The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031971	Parvimonas micra strain KCOM 1037 chromosome, complete genome	1661863	247429	268800	1661863	integrase	Streptococcus_phage(90.0%)	24	242746:242762	275206:275222
242746:242762	attL	AAGAAAGATATTAAAGA	NA	NA	NA	NA
AXU09961.1|247429_247744_+	DUF961 domain-containing protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
AXU09962.1|247759_248146_+	DUF961 domain-containing protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
AXU09963.1|248174_249560_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	94.1	3.7e-253
AXU09964.1|249562_249718_+	conjugal transfer protein	NA	NA	NA	NA	NA
AXU09965.1|249765_250941_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	96.2	1.9e-218
AXU09966.1|250983_251205_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
AXU09967.1|251321_251819_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	94.5	9.6e-87
AXU09968.1|251832_252225_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	99.2	1.2e-68
AXU09969.1|252208_254656_+	ATP/GTP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	97.7	0.0e+00
AXU09970.1|254658_256836_+	YtxH domain-containing protein	NA	A0A1S5SF30	Streptococcus_phage	83.8	2.3e-302
AXU09971.1|256832_257834_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	94.9	1.3e-183
AXU09972.1|257830_258766_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	99.0	7.7e-170
AXU09973.1|259040_259127_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
AXU09974.1|259142_261062_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.5	0.0e+00
AXU09975.1|261162_261348_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	67.9	3.9e-17
AXU09976.1|261407_261761_-	XRE family transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
AXU11208.1|261965_262037_+	hypothetical protein	NA	NA	NA	NA	NA
AXU09977.1|262265_262688_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
AXU09978.1|262684_262915_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
AXU09979.1|263140_263392_-	hypothetical protein	NA	NA	NA	NA	NA
AXU09980.1|263375_263579_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
AXU09981.1|263660_264878_+|integrase	site-specific integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
AXU09982.1|265327_267073_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	1.9e-36
AXU09983.1|267066_268800_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	1.6e-35
275206:275222	attR	AAGAAAGATATTAAAGA	NA	NA	NA	NA
>prophage 2
CP031971	Parvimonas micra strain KCOM 1037 chromosome, complete genome	1661863	360855	382137	1661863	tRNA,protease	Bacillus_phage(22.22%)	17	NA	NA
AXU10058.1|360855_362559_+|tRNA	proline--tRNA ligase	tRNA	A0A1V0SJ28	Klosneuvirus	34.8	2.4e-12
AXU10059.1|362677_364468_+	ABC transporter ATP-binding protein/permease	NA	A0A076FI99	Aureococcus_anophage	26.3	1.0e-21
AXU10060.1|364457_366113_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	21.6	5.2e-20
AXU10061.1|366173_366593_+	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AXU10062.1|366876_369000_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2H4YEI7	Aeromonas_phage	41.5	2.0e-141
AXU10063.1|369012_369507_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	40.7	6.7e-32
AXU10064.1|369509_370682_+	cation transporter	NA	NA	NA	NA	NA
AXU10065.1|370771_372526_+	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	22.3	3.7e-08
AXU10066.1|372512_374276_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.7	8.6e-21
AXU10067.1|374445_376074_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	3.8e-31
AXU10068.1|376090_376741_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	36.0	1.0e-24
AXU10069.1|377513_378239_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXU10070.1|378318_379017_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXU10071.1|379043_379769_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXU10072.1|379830_380553_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXU10073.1|380661_381378_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXU10074.1|381429_382137_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
CP031971	Parvimonas micra strain KCOM 1037 chromosome, complete genome	1661863	660451	675067	1661863		Cyanophage(22.22%)	12	NA	NA
AXU10327.1|660451_662212_-	hypothetical protein	NA	A0A1C9C589	Heterosigma_akashiwo_virus	25.5	3.2e-07
AXU10328.1|662618_663296_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
AXU10329.1|663412_663892_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	48.5	8.5e-24
AXU10330.1|663907_664933_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	43.5	9.6e-65
AXU11220.1|664947_668619_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	28.8	2.8e-29
AXU10331.1|668620_669328_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	42.6	7.1e-43
AXU10332.1|669314_670760_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.3	1.2e-47
AXU10333.1|670778_671402_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.3	7.5e-20
AXU10334.1|671403_672933_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	46.6	2.2e-65
AXU10335.1|672942_674184_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AXU10336.1|674317_674602_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AXU10337.1|674614_675067_+	single-stranded DNA-binding protein	NA	H9A0L6	Staphylococcus_phage	42.2	4.9e-21
