:1480464
AXP38322.1|1425765_1426731_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AXP38323.1|1426773_1427652_-	cytidine deaminase	NA	NA	NA	NA	NA
AXP38324.1|1427925_1428408_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
AXP38325.1|1428876_1430115_-	peptidase T	NA	NA	NA	NA	NA
AXP38326.1|1430380_1431529_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	37.1	1.9e-29
AXP38327.1|1431512_1432373_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.2	7.6e-15
AXP38328.1|1432372_1433143_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
AXP38329.1|1433215_1434355_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AXP38330.1|1435935_1436292_+	hypothetical protein	NA	NA	NA	NA	NA
AXP38331.1|1436401_1436596_-	guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
AXP38332.1|1436531_1436771_-	DNA cytosine methyltransferase	NA	A0A2H4PAK4	Aphanizomenon_phage	44.1	1.0e-06
AXP38333.1|1436764_1436983_+	hypothetical protein	NA	NA	NA	NA	NA
AXP38334.1|1436963_1438394_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	E3SJ88	Synechococcus_phage	44.6	4.1e-21
1437881:1437903	attL	CATTCGCTTTACGTGCAATTTGA	NA	NA	NA	NA
AXP38335.1|1438490_1439426_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.0	2.6e-53
AXP38336.1|1439499_1441398_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.9	2.1e-97
AXP38337.1|1441465_1443709_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.6	3.7e-85
AXP38338.1|1443750_1444965_+	sodium/glutamate symport carrier protein	NA	NA	NA	NA	NA
AXP38339.1|1445003_1445912_-	RimK family alpha-L-glutamate ligase	NA	A0A1D7SA11	Synechococcus_phage	34.0	1.0e-33
AXP38340.1|1446028_1446292_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	70.1	9.4e-25
AXP38341.1|1446358_1447579_-	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
AXP38342.1|1447727_1449740_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AXP38343.1|1449827_1450814_+	protein licA	NA	NA	NA	NA	NA
AXP38344.1|1450813_1451692_+	DMT family transporter	NA	NA	NA	NA	NA
AXP38345.1|1451688_1452390_+|holin	CTP--phosphocholine cytidylyltransferase	holin	NA	NA	NA	NA
AXP38346.1|1452389_1453187_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	51.1	2.1e-06
AXP38347.1|1453224_1455072_-	signal peptide peptidase SppA	NA	A0A2I6UG67	Salinibacter_virus	28.0	3.0e-16
AXP38348.1|1455169_1455724_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AXP38349.1|1456321_1456930_-	flavodoxin family protein	NA	NA	NA	NA	NA
AXP38350.1|1457049_1458294_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
AXP38351.1|1458578_1459019_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
AXP38352.1|1459088_1460177_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A1Z1LYN9	Serratia_phage	47.0	7.8e-81
AXP38746.1|1460394_1461645_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AXP38353.1|1461644_1462328_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.1	5.6e-37
AXP38354.1|1462409_1463051_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AXP38355.1|1463060_1463843_-	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
AXP38356.1|1463830_1464478_-	DUF452 family protein	NA	NA	NA	NA	NA
AXP38357.1|1464487_1465630_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AXP38358.1|1465616_1466924_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
AXP38359.1|1466942_1468124_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
AXP38360.1|1468123_1469071_-	2-hydroxyacid dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	31.4	3.9e-28
AXP38361.1|1469130_1469985_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.9	2.9e-46
AXP38362.1|1469999_1470803_-	hypothetical protein	NA	NA	NA	NA	NA
AXP38363.1|1470802_1471681_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AXP38364.1|1471680_1472151_-	RDD family protein	NA	NA	NA	NA	NA
AXP38365.1|1472173_1473259_-	peptide chain release factor 1	NA	G0YKC3	Acinetobacter_phage	52.8	6.3e-06
