The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP016989	Aeromonas hydrophila strain ZYAH72 chromosome, complete genome	5159182	615526	717012	5159182	integrase,capsid,tail,holin,tRNA,terminase,head,portal	Aeromonas_virus(62.0%)	90	643168:643185	696684:696701
AXV28514.1|615526_617125_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.2	1.4e-25
AXV32259.1|617218_619765_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.2	5.7e-34
AXV28515.1|619984_621277_+|integrase	integrase	integrase	K7PGY1	Enterobacteria_phage	24.3	3.3e-22
AXV28516.1|622187_622376_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AXV28517.1|623401_624568_-	hypothetical protein	NA	NA	NA	NA	NA
AXV28518.1|626774_627935_-	hypothetical protein	NA	NA	NA	NA	NA
AXV28519.1|628658_629150_+	damage-inducible protein CinA	NA	B5TK85	Pseudomonas_phage	50.3	1.2e-28
AXV28520.1|629229_630294_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	64.4	1.5e-116
AXV28521.1|630335_630836_+	RecX family transcriptional regulator	NA	NA	NA	NA	NA
AXV28522.1|631293_633918_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.9	6.2e-76
AXV28523.1|633934_635182_+	aspartate kinase	NA	NA	NA	NA	NA
AXV28524.1|635275_635464_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	2.9e-12
AXV28525.1|636709_637537_-	peptidase S11	NA	NA	NA	NA	NA
AXV28526.1|637676_638342_-	hypothetical protein	NA	NA	NA	NA	NA
AXV28527.1|638360_639653_-	hypothetical protein	NA	NA	NA	NA	NA
AXV28528.1|639839_642692_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.2	6.9e-137
AXV28529.1|642757_643213_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
643168:643185	attL	GCGCGTCATCCTGCTCGC	NA	NA	NA	NA
AXV28530.1|643375_644884_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.6	4.4e-50
AXV28531.1|645056_646169_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AXV28532.1|646310_647381_+	lipopolysaccharide ABC transporter permease LptG	NA	NA	NA	NA	NA
AXV28533.1|647542_648064_-	hypothetical protein	NA	NA	NA	NA	NA
AXV28534.1|649031_650642_-	hypothetical protein	NA	A5X9J8	Aeromonas_virus	72.6	4.0e-235
AXV28535.1|650638_651202_-	hypothetical protein	NA	A5X9J7	Aeromonas_virus	72.6	5.6e-59
AXV32260.1|651198_651642_-	hypothetical protein	NA	A5X9J6	Aeromonas_virus	52.6	3.0e-31
AXV28536.1|654811_655492_-|tail	phage tail protein	tail	A5X9J2	Aeromonas_virus	75.8	2.9e-86
AXV28537.1|655484_656672_-	hypothetical protein	NA	A5X9J1	Aeromonas_virus	79.8	7.4e-178
AXV28538.1|656668_656992_-	hypothetical protein	NA	A5X9J0	Aeromonas_virus	86.9	1.1e-46
AXV28539.1|656991_658761_-|tail	phage tail tape measure protein	tail	A5X9I9	Aeromonas_virus	75.3	2.7e-256
AXV28540.1|658952_659216_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	85.4	1.4e-33
AXV28541.1|659339_659783_-	hypothetical protein	NA	NA	NA	NA	NA
AXV28542.1|659779_660241_-	lysozyme	NA	G0ZT35	Aeromonas_phage	91.5	4.7e-80
AXV28543.1|660227_660554_-|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	59.4	1.8e-25
AXV28544.1|660575_660785_-	hypothetical protein	NA	A0A0N7C211	Escherichia_phage	45.3	1.7e-05
AXV28545.1|660788_661244_-|tail	phage tail protein	tail	A5X9I1	Aeromonas_virus	86.1	2.3e-71
