The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031613	Klebsiella pneumoniae strain ZYST1 chromosome, complete genome	5248387	1202634	1288182	5248387	head,lysis,tRNA,tail,integrase,plate,portal,capsid	Salmonella_phage(71.7%)	94	1212266:1212313	1247103:1247150
AXS29693.1|1202634_1204968_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.4	0.0e+00
AXS29694.1|1204982_1205303_-	hypothetical protein	NA	NA	NA	NA	NA
AXS29695.1|1205299_1205527_-	hypothetical protein	NA	NA	NA	NA	NA
AXS29696.1|1205523_1206075_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	3.0e-33
AXS29697.1|1206887_1207625_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	66.1	6.9e-81
AXS29698.1|1207621_1207867_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	77.8	3.7e-31
AXS29699.1|1207883_1208450_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	1.5e-56
AXS29700.1|1208491_1208599_-	acetyl xylan esterase	NA	NA	NA	NA	NA
AXS29701.1|1208964_1210857_+	hypothetical protein	NA	NA	NA	NA	NA
AXS29702.1|1210893_1212081_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	51.0	2.4e-107
AXS29703.1|1212216_1212399_+	hypothetical protein	NA	NA	NA	NA	NA
1212266:1212313	attL	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACATCCT	NA	NA	NA	NA
AXS29704.1|1212427_1213618_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	49.6	6.9e-107
AXS29705.1|1213627_1214641_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.5	8.0e-189
AXS29706.1|1214643_1215273_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.8e-61
AXS29707.1|1215395_1215638_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AXS29708.1|1215670_1216180_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	85.2	1.4e-77
AXS29709.1|1216187_1216388_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	84.6	1.3e-26
AXS29710.1|1216351_1216693_+	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	86.7	1.1e-49
AXS29711.1|1216760_1216994_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	92.2	3.5e-31
AXS29712.1|1216993_1217221_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	90.7	1.5e-34
AXS29713.1|1217217_1217514_+	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	50.0	1.0e-11
AXS29714.1|1217510_1218398_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	71.1	1.0e-110
AXS29715.1|1218378_1220763_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.4	0.0e+00
AXS29716.1|1220925_1221114_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
AXS29717.1|1221125_1221359_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	94.8	9.8e-34
AXS29718.1|1221454_1222138_-	hypothetical protein	NA	NA	NA	NA	NA
AXS29719.1|1222124_1223204_-	hypothetical protein	NA	NA	NA	NA	NA
AXS29720.1|1223203_1224205_-	hypothetical protein	NA	NA	NA	NA	NA
AXS29721.1|1224726_1224996_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	42.4	2.4e-15
AXS29722.1|1225048_1226095_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.3	1.2e-171
AXS29723.1|1226094_1227861_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	92.2	0.0e+00
AXS29724.1|1228001_1228835_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	72.6	3.6e-102
AXS29725.1|1228851_1229904_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	90.5	2.6e-174
AXS29726.1|1229907_1230561_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	79.1	4.2e-90
AXS29727.1|1230656_1231121_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	2.3e-74
AXS29728.1|1231120_1231324_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	88.1	1.7e-29
AXS29729.1|1231327_1231543_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	2.1e-30
AXS29730.1|1231523_1232033_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	5.2e-80
AXS29731.1|1232037_1232421_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	46.2	5.1e-19
AXS29732.1|1232417_1232846_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	5.4e-54
AXS29733.1|1232775_1232979_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	73.1	4.9e-21
AXS29734.1|1232941_1233373_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.9	3.4e-64
AXS29735.1|1233365_1233812_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	78.6	8.7e-55
AXS29736.1|1233880_1234453_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	71.2	4.7e-77
AXS29737.1|1234449_1234812_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	3.5e-46
AXS29738.1|1234798_1235707_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.9	1.6e-108
AXS29739.1|1235699_1236296_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	57.6	1.2e-54
AXS29740.1|1238313_1238565_+	hypothetical protein	NA	NA	NA	NA	NA
AXS29741.1|1238636_1239800_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	48.3	1.2e-42
AXS29742.1|1239936_1241109_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	1.7e-206
AXS29743.1|1241118_1241634_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.8	6.3e-81