AXP38366.1|1473345_1473882_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AXP38367.1|1474155_1474857_-	hypothetical protein	NA	B7SDN5	Haemophilus_phage	62.1	5.7e-77
AXP38747.1|1474868_1475030_-	DUF935 family protein	NA	B7SDN1	Haemophilus_phage	66.7	1.5e-12
AXP38368.1|1475028_1475505_+	pyruvate kinase	NA	NA	NA	NA	NA
AXP38369.1|1475518_1475821_+	hypothetical protein	NA	NA	NA	NA	NA
AXP38370.1|1475831_1476332_+	hypothetical protein	NA	B3GVZ0	Streptococcus_phage	40.2	1.7e-22
AXP38371.1|1476331_1476616_+	hypothetical protein	NA	A0A0M3LP12	Mannheimia_phage	51.1	1.1e-18
AXP38372.1|1476646_1477648_-|integrase	site-specific integrase	integrase	A0A0M3LRG1	Mannheimia_phage	62.2	1.0e-111
AXP38373.1|1478097_1478520_-	enoyl-CoA hydratase	NA	F6MIM0	Haemophilus_phage	65.5	6.1e-50
AXP38374.1|1478586_1479189_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	71.5	1.3e-72
AXP38748.1|1479200_1480811_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	61.4	4.2e-200
1480442:1480464	attR	CATTCGCTTTACGTGCAATTTGA	NA	NA	NA	NA
AXP38375.1|1481007_1484658_-|tail	phage tail protein	tail	A0A0R6PIC9	Moraxella_phage	37.2	3.8e-140
AXP38376.1|1484661_1485381_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	39.7	1.0e-33
AXP38377.1|1485319_1486027_-	hypothetical protein	NA	A0A1B1IV85	uncultured_Mediterranean_phage	43.2	2.6e-53
AXP38378.1|1486028_1486679_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	39.6	3.3e-34
AXP38379.1|1487415_1487949_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AXP38380.1|1488010_1488355_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	41.3	8.6e-18
AXP38381.1|1488355_1490734_-	hypothetical protein	NA	H6WRV7	Salmonella_phage	32.0	1.5e-28
AXP38382.1|1490675_1490981_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXP38383.1|1491043_1491427_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXP38384.1|1491432_1491933_-|tail	phage tail protein	tail	O64327	Escherichia_phage	56.1	7.5e-39
AXP38385.1|1491925_1492330_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	31.3	6.3e-12
AXP38386.1|1492326_1492872_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	40.6	1.9e-27
AXP38387.1|1492871_1493177_-	hypothetical protein	NA	NA	NA	NA	NA
AXP38388.1|1493157_1493481_-	DUF2190 family protein	NA	NA	NA	NA	NA
AXP38389.1|1495538_1497062_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	58.3	4.9e-158
AXP38390.1|1497065_1497284_-	hypothetical protein	NA	NA	NA	NA	NA
AXP38391.1|1497280_1499401_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	66.7	1.1e-272
AXP38392.1|1499403_1499877_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	52.3	7.1e-39
AXP38393.1|1500153_1500543_-	hypothetical protein	NA	NA	NA	NA	NA
AXP38394.1|1500584_1500866_-	hypothetical protein	NA	Q776X1	Haemophilus_phage	72.2	1.4e-29
AXP38395.1|1500777_1501101_-	DUF2570 domain-containing protein	NA	Q7Y5U9	Haemophilus_phage	55.1	3.5e-21
AXP38396.1|1501093_1501696_-	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	55.4	3.9e-58
AXP38397.1|1501661_1502021_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AXP38398.1|1502260_1502779_-	antitermination protein	NA	G8C7V7	Escherichia_phage	34.0	3.4e-18
AXP38399.1|1502779_1503325_-	recombination protein NinG	NA	D0UIK8	Aggregatibacter_phage	71.9	8.1e-63
AXP38400.1|1503413_1503833_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	83.3	3.1e-62
AXP38401.1|1503869_1504088_-	hypothetical protein	NA	A0A0M3LPX7	Mannheimia_phage	59.7	1.3e-16
AXP38402.1|1504087_1505011_-	SAM-dependent methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	58.5	1.7e-97
AXP38403.1|1505007_1505589_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	56.0	7.6e-51
AXP38404.1|1505585_1506221_-	replication P	NA	A0A1P8DTF3	Proteus_phage	35.5	3.5e-17
AXP38405.1|1506205_1506964_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	68.3	3.6e-61