AXV28546.1|661247_662372_-|tail	phage tail protein	tail	A5X9I0	Aeromonas_virus	81.6	3.0e-176
AXV28547.1|662376_663063_-	virion morphogenesis protein	NA	A5X9H9	Aeromonas_virus	87.3	4.7e-108
AXV28548.1|663059_663572_-	hypothetical protein	NA	A5X9H8	Aeromonas_virus	86.2	8.4e-86
AXV28549.1|663580_664042_-|head	head protein	head	A5X9H7	Aeromonas_virus	94.1	2.9e-69
AXV28550.1|664212_664941_-|terminase	terminase	terminase	A5X9H6	Aeromonas_virus	89.2	1.3e-121
AXV28551.1|664944_665994_-|capsid	phage major capsid protein, P2 family	capsid	A5X9H5	Aeromonas_virus	86.4	1.9e-172
AXV28552.1|666003_666861_-|capsid	capsid protein	capsid	A5X9H4	Aeromonas_virus	80.6	1.9e-127
AXV28553.1|667036_668857_+|terminase	terminase	terminase	A5X9H3	Aeromonas_virus	88.8	0.0e+00
AXV28554.1|668853_669870_+|portal	phage portal protein	portal	A5X9H1	Aeromonas_virus	91.4	8.6e-183
AXV28555.1|669935_670187_+	transcriptional regulator	NA	A5X9H0	Aeromonas_virus	84.3	1.1e-35
AXV28556.1|670229_670418_-	hypothetical protein	NA	NA	NA	NA	NA
AXV28557.1|670563_670917_+	hypothetical protein	NA	NA	NA	NA	NA
AXV28558.1|672301_672634_-	hypothetical protein	NA	NA	NA	NA	NA
AXV28559.1|672751_672970_-	hypothetical protein	NA	A5X9G7	Aeromonas_virus	72.2	5.6e-23
AXV28560.1|672966_673449_-	hypothetical protein	NA	NA	NA	NA	NA
AXV28561.1|673451_673946_-	hypothetical protein	NA	A5X9G5	Aeromonas_virus	86.6	5.3e-77
AXV32261.1|674219_676487_-	replication protein	NA	A5X9G4	Aeromonas_virus	81.8	0.0e+00
AXV28562.1|676803_677340_-	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	64.6	6.3e-68
AXV28563.1|677336_677753_-	hypothetical protein	NA	NA	NA	NA	NA
AXV28564.1|677749_677959_-	hypothetical protein	NA	A5X9G1	Aeromonas_virus	94.2	4.2e-28
AXV28565.1|677955_678147_-	hypothetical protein	NA	A5X9G0	Aeromonas_virus	74.6	1.1e-19
AXV28566.1|678319_678583_-	transcriptional regulator	NA	NA	NA	NA	NA
AXV28567.1|678840_679299_-	hypothetical protein	NA	A5X9F8	Aeromonas_virus	71.1	3.6e-56
AXV28568.1|679309_679819_-	hypothetical protein	NA	A5X9F7	Aeromonas_virus	83.4	1.7e-75
AXV28569.1|679848_680064_-	hypothetical protein	NA	A5X9F6	Aeromonas_virus	64.8	5.9e-17
AXV28570.1|680200_680914_+	transcriptional regulator	NA	A5X9F5	Aeromonas_virus	80.1	4.0e-102
AXV28571.1|680923_681775_+	hypothetical protein	NA	A5X9F4	Aeromonas_virus	74.0	3.0e-72
AXV28572.1|681761_682811_+|integrase	integrase	integrase	A5X9F3	Aeromonas_virus	92.2	2.8e-189
AXV28573.1|683197_684406_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	46.0	7.8e-90
AXV28574.1|684649_684859_+	transcriptional regulator	NA	NA	NA	NA	NA
AXV28575.1|684869_685283_+	hypothetical protein	NA	NA	NA	NA	NA
AXV28576.1|685296_686076_+	antirepressor	NA	A0A088CBR4	Shigella_phage	41.8	1.8e-26
AXV28577.1|686072_686612_+	hypothetical protein	NA	NA	NA	NA	NA
AXV32262.1|686914_687271_+	hypothetical protein	NA	NA	NA	NA	NA
AXV28578.1|690218_691784_-	hypothetical protein	NA	NA	NA	NA	NA
AXV28579.1|693275_694712_+	ammonia channel protein	NA	NA	NA	NA	NA
AXV28580.1|695025_696378_+	23S rRNA (uracil-5-)-methyltransferase RumA	NA	A0A2K5B251	Erysipelothrix_phage	42.9	2.0e-94