AXS29744.1|1241686_1241986_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	77.0	4.8e-33
AXS29745.1|1242000_1242120_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AXS29746.1|1242112_1244743_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	37.0	6.2e-108
AXS29747.1|1244739_1245234_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	78.9	1.0e-59
AXS29748.1|1245221_1246316_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	82.5	1.3e-168
AXS29749.1|1246382_1246601_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AXS29750.1|1246628_1247006_-	hypothetical protein	NA	NA	NA	NA	NA
AXS29751.1|1247609_1248092_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1247103:1247150	attR	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACATCCT	NA	NA	NA	NA
AXS29752.1|1248202_1248679_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AXS29753.1|1248668_1248959_+	RnfH family protein	NA	NA	NA	NA	NA
AXS29754.1|1249025_1249367_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AXS29755.1|1249514_1251176_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AXS29756.1|1251262_1252141_-	NAD(+) kinase	NA	NA	NA	NA	NA
AXS29757.1|1252265_1252856_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AXS29758.1|1252975_1254262_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AXS29759.1|1254281_1255073_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AXS29760.1|1255236_1256601_+	signal recognition particle protein	NA	NA	NA	NA	NA
AXS29761.1|1256860_1257109_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AXS29762.1|1257127_1257676_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AXS29763.1|1257707_1258475_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AXS29764.1|1258514_1258862_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AXS29765.1|1258980_1259439_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AXS29766.1|1259495_1260866_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AXS29767.1|1260874_1261357_-	OmpA family protein	NA	NA	NA	NA	NA
AXS29768.1|1261370_1262594_-	diguanylate cyclase	NA	NA	NA	NA	NA
AXS29769.1|1262586_1263096_-	YfiR family protein	NA	NA	NA	NA	NA
AXS29770.1|1263438_1264509_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
AXS29771.1|1264518_1265640_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AXS29772.1|1265702_1266575_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AXS29773.1|1266571_1267732_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AXS29774.1|1267832_1267880_-	hypothetical protein	NA	NA	NA	NA	NA
AXS29775.1|1267986_1268322_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AXS29776.1|1268592_1269330_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AXS29777.1|1269461_1270442_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AXS29778.1|1270438_1271170_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AXS29779.1|1271299_1273873_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
AXS29780.1|1279870_1281169_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	4.1e-44
AXS29781.1|1281172_1281496_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
AXS29782.1|1281537_1282893_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AXS29783.1|1283013_1285665_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AXS29784.1|1285699_1286398_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AXS29785.1|1286467_1286893_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AXS29786.1|1287096_1288182_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
CP031613	Klebsiella pneumoniae strain ZYST1 chromosome, complete genome	5248387	1363223	1428843	5248387	holin,tail,protease,integrase,transposase,terminase	Salmonella_phage(33.96%)	72	1364218:1364235	1431590:1431607
AXS29854.1|1363223_1364690_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
1364218:1364235	attL	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
AXS29855.1|1364757_1366335_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AXS29856.1|1366526_1367777_+|integrase	site-specific integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	6.8e-206
AXS29857.1|1367793_1367985_-	hypothetical protein	NA	NA	NA	NA	NA
AXS29858.1|1367981_1368575_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.4	3.7e-109
AXS29859.1|1368571_1368730_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.8	5.1e-18
AXS29860.1|1368722_1369016_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
AXS29861.1|1369125_1369374_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
AXS29862.1|1369422_1370304_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	6.8e-136
AXS29863.1|1370300_1371122_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.6	6.2e-131
AXS29864.1|1371121_1371406_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	44.0	2.4e-10