AXP38406.1|1506960_1507629_-	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	54.3	5.7e-58
AXP38407.1|1507674_1507899_-	transcriptional regulator	NA	D0UIL8	Aggregatibacter_phage	53.2	2.7e-12
AXP38408.1|1508035_1508947_+	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	40.5	8.0e-39
AXP38409.1|1508957_1510655_+	hypothetical protein	NA	D0UIM0	Aggregatibacter_phage	86.5	2.2e-287
AXP38410.1|1510645_1510846_-	hypothetical protein	NA	NA	NA	NA	NA
AXP38411.1|1510929_1511100_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AXP38412.1|1511114_1511336_+	hypothetical protein	NA	NA	NA	NA	NA
AXP38413.1|1512188_1512440_+	hypothetical protein	NA	NA	NA	NA	NA
AXP38414.1|1512429_1513455_+	endonuclease	NA	A0A0M3LQ72	Mannheimia_phage	47.0	1.7e-24
AXP38415.1|1513505_1513847_+	hypothetical protein	NA	NA	NA	NA	NA
AXP38416.1|1513846_1514035_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
AXP38417.1|1514365_1514866_+	hypothetical protein	NA	B4XYS3	Lactobacillus_phage	36.6	4.7e-17
AXP38418.1|1514876_1515530_+	hypothetical protein	NA	A0A077KCB6	Edwardsiella_phage	51.6	3.9e-27
AXP38419.1|1515539_1515974_+	single-stranded DNA-binding protein	NA	A0A059WRL7	Vibrio_phage	36.2	9.8e-19
AXP38420.1|1516033_1516213_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	62.1	1.8e-11
AXP38421.1|1516532_1516769_+	hypothetical protein	NA	NA	NA	NA	NA
AXP38422.1|1516765_1517125_+	hypothetical protein	NA	NA	NA	NA	NA
AXP38423.1|1517132_1518302_+	DNA (cytosine-5-)-methyltransferase	NA	A0A2I7R2G4	Vibrio_phage	46.9	3.0e-94
AXP38424.1|1518298_1518541_+	hypothetical protein	NA	NA	NA	NA	NA
AXP38425.1|1518537_1518816_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
AXP38426.1|1518819_1519131_+	hypothetical protein	NA	NA	NA	NA	NA
AXP38427.1|1519260_1519461_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXP38428.1|1519457_1520705_-	DUF4102 domain-containing protein	NA	A0A1V0E8G8	Vibrio_phage	37.4	2.1e-74
>prophage 5
CP031689	Haemophilus influenzae strain P621-7028 chromosome, complete genome	1838740	1648786	1657295	1838740		uncultured_Caudovirales_phage(16.67%)	9	NA	NA
AXP38541.1|1648786_1649470_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	51.2	1.0e-54
AXP38542.1|1649462_1649888_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	42.7	1.3e-20
AXP38543.1|1649888_1650524_+	7-carboxy-7-deazaguanine synthase	NA	S4TZT1	uncultured_phage	30.3	8.7e-16
AXP38752.1|1650913_1651147_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
AXP38544.1|1651130_1653314_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.7	3.9e-116
AXP38545.1|1653433_1654405_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
AXP38546.1|1654419_1655307_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AXP38547.1|1655316_1656309_+	dipeptide transport ATP-binding protein DppD	NA	G3M9Y6	Bacillus_virus	30.8	2.0e-14
AXP38548.1|1656311_1657295_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	1.4e-20
>prophage 6
CP031689	Haemophilus influenzae strain P621-7028 chromosome, complete genome	1838740	1788010	1797031	1838740		Escherichia_phage(83.33%)	9	NA	NA
AXP38672.1|1788010_1789855_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.3	1.1e-21
AXP38673.1|1789932_1790211_-	copper chaperone	NA	NA	NA	NA	NA
AXP38755.1|1790219_1790537_-	hypothetical protein	NA	NA	NA	NA	NA
AXP38674.1|1790556_1791666_-	transglutaminase family protein	NA	NA	NA	NA	NA
AXP38675.1|1791918_1794339_+	twin-arginine translocation signal domain-containing protein	NA	A0A077SK27	Escherichia_phage	50.4	3.1e-223
AXP38676.1|1794349_1794967_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	56.8	4.9e-72
AXP38677.1|1794968_1795808_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	31.9	1.9e-18
AXP38678.1|1795919_1796531_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	32.5	1.7e-21
AXP38679.1|1796530_1797031_+	ferredoxin-type protein NapF	NA	A0A077SLP0	Escherichia_phage	32.0	3.2e-13