AXV28581.1|696734_697352_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
696684:696701	attR	GCGAGCAGGATGACGCGC	NA	NA	NA	NA
AXV28582.1|697392_698181_+	deoxyribonuclease	NA	NA	NA	NA	NA
AXV28583.1|698394_699669_+	nucleoside transporter NupC	NA	NA	NA	NA	NA
AXV28584.1|699792_699963_+	XapX domain protein	NA	R4TMJ4	Halovirus	60.0	6.3e-06
AXV28585.1|700354_701128_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
AXV28586.1|701237_702569_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.0e-78
AXV28587.1|702583_703792_+	phosphopentomutase	NA	NA	NA	NA	NA
AXV28588.1|703869_704586_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
AXV28589.1|704655_706902_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.6	3.5e-19
AXV28590.1|706955_707564_-	hypothetical protein	NA	NA	NA	NA	NA
AXV28591.1|707684_708695_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
AXV28592.1|708744_709650_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXV28593.1|709776_712155_-	pilus assembly protein TapZ	NA	NA	NA	NA	NA
AXV28594.1|712255_713620_+	DNA repair protein RadA	NA	NA	NA	NA	NA
AXV28595.1|713691_714072_-	pilus assembly protein	NA	NA	NA	NA	NA
AXV28596.1|714173_714656_-	anti-RNA polymerase sigma 70 factor	NA	NA	NA	NA	NA
AXV28597.1|714997_715270_+	DNA-binding protein	NA	A0A249Y2G7	Serratia_phage	44.2	3.6e-11
AXV28598.1|715371_715797_+	hypothetical protein	NA	NA	NA	NA	NA
AXV28599.1|716025_717012_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 2
CP016989	Aeromonas hydrophila strain ZYAH72 chromosome, complete genome	5159182	1070743	1078647	5159182		Staphylococcus_phage(50.0%)	9	NA	NA
AXV28889.1|1070743_1071997_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.5	2.3e-100
AXV32274.1|1072125_1072560_+	hypothetical protein	NA	NA	NA	NA	NA
AXV28890.1|1072634_1072967_+	NIPSNAP family containing protein	NA	NA	NA	NA	NA
AXV28891.1|1073089_1073539_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AXV28892.1|1073635_1074745_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.2	2.7e-49
AXV28893.1|1074799_1075453_+	riboflavin synthase subunit alpha	NA	A0A2I2L4R9	Orpheovirus	36.6	7.1e-21
AXV28894.1|1075594_1076704_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	39.0	7.9e-65
AXV28895.1|1076767_1077979_-	GlyGly-CTERM sorting domain-containing protein	NA	V5LS29	Emiliania_huxleyi_virus	26.9	8.8e-09
AXV28896.1|1078176_1078647_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	3.5e-30
>prophage 3
CP016989	Aeromonas hydrophila strain ZYAH72 chromosome, complete genome	5159182	2084705	2094448	5159182	integrase,transposase	uncultured_Caudovirales_phage(25.0%)	8	2082576:2082607	2094715:2094746
2082576:2082607	attL	GAGGGTTCGAATCCCTCCCTCACCGCCAAATA	NA	NA	NA	NA
AXV32305.1|2084705_2085902_+|integrase	integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	32.4	2.2e-36
AXV29687.1|2086039_2087002_+	hypothetical protein	NA	NA	NA	NA	NA
AXV32306.1|2088017_2089028_+	hypothetical protein	NA	A0A2P1CFH0	Microbacterium_phage	23.5	2.6e-06
AXV29688.1|2092164_2092431_+|transposase	transposase	transposase	NA	NA	NA	NA
AXV29689.1|2092451_2092580_+|integrase	integrase catalytic subunit	integrase	NA	NA	NA	NA