AXS29865.1|1371402_1371702_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	4.7e-20
AXS29866.1|1371709_1372741_-	hypothetical protein	NA	A0A1B0VN89	Pseudomonas_phage	51.4	3.6e-35
AXS29867.1|1373141_1373723_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	2.1e-64
AXS29868.1|1373876_1374110_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AXS29869.1|1374256_1374466_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.4e-26
AXS29870.1|1374465_1375227_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	90.2	1.6e-136
AXS29871.1|1375223_1376009_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
AXS29872.1|1376128_1376476_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	83.5	1.7e-50
AXS29873.1|1376668_1377208_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	41.9	1.5e-08
AXS29874.1|1377484_1378246_+	ead/Ea22-like family protein	NA	C6ZR30	Salmonella_phage	65.2	6.8e-07
AXS29875.1|1378242_1378422_+	hypothetical protein	NA	NA	NA	NA	NA
AXS29876.1|1378418_1379162_+	hypothetical protein	NA	K7P7E4	Enterobacteria_phage	56.6	3.3e-14
AXS29877.1|1379246_1379486_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	1.9e-08
AXS29878.1|1379485_1379722_+	hypothetical protein	NA	NA	NA	NA	NA
AXS29879.1|1379714_1380053_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	88.2	1.9e-49
AXS29880.1|1380127_1380385_+	lF-82	NA	NA	NA	NA	NA
AXS29881.1|1380462_1381047_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	89.1	1.3e-90
AXS29882.1|1381043_1382519_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.5	1.9e-279
AXS29883.1|1382530_1382803_-	hypothetical protein	NA	NA	NA	NA	NA
AXS29884.1|1382888_1383254_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	95.9	5.1e-61
AXS29885.1|1383745_1383934_+	hypothetical protein	NA	NA	NA	NA	NA
AXS29886.1|1383953_1384160_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
AXS29887.1|1384174_1385857_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	2.5e-264
AXS29888.1|1385853_1386150_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	9.6e-34
AXS29889.1|1386152_1386842_+	peptidase	NA	G9L6C4	Escherichia_phage	69.6	2.9e-65
AXS29890.1|1386856_1387843_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.6	3.3e-179
AXS29891.1|1387896_1388334_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
AXS29892.1|1388344_1388686_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	71.9	1.1e-36
AXS29893.1|1388736_1389060_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
AXS29894.1|1389059_1389665_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	79.0	3.3e-89
AXS29895.1|1389664_1392142_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.2	0.0e+00
AXS29896.1|1392141_1392606_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
AXS29897.1|1392605_1393145_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	79.4	3.0e-70
AXS29898.1|1393155_1395969_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	93.3	0.0e+00
AXS29899.1|1395965_1397771_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	73.3	1.7e-237
AXS29900.1|1397774_1400249_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	87.0	0.0e+00
AXS29901.1|1400447_1400744_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	94.8	4.4e-47
AXS29902.1|1400778_1400931_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	3.3e-14
AXS29903.1|1401029_1401326_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.1	2.4e-24
AXS29904.1|1403834_1404083_+	hypothetical protein	NA	NA	NA	NA	NA
AXS29905.1|1404418_1404823_+	hypothetical protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
AXS29906.1|1404809_1405115_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	80.4	7.8e-39
AXS29907.1|1405104_1405734_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	77.4	8.1e-91
AXS29908.1|1405730_1406213_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	77.5	4.1e-58
AXS29909.1|1406432_1408301_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
AXS29910.1|1408284_1409463_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
AXS29911.1|1409756_1410989_-	MFS transporter	NA	NA	NA	NA	NA
AXS29912.1|1411086_1411974_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXS29913.1|1412070_1412262_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
AXS29914.1|1414895_1416428_-	exopolyphosphatase	NA	NA	NA	NA	NA
AXS29915.1|1416431_1418492_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
AXS29916.1|1418672_1419314_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
AXS29917.1|1419310_1420348_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
AXS29918.1|1420611_1421505_+	beta-glucoside kinase	NA	NA	NA	NA	NA
AXS29919.1|1421514_1422948_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AXS29920.1|1423165_1423792_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AXS29921.1|1423887_1425174_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