>prophage 4
CP031971	Parvimonas micra strain KCOM 1037 chromosome, complete genome	1661863	1601393	1634924	1661863	capsid,holin,integrase,terminase,portal,tail	Streptococcus_phage(35.48%)	55	1581449:1581477	1639624:1639652
1581449:1581477	attL	AGCAAAAGTAAATGTATCGCAGATACATC	NA	NA	NA	NA
AXU11130.1|1601393_1602137_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.6	4.6e-16
AXU11131.1|1602349_1602784_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AXU11132.1|1602808_1603198_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AXU11133.1|1603364_1604489_-|integrase	site-specific integrase	integrase	H7BVF7	unidentified_phage	36.4	1.5e-55
AXU11134.1|1604584_1605544_-	exonuclease	NA	X2KQX9	Campylobacter_phage	37.7	2.1e-45
AXU11135.1|1605546_1606023_-	hypothetical protein	NA	A0A059T7S0	Listeria_phage	31.5	2.2e-08
AXU11136.1|1606043_1606415_-	XRE family transcriptional regulator	NA	A0A0A7RTU8	Clostridium_phage	54.7	3.4e-12
AXU11137.1|1606577_1606787_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXU11138.1|1606812_1607073_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11139.1|1607057_1607444_-	hypothetical protein	NA	NA	NA	NA	NA
AXU11140.1|1607519_1607723_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11141.1|1607715_1608096_-	DUF2513 domain-containing protein	NA	A0A1P8L6H1	Staphylococcus_phage	33.9	7.0e-13
AXU11142.1|1608164_1608374_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11143.1|1608363_1608549_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11144.1|1608552_1608741_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11145.1|1608740_1609019_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11146.1|1609002_1609251_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11147.1|1609288_1609711_+	single-stranded DNA-binding protein	NA	S5MP28	Brevibacillus_phage	42.8	5.6e-19
AXU11148.1|1609739_1609967_+	hypothetical protein	NA	A0A1V0E8D1	Vibrio_phage	56.9	6.0e-12
AXU11149.1|1609972_1610605_+	HNH endonuclease	NA	M1PKJ5	Streptococcus_phage	27.8	1.8e-13
AXU11150.1|1610604_1611015_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11151.1|1611236_1612070_+	hypothetical protein	NA	I2E8X7	Clostridium_phage	37.6	3.0e-40
AXU11152.1|1612066_1612420_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11153.1|1612420_1612639_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11154.1|1612631_1613156_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11155.1|1613155_1613341_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11156.1|1613343_1613886_+	hypothetical protein	NA	A0A2K9V2V4	Faecalibacterium_phage	33.5	1.4e-19
AXU11157.1|1613888_1614323_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11158.1|1614326_1614767_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11159.1|1614986_1615328_+	HNH endonuclease	NA	A0A1B1IMY5	Lactococcus_phage	63.9	1.8e-36
AXU11160.1|1615421_1616654_+|portal	phage portal protein	portal	A0A1P8BMI8	Lactococcus_phage	65.7	8.9e-150
AXU11161.1|1616643_1617735_+	hypothetical protein	NA	M1PL14	Streptococcus_phage	42.1	1.2e-52
AXU11162.1|1617703_1617997_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11163.1|1618079_1619471_+|terminase	terminase	terminase	A0A1P8BMS5	Lactococcus_phage	62.1	9.3e-172
AXU11164.1|1619563_1620028_+	DUF4355 domain-containing protein	NA	M1Q1L0	Streptococcus_phage	46.5	2.8e-24
AXU11165.1|1620032_1620917_+|capsid	phage major capsid protein	capsid	A0A1B1IMW9	Lactococcus_phage	64.5	3.9e-107
AXU11166.1|1620918_1621122_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11167.1|1621131_1621524_+	hypothetical protein	NA	A0A1X9I730	Streptococcus_phage	68.7	2.4e-40
AXU11168.1|1621510_1621849_+	hypothetical protein	NA	Q7Y4I1	Streptococcus_phage	59.5	1.4e-33
AXU11169.1|1621841_1622075_+	hypothetical protein	NA	M1NRG9	Streptococcus_phage	67.1	9.9e-18
AXU11170.1|1622076_1622412_+	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	65.8	2.4e-33
AXU11171.1|1622425_1622980_+|tail	phage tail protein	tail	A0A141E164	Streptococcus_phage	63.1	4.7e-58
AXU11172.1|1622982_1623243_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11173.1|1623260_1623641_+	hypothetical protein	NA	A0A0B5A083	Streptococcus_phage	45.0	2.3e-24
AXU11174.1|1623633_1625649_+	hypothetical protein	NA	A0A1B1IMY1	Lactococcus_phage	60.0	3.9e-102
AXU11175.1|1625657_1626374_+|tail	phage tail protein	tail	D7RWD9	Brochothrix_phage	28.8	7.8e-13
AXU11176.1|1626373_1628797_+	hypothetical protein	NA	A0A1P8BMA1	Lactococcus_phage	35.3	3.3e-47
AXU11177.1|1628796_1630536_+	hypothetical protein	NA	A0A1W6JLC2	Lactococcus_phage	27.6	6.5e-29
AXU11178.1|1630540_1631164_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11179.1|1631282_1631588_+	hypothetical protein	NA	NA	NA	NA	NA
AXU11180.1|1631601_1631844_+|holin	phage holin	holin	A0A1Q1PVX5	Staphylococcus_phage	36.1	1.5e-05
AXU11181.1|1631894_1632752_+	gametolysin	NA	A0A1S5S9Z7	Streptococcus_phage	38.7	2.2e-22
AXU11182.1|1632793_1633027_-	hypothetical protein	NA	NA	NA	NA	NA
AXU11183.1|1633060_1633258_-	hypothetical protein	NA	A0A286QNA2	Streptococcus_phage	56.6	1.5e-06
AXU11184.1|1634507_1634924_+	GTP pyrophosphokinase	NA	A0A060QNR4	Streptococcus_phage	47.3	1.0e-20
1639624:1639652	attR	GATGTATCTGCGATACATTTACTTTTGCT	NA	NA	NA	NA