AXV29690.1|2092758_2093154_+|transposase	transposase	transposase	Q76S41	Shigella_phage	81.1	7.0e-48
AXV29691.1|2093292_2093598_+|transposase	transposase	transposase	NA	NA	NA	NA
AXV32307.1|2093839_2094448_+|integrase	integrase	integrase	A0A0P0I4A4	Acinetobacter_phage	53.3	5.2e-58
2094715:2094746	attR	GAGGGTTCGAATCCCTCCCTCACCGCCAAATA	NA	NA	NA	NA
>prophage 4
CP016989	Aeromonas hydrophila strain ZYAH72 chromosome, complete genome	5159182	2479005	2493942	5159182		Aeromonas_phage(76.92%)	22	NA	NA
AXV29979.1|2479005_2481558_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	36.3	8.8e-43
AXV29980.1|2481673_2482003_+	nucleoid-associated protein	NA	NA	NA	NA	NA
AXV29981.1|2482030_2483311_-	hypothetical protein	NA	R9TMP3	Vibrio_phage	31.2	2.0e-43
AXV29982.1|2483314_2483593_-	hypothetical protein	NA	NA	NA	NA	NA
AXV29983.1|2483585_2484023_-	hypothetical protein	NA	A0A1I9KG69	Aeromonas_phage	82.7	2.0e-51
AXV29984.1|2484113_2484692_-	phage N-6-adenine-methyltransferase	NA	A0A1I9KF87	Aeromonas_phage	89.1	5.2e-100
AXV29985.1|2484722_2485811_-	hypothetical protein	NA	A0A1I9KFA0	Aeromonas_phage	87.2	5.5e-87
AXV29986.1|2485859_2486837_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	92.9	1.0e-177
AXV29987.1|2486833_2487679_-	exodeoxyribonuclease VIII	NA	A0A1I9KFF5	Aeromonas_phage	95.0	5.9e-161
AXV29988.1|2487675_2488041_-	hypothetical protein	NA	A0A1I9KFC9	Aeromonas_phage	69.4	2.3e-37
AXV29989.1|2488043_2488265_-	hypothetical protein	NA	A0A1I9KG01	Aeromonas_phage	61.3	1.3e-11
AXV29990.1|2488522_2489020_-	hypothetical protein	NA	NA	NA	NA	NA
AXV29991.1|2489016_2489301_-	transcriptional regulator	NA	NA	NA	NA	NA
AXV29992.1|2489499_2489853_+	hypothetical protein	NA	NA	NA	NA	NA
AXV29993.1|2490162_2490408_-	hypothetical protein	NA	A0A1I9KF98	Aeromonas_phage	82.7	1.5e-29
AXV29994.1|2490707_2490887_-	hypothetical protein	NA	NA	NA	NA	NA
AXV29995.1|2491125_2491701_-	hypothetical protein	NA	NA	NA	NA	NA
AXV29996.1|2491869_2492088_+	hypothetical protein	NA	NA	NA	NA	NA
AXV29997.1|2492129_2492519_+	hypothetical protein	NA	A0A1I9KF96	Aeromonas_phage	87.3	3.0e-51
AXV29998.1|2492523_2492742_+	hypothetical protein	NA	A0A1I9KFG0	Aeromonas_phage	94.4	3.1e-29
AXV29999.1|2492938_2493184_+	hypothetical protein	NA	NA	NA	NA	NA
AXV30000.1|2493180_2493942_+	DNA-binding protein	NA	Q8HA96	Salmonella_phage	76.9	9.4e-33
>prophage 5
CP016989	Aeromonas hydrophila strain ZYAH72 chromosome, complete genome	5159182	2504247	2509356	5159182		Aeromonas_phage(50.0%)	7	NA	NA
AXV32322.1|2504247_2504754_+	hypothetical protein	NA	A0A2I6PG18	Plesiomonas_phage	48.8	4.6e-36
AXV30008.1|2504750_2505191_+	hypothetical protein	NA	A0A1I9KFA6	Aeromonas_phage	95.1	3.7e-74
AXV30009.1|2505187_2505610_+	hypothetical protein	NA	A0A1I9KG18	Aeromonas_phage	80.7	4.8e-63
AXV30010.1|2505606_2506308_+	hypothetical protein	NA	A0A1I9KFB9	Aeromonas_phage	85.4	4.6e-103
AXV30011.1|2506375_2507134_-	cytolytic delta-endotoxin (insecticidal protein)	NA	NA	NA	NA	NA
AXV30012.1|2507656_2508937_-	protein UmuC	NA	I6RSM4	Salmonella_phage	56.1	3.4e-128