AXS29922.1|1425272_1425974_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
AXS29923.1|1425970_1426882_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
AXS29924.1|1427010_1427370_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AXS29925.1|1427379_1428843_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
1431590:1431607	attR	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
>prophage 3
CP031613	Klebsiella pneumoniae strain ZYST1 chromosome, complete genome	5248387	2712399	2723286	5248387		Escherichia_phage(85.71%)	8	NA	NA
AXS31139.1|2712399_2715507_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
AXS31140.1|2716857_2717946_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.4	2.0e-209
AXS31141.1|2718032_2718293_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AXS31142.1|2718590_2719451_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AXS31143.1|2719471_2720233_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXS31144.1|2720223_2720457_+	hypothetical protein	NA	NA	NA	NA	NA
AXS31145.1|2720494_2721397_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.3	2.5e-157
AXS31146.1|2722665_2723286_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
CP031613	Klebsiella pneumoniae strain ZYST1 chromosome, complete genome	5248387	3377550	3387014	5248387	protease,tRNA	Brazilian_cedratvirus(16.67%)	9	NA	NA
AXS31767.1|3377550_3379272_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AXS31768.1|3379316_3380018_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXS31769.1|3380371_3380590_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXS31770.1|3380710_3382990_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AXS31771.1|3383020_3383338_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AXS31772.1|3383663_3383885_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AXS31773.1|3383839_3384022_-	hypothetical protein	NA	NA	NA	NA	NA
AXS31774.1|3383961_3385902_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	7.2e-37
AXS31775.1|3385898_3387014_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 5
CP031613	Klebsiella pneumoniae strain ZYST1 chromosome, complete genome	5248387	3581812	3619853	5248387	head,holin,tail,integrase,plate,portal,terminase,capsid	Enterobacteria_phage(77.78%)	52	3569945:3569959	3620363:3620377
3569945:3569959	attL	TCAGCGCTTCGCCGA	NA	NA	NA	NA
AXS31960.1|3581812_3582619_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.5e-65
AXS31961.1|3582615_3582822_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXS31962.1|3582952_3583249_-	NINE protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
AXS31963.1|3583384_3583525_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AXS31964.1|3583715_3583976_-	hypothetical protein	NA	NA	NA	NA	NA
AXS31965.1|3584018_3585128_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	3.1e-194
AXS31966.1|3585285_3586470_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	4.7e-225
AXS31967.1|3586469_3586982_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
AXS31968.1|3587036_3587402_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.9e-55
AXS31969.1|3587329_3587566_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.9e-22
AXS31970.1|3587552_3590360_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.3	0.0e+00
AXS31971.1|3590366_3590861_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	2.1e-86
AXS31972.1|3590887_3591487_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.6e-86
AXS31973.1|3591519_3591906_+	hypothetical protein	NA	NA	NA	NA	NA
AXS31974.1|3591927_3592368_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	70.3	7.3e-54
AXS31975.1|3592339_3592942_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.4	1.2e-91
AXS31976.1|3592941_3593382_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	50.6	5.8e-35
AXS31977.1|3593410_3594670_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	70.9	2.2e-180
AXS31978.1|3594666_3595275_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	76.4	2.1e-88
AXS31979.1|3595267_3596164_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	3.9e-155
AXS31980.1|3596167_3596518_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	9.2e-60
AXS31981.1|3596514_3597096_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	5.0e-103
AXS31982.1|3597092_3597728_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
AXS31983.1|3597720_3598188_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
AXS31984.1|3598174_3598354_-	hypothetical protein	NA	NA	NA	NA	NA
AXS31985.1|3598325_3598733_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
AXS31986.1|3598729_3599122_-	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	2.9e-70
AXS31987.1|3599118_3599442_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AXS31988.1|3599444_3599645_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AXS31989.1|3599644_3600139_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
AXS31990.1|3600241_3601042_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	90.6	7.3e-129
AXS31991.1|3601087_3602140_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	92.0	1.1e-183
AXS31992.1|3602163_3603000_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.2	7.2e-119
AXS31993.1|3603154_3604906_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
AXS31994.1|3604905_3605952_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	3.3e-206
AXS31995.1|3606456_3608661_-	peptidase S8	NA	NA	NA	NA	NA
AXS31996.1|3608657_3609740_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	8.4e-19
AXS31997.1|3610070_3610382_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	3.2e-48
AXS31998.1|3610386_3611346_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.1e-179
AXS31999.1|3611422_3614263_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.7	0.0e+00
AXS32000.1|3614259_3614649_-	inositol monophosphatase	NA	NA	NA	NA	NA
AXS32001.1|3614721_3614952_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	84.2	1.3e-25
AXS32002.1|3615274_3615574_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.8	9.6e-42
AXS32003.1|3615570_3615816_-	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
AXS32004.1|3615812_3616016_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
AXS32005.1|3616212_3616455_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AXS32006.1|3616466_3616754_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	1.0e-32
AXS32007.1|3616764_3617106_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	5.1e-55
AXS32008.1|3617124_3617451_-	hypothetical protein	NA	NA	NA	NA	NA
AXS32009.1|3617546_3617849_+	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
AXS32010.1|3617915_3618905_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	53.5	3.4e-99
AXS32011.1|3619061_3619853_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	1.2e-11
3620363:3620377	attR	TCAGCGCTTCGCCGA	NA	NA	NA	NA
>prophage 6
CP031613	Klebsiella pneumoniae strain ZYST1 chromosome, complete genome	5248387	4602692	4614724	5248387		Enterobacteria_phage(71.43%)	11	NA	NA
AXS32894.1|4602692_4603958_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.3	5.8e-80
AXS32895.1|4604700_4607034_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.7	0.0e+00
AXS32896.1|4607047_4607368_-	hypothetical protein	NA	NA	NA	NA	NA
AXS32897.1|4607364_4607592_-	hypothetical protein	NA	NA	NA	NA	NA
AXS32898.1|4607588_4608140_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	66.7	4.9e-31
AXS32899.1|4608963_4609701_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	60.1	1.9e-70
AXS32900.1|4609697_4609943_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	5.0e-20
AXS32901.1|4609960_4610527_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	3.9e-60
AXS32902.1|4610592_4610808_+	hypothetical protein	NA	NA	NA	NA	NA
AXS32903.1|4610923_4613332_-	hypothetical protein	NA	NA	NA	NA	NA
AXS32904.1|4613452_4614724_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.7	3.1e-73
>prophage 1
CP031614	Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence	196414	0	4394	196414		Morganella_phage(33.33%)	6	NA	NA
AXY65971.1|177_603_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
AXY65972.1|757_1009_+	hypothetical protein	NA	NA	NA	NA	NA
AXY65973.1|1008_2493_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AXY66152.1|2726_2957_+	hypothetical protein	NA	NA	NA	NA	NA
AXY65974.1|3477_3903_+	antirestriction protein	NA	NA	NA	NA	NA
AXY65975.1|4139_4394_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
>prophage 2
CP031614	Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence	196414	7531	15363	196414	transposase	Thalassomonas_phage(25.0%)	9	NA	NA
AXY65980.1|7531_8095_+	SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
AXY65981.1|7989_8310_-	hypothetical protein	NA	NA	NA	NA	NA
AXY65982.1|8870_9413_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	6.0e-50
AXY65983.1|9461_9710_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AXY65984.1|9779_11816_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	6.9e-22
AXY65985.1|12309_13038_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AXY65986.1|13034_13361_+	theronine dehydrogenase	NA	NA	NA	NA	NA
AXY65987.1|13416_13791_+	hypothetical protein	NA	NA	NA	NA	NA
AXY65988.1|13994_15363_+|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	7.2e-108
>prophage 3
CP031614	Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence	196414	18673	22276	196414		Klebsiella_phage(25.0%)	8	NA	NA
AXY65993.1|18673_19030_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	4.4e-25
AXY65994.1|19090_19303_+	hypothetical protein	NA	NA	NA	NA	NA