AXV30013.1|2508933_2509356_-	UV protection and mutation protein	NA	A0A1W6JNS2	Morganella_phage	51.6	8.3e-31
>prophage 6
CP016989	Aeromonas hydrophila strain ZYAH72 chromosome, complete genome	5159182	2513871	2542902	5159182	bacteriocin,terminase,portal,capsid	Aeromonas_phage(100.0%)	24	NA	NA
AXV30018.1|2513871_2514189_+	hypothetical protein	NA	A0A1I9KFB8	Aeromonas_phage	95.2	1.4e-51
AXV30019.1|2514188_2514668_+	TIGR02594 family protein	NA	A0A1I9KGA3	Aeromonas_phage	97.4	1.0e-85
AXV30020.1|2514723_2514948_+	hypothetical protein	NA	A0A1I9KFG6	Aeromonas_phage	100.0	1.7e-30
AXV30021.1|2514949_2515180_+	hypothetical protein	NA	A0A1I9KFC5	Aeromonas_phage	82.9	1.4e-27
AXV30022.1|2515227_2515413_+	hypothetical protein	NA	A0A1I9KFC1	Aeromonas_phage	86.9	3.1e-22
AXV30023.1|2515413_2516304_+|terminase	terminase	terminase	A0A1I9KFG9	Aeromonas_phage	76.1	6.5e-102
AXV30024.1|2517057_2518755_+|terminase	terminase	terminase	A0A1I9KFB6	Aeromonas_phage	95.9	0.0e+00
AXV30025.1|2518754_2520881_+|portal	portal protein	portal	A0A1I9KFF7	Aeromonas_phage	95.5	0.0e+00
AXV30026.1|2521176_2522115_+	hypothetical protein	NA	A0A1I9KFD1	Aeromonas_phage	87.8	5.8e-141
AXV30027.1|2522186_2523404_+|capsid	major capsid protein	capsid	A0A1I9KFC6	Aeromonas_phage	92.3	6.2e-220
AXV30028.1|2523467_2523857_+	hypothetical protein	NA	A0A1I9KGB3	Aeromonas_phage	90.7	2.5e-58
AXV30029.1|2523918_2524359_+	hypothetical protein	NA	A0A1I9KFH0	Aeromonas_phage	81.6	8.3e-50
AXV30030.1|2524361_2524943_+	hypothetical protein	NA	A0A1I9KFD5	Aeromonas_phage	85.5	1.0e-92
AXV30031.1|2524952_2525630_+	hypothetical protein	NA	A0A1I9KFD0	Aeromonas_phage	78.2	2.7e-100
AXV30032.1|2525651_2527280_+	hypothetical protein	NA	A0A1I9KFH7	Aeromonas_phage	77.2	5.6e-59
AXV30033.1|2527276_2527600_+	hypothetical protein	NA	A0A2R4ALX6	Aeromonas_phage	76.7	1.5e-35
AXV32325.1|2527695_2529300_+	hypothetical protein	NA	A0A1I9KFD2	Aeromonas_phage	82.4	1.1e-269
AXV30034.1|2529299_2533190_+	hypothetical protein	NA	A0A1I9KGC4	Aeromonas_phage	62.3	1.0e-159
AXV30035.1|2533186_2533546_+	hypothetical protein	NA	A0A1I9KFI0	Aeromonas_phage	75.6	5.2e-50
AXV30036.1|2533555_2534188_+	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	85.4	9.0e-90
AXV30037.1|2534198_2534579_+	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	83.1	2.3e-48
AXV30038.1|2534578_2534818_+|bacteriocin	bacteriocin	bacteriocin	A0A1I9KFI4	Aeromonas_phage	63.5	1.7e-17
AXV30039.1|2534827_2536228_+	hypothetical protein	NA	A0A1I9KFD9	Aeromonas_phage	71.0	1.7e-181
AXV30040.1|2536527_2542902_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	47.2	1.1e-105
>prophage 7
CP016989	Aeromonas hydrophila strain ZYAH72 chromosome, complete genome	5159182	2665368	2681847	5159182	tRNA	Hokovirus(12.5%)	11	NA	NA
AXV30141.1|2665368_2669328_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	36.8	2.6e-33
AXV30142.1|2669382_2669679_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	35.6	3.0e-11
AXV30143.1|2669682_2672070_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	24.5	1.8e-05
AXV30144.1|2672082_2673066_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	44.0	1.5e-35