AXY65995.1|19313_19538_+	hypothetical protein	NA	NA	NA	NA	NA
AXY65996.1|19618_19939_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
AXY65997.1|19928_20207_+	XRE family transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
AXY65998.1|20207_20621_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXY65999.1|21138_21357_-	hypothetical protein	NA	NA	NA	NA	NA
AXY66000.1|21454_22276_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.4	2.6e-44
>prophage 4
CP031614	Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence	196414	51775	98814	196414	bacteriocin,transposase	Escherichia_phage(28.57%)	39	NA	NA
AXY66037.1|51775_57034_+	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.3	5.2e-05
AXY66038.1|57123_57849_+	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
AXY66039.1|57920_58514_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
AXY66040.1|58680_59277_+	hypothetical protein	NA	NA	NA	NA	NA
AXY66041.1|59449_60430_+|transposase	IS5-like element ISEc68 family transposase	transposase	Q38213	Escherichia_phage	80.9	1.4e-153
AXY66042.1|63128_63605_+	hypothetical protein	NA	NA	NA	NA	NA
AXY66043.1|64365_65049_+	YecA family protein	NA	NA	NA	NA	NA
AXY66044.1|65101_68386_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.6	4.3e-66
AXY66045.1|68382_69138_+	M48 family peptidase	NA	NA	NA	NA	NA
AXY66046.1|69997_71449_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AXY66047.1|71441_73484_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AXY66048.1|79861_80266_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
AXY66049.1|80262_80610_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AXY66050.1|80658_82197_+|transposase	IS66 family transposase ISKpn24	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
AXY66154.1|82309_82567_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AXY66155.1|82796_83348_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	6.2e-18
AXY66051.1|83667_83946_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
AXY66156.1|84161_84239_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
AXY66052.1|84231_85089_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AXY66053.1|85393_85582_-	hypothetical protein	NA	NA	NA	NA	NA
AXY66054.1|85724_85973_-	hypothetical protein	NA	NA	NA	NA	NA
AXY66055.1|86212_86539_+	hypothetical protein	NA	NA	NA	NA	NA
AXY66056.1|86989_87805_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AXY66057.1|87955_88660_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXY66157.1|88550_88802_-	hypothetical protein	NA	NA	NA	NA	NA
AXY66058.1|88788_89553_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXY66059.1|89524_89902_-	hypothetical protein	NA	Q6JIG6	Burkholderia_virus	38.4	2.0e-07
AXY66060.1|89984_90203_-	hypothetical protein	NA	NA	NA	NA	NA
AXY66061.1|90310_91003_+	hypothetical protein	NA	B1B6L9	Salmonella_phage	39.1	1.3e-25
AXY66062.1|91105_91462_-	hypothetical protein	NA	NA	NA	NA	NA
AXY66063.1|91407_91992_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXY66064.1|91991_93230_-	MFS transporter	NA	NA	NA	NA	NA
AXY66065.1|93226_94132_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AXY66066.1|95228_95438_+	hypothetical protein	NA	NA	NA	NA	NA
AXY66067.1|95471_96176_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXY66068.1|96282_97488_-	chromate efflux transporter	NA	NA	NA	NA	NA
AXY66069.1|97643_97847_-	hypothetical protein	NA	NA	NA	NA	NA
AXY66070.1|97865_98045_+	hypothetical protein	NA	NA	NA	NA	NA
AXY66071.1|97974_98814_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
>prophage 5
CP031614	Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence	196414	101880	134046	196414	integrase,transposase	Salmonella_phage(25.0%)	27	97649:97662	117957:117970
97649:97662	attL	TTCCGTTTTCTGAG	NA	NA	NA	NA
AXY66075.1|101880_102894_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXY66076.1|102832_103447_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AXY66077.1|103572_104133_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AXY66159.1|104717_105641_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	5.1e-166
AXY66078.1|105759_106311_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
AXY66079.1|106307_107267_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AXY66080.1|107397_108780_-	carbohydrate porin	NA	NA	NA	NA	NA
AXY66081.1|109011_109194_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
AXY66082.1|109250_110504_-	MFS transporter	NA	NA	NA	NA	NA
AXY66083.1|110555_113630_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
AXY66084.1|113751_114834_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.1	4.4e-185
AXY66085.1|115056_115272_+	hypothetical protein	NA	NA	NA	NA	NA
AXY66086.1|115294_116293_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AXY66087.1|116696_117701_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXY66088.1|118160_118481_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
117957:117970	attR	TTCCGTTTTCTGAG	NA	NA	NA	NA
AXY66089.1|118455_118917_+	dinitrogenase iron-molybdenum cofactor	NA	NA	NA	NA	NA
AXY66090.1|119077_119515_+	PaaI family thioesterase	NA	NA	NA	NA	NA
AXY66091.1|119629_120106_+	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	28.7	6.7e-05
AXY66092.1|120410_120761_-	transcriptional regulator	NA	NA	NA	NA	NA
AXY66093.1|122842_123484_-	resolvase	NA	NA	NA	NA	NA
AXY66094.1|124412_125720_-	calmodulin-binding protein	NA	NA	NA	NA	NA
AXY66095.1|125716_127873_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	41.7	5.2e-36
AXY66096.1|128286_129819_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
AXY66097.1|129956_130361_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXY66160.1|130409_131756_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AXY66098.1|131981_132614_+	hypothetical protein	NA	NA	NA	NA	NA
AXY66099.1|132642_134046_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP031614	Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence	196414	138991	143298	196414		uncultured_Caudovirales_phage(100.0%)	5	NA	NA
AXY66110.1|138991_139342_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
AXY66111.1|139391_139754_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AXY66112.1|139771_141523_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AXY66113.1|141570_142860_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
AXY66114.1|142872_143298_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
>prophage 7
CP031614	Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence	196414	146755	147466	196414		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AXY66161.1|146755_147466_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
>prophage 8
CP031614	Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence	196414	151983	154061	196414		Bacillus_phage(100.0%)	2	NA	NA
AXY66121.1|151983_153384_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AXY66122.1|153380_154061_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 9
CP031614	Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence	196414	159154	166411	196414		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
AXY66128.1|159154_159892_+	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AXY66129.1|159925_160123_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AXY66130.1|160163_162611_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AXY66131.1|162737_163178_-	hypothetical protein	NA	NA	NA	NA	NA
AXY66132.1|163264_166411_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
>prophage 10
CP031614	Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence	196414	169784	178288	196414	transposase	Bacillus_phage(50.0%)	5	NA	NA
AXY66136.1|169784_170465_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AXY66137.1|170457_171933_+	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AXY66138.1|172183_172615_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AXY66164.1|174043_175250_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
AXY66139.1|176284_178288_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
>prophage 11
CP031614	Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence	196414	183596	192369	196414	integrase,transposase	Macacine_betaherpesvirus(50.0%)	8	175971:175985	195997:196011
175971:175985	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
AXY66143.1|183596_184520_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
AXY66144.1|184584_184896_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXY66145.1|184922_185870_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
AXY66146.1|187012_187753_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AXY66147.1|187935_188133_+	hypothetical protein	NA	NA	NA	NA	NA
AXY66148.1|188469_189480_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
AXY66149.1|190231_191398_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
AXY66150.1|191397_192369_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
195997:196011	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
>prophage 1
CP031615	Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C2, complete sequence	107458	53025	92693	107458	transposase,integrase	Escherichia_phage(22.22%)	49	81308:81367	92697:93516
AXY66218.1|53025_54180_-|integrase	integrase	integrase	B5WZU7	Pseudomonas_phage	43.0	1.3e-46
AXY66283.1|54307_54463_+	shufflon protein C'	NA	NA	NA	NA	NA
AXY66219.1|54459_54765_-	shufflon protein C	NA	NA	NA	NA	NA
AXY66220.1|54752_55100_-	shufflon protein D'	NA	NA	NA	NA	NA
AXY66221.1|55166_55415_+	hypothetical protein	NA	NA	NA	NA	NA
AXY66284.1|55411_55618_-	prepilin	NA	NA	NA	NA	NA
AXY66285.1|55582_55906_+	shufflon protein B	NA	NA	NA	NA	NA
AXY66222.1|57233_57890_-	prepilin peptidase	NA	NA	NA	NA	NA
AXY66223.1|57874_58435_-	lytic transglycosylase	NA	NA	NA	NA	NA
AXY66224.1|58444_59059_-	pilus assembly protein PilX	NA	NA	NA	NA	NA
AXY66225.1|59076_60174_-	pilus assembly protein PilR	NA	NA	NA	NA	NA
AXY66226.1|60186_61740_-	ATP-binding protein	NA	NA	NA	NA	NA
AXY66227.1|61750_62203_-	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
AXY66228.1|62189_63485_-	pilus assembly protein PilO	NA	NA	NA	NA	NA
AXY66229.1|63477_65160_-	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
AXY66230.1|65173_65611_-	pilus assembly protein PilP	NA	NA	NA	NA	NA
AXY66231.1|65610_66477_-	pili assembly chaperone	NA	NA	NA	NA	NA
AXY66232.1|66710_67304_-	pili assembly chaperone	NA	NA	NA	NA	NA
AXY66233.1|67300_67597_-	pilJ	NA	NA	NA	NA	NA
AXY66234.1|67772_68027_-	pilus assembly protein	NA	NA	NA	NA	NA
AXY66286.1|67908_68208_+	hypothetical protein	NA	NA	NA	NA	NA
AXY66235.1|68188_68740_-	hypothetical protein	NA	NA	NA	NA	NA
AXY66236.1|68784_68997_+	hypothetical protein	NA	NA	NA	NA	NA
AXY66237.1|68912_69596_-	conjugal transfer protein TraC	NA	NA	NA	NA	NA
AXY66238.1|69698_69878_+	hypothetical protein	NA	NA	NA	NA	NA
AXY66287.1|69849_70383_-	transcription termination factor NusG	NA	NA	NA	NA	NA
AXY66239.1|70388_70511_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
AXY66240.1|70824_71061_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
AXY66241.1|71029_71293_-	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	54.0	4.7e-08
AXY66242.1|71766_71973_+	hypothetical protein	NA	NA	NA	NA	NA
AXY66289.1|71969_72290_-	hypothetical protein	NA	NA	NA	NA	NA
AXY66288.1|72265_73297_+	replication initiation protein	NA	NA	NA	NA	NA
AXY66243.1|73864_73996_-	replication protein RepA4	NA	NA	NA	NA	NA
AXY66244.1|74206_75199_+	hypothetical protein	NA	NA	NA	NA	NA
AXY66245.1|75257_75875_-	proQ/FINO family protein	NA	NA	NA	NA	NA
AXY66246.1|77889_78480_-	hypothetical protein	NA	NA	NA	NA	NA
AXY66247.1|78479_78737_-	hypothetical protein	NA	NA	NA	NA	NA
AXY66248.1|79065_80169_+	nucleotide-binding containing TIR-like domain protein	NA	NA	NA	NA	NA
AXY66249.1|80198_81359_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
81308:81367	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AXY66250.1|81370_82075_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXY66251.1|82020_82233_-	hypothetical protein	NA	NA	NA	NA	NA
AXY66252.1|82514_84050_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	6.6e-102
AXY66253.1|84066_84822_+	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
AXY66254.1|86362_87796_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	1.4e-106
AXY66255.1|87895_88162_+|transposase	IS1 family transposase	transposase	U5P0U6	Shigella_phage	93.2	1.2e-40
AXY66290.1|89283_90075_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA22	NA	NA	NA	NA	NA
AXY66256.1|90223_91237_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXY66257.1|91175_91790_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AXY66258.1|91988_92693_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
92697:93516	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCGTATCGGTGCGTTCTGATCTTCGCGTCAGACATTGCCGCGGCGCGGGCACAACAAAAAGCCCGGCATCGCTGCCGGGCTCCGGCCCCGTCCTTGGGGCCTTGATGTCGGGTCGTTGCCGGGATCGGACCGCGCTGGCGCGGTCCGGTTCCCTGACGACCGGGCCAACCGCATCAGAAATCCATGCCGCCCATGCCACCCATGCCGCCGCCCGGCGGCATCGCCGGCTCGTCCTTCTTCGGGGCCTCGGCCACCATGGCTTCGGTGGTGATCATCAGGCCCGCGATGGAGGCGGCGTTCTGCAACGCGGTGCGGGTGACCTTGGCAAAGAAGGTATCCAGCAGGTACGACACGTCCGCGATCTGGTCGAGGTTGGCATCACCGCTCACGGATGTGACGCTGCCCTTCTTGTTCAGGAAGAAATCGCGCCAGTTGCCATAGGCCTGGTCGCGCTCCACTTCCGCGCGGTAAAGGTTCAGGTCTTCCTGGCTGGCACCTTCCAGCACGTGCGACATGCGCAGCGGCGCTCGGGTGCGGCAAAAACTTTTGTTTGTTCATCAATGATTTGACCGTCTATTTCAAACGTTTTACCAGCATAATCAAATAGATGGTAATAAGTTAAAATAGATTCTGAAAATGATATATCATTTTCTTTATTAACAAATATCAGCTCTTGTCCTTTTTCTATACGGTTTTGAATTTCATCTTGATAACTTTTTACAAGATAAATGCTATCGCCACGCCATATTTCCTGTCCGTTA	NA	NA	NA	NA
>prophage 2
CP031615	Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C2, complete sequence	107458	101797	107186	107458	integrase	Escherichia_phage(33.33%)	8	99097:99109	105451:105463
99097:99109	attL	TGAAATCAGCCAG	NA	NA	NA	NA
AXY66272.1|101797_102580_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
AXY66273.1|102717_102993_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AXY66274.1|102986_103631_-	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
AXY66275.1|103859_104831_+	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
AXY66276.1|104799_105228_+	plasmid stability protein	NA	NA	NA	NA	NA
AXY66277.1|105232_106504_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.5	1.9e-142
105451:105463	attR	TGAAATCAGCCAG	NA	NA	NA	NA
AXY66278.1|106503_106941_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
AXY66279.1|106937_107186_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