AXV30145.1|2673381_2673738_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AXV30146.1|2673753_2673951_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AXV30147.1|2674037_2674502_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	39.1	2.0e-14
AXV30148.1|2674589_2676518_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.9	2.8e-126
AXV30149.1|2676754_2677342_-	hypothetical protein	NA	NA	NA	NA	NA
AXV30150.1|2677516_2678572_+	DNA repair photolyase	NA	A0A1C9EG97	Acidianus_two-tailed_virus	28.6	2.4e-10
AXV30151.1|2679099_2681847_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.9	1.3e-108
>prophage 8
CP016989	Aeromonas hydrophila strain ZYAH72 chromosome, complete genome	5159182	3488020	3499093	5159182	head	Shigella_phage(50.0%)	15	NA	NA
AXV30809.1|3488020_3488434_-	hypothetical protein	NA	B7SDP4	Haemophilus_phage	36.4	1.3e-15
AXV30810.1|3488435_3488885_-	hypothetical protein	NA	NA	NA	NA	NA
AXV30811.1|3488988_3489897_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	57.2	7.4e-101
AXV30812.1|3489941_3491090_-	hypothetical protein	NA	A0A0C4UQU6	Shigella_phage	43.5	2.1e-68
AXV30813.1|3491312_3491759_-	phage virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	32.9	4.8e-13
AXV30814.1|3491758_3491959_-	hypothetical protein	NA	NA	NA	NA	NA
AXV30815.1|3491978_3493448_-	F protein	NA	A0A2H4IYU7	uncultured_Caudovirales_phage	52.7	1.5e-63
AXV30816.1|3493447_3495037_-	hypothetical protein	NA	J9SVY0	Pseudomonas_phage	48.4	2.1e-119
AXV30817.1|3495036_3496590_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	58.4	5.7e-162
AXV30818.1|3496589_3497165_-	hypothetical protein	NA	A0A0C4UQU5	Shigella_phage	68.9	3.6e-61
AXV30819.1|3497167_3497464_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	57.0	6.2e-17
AXV30820.1|3497460_3497796_-	hypothetical protein	NA	NA	NA	NA	NA
AXV30821.1|3498004_3498226_-	hypothetical protein	NA	NA	NA	NA	NA
AXV30822.1|3498218_3498521_-	hypothetical protein	NA	NA	NA	NA	NA
AXV30823.1|3498517_3499093_-	secretion activator protein	NA	B0ZSJ3	Halomonas_phage	30.4	3.7e-13
>prophage 9
CP016989	Aeromonas hydrophila strain ZYAH72 chromosome, complete genome	5159182	4115969	4152334	5159182	integrase,terminase,capsid,portal,transposase	Klebsiella_phage(13.04%)	40	4118344:4118359	4159869:4159884
AXV31334.1|4115969_4116281_-	hypothetical protein	NA	A0A2H4J8C5	uncultured_Caudovirales_phage	43.2	2.8e-12
AXV31335.1|4116283_4116739_-	hypothetical protein	NA	NA	NA	NA	NA
AXV31336.1|4116810_4118097_-|capsid	capsid protein	capsid	Q6UAX6	Klebsiella_phage	62.4	1.4e-142
AXV31337.1|4118165_4119101_-	serine peptidase	NA	Q6UAX7	Klebsiella_phage	50.8	2.5e-80
4118344:4118359	attL	GTTACCTGCTCAACGC	NA	NA	NA	NA
AXV31338.1|4119088_4120342_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	62.1	1.7e-151
AXV31339.1|4120341_4120530_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	65.8	4.5e-05
AXV31340.1|4120523_4122245_-|terminase	terminase	terminase	U5P0Q5	Shigella_phage	74.2	7.1e-254
AXV31341.1|4122254_4122740_-|terminase	terminase	terminase	A0A2D1GNP3	Pseudomonas_phage	59.5	1.1e-47
AXV32372.1|4122835_4123216_-	HNH endonuclease	NA	A0A1V0E8A5	Vibrio_phage	53.0	2.4e-29
AXV31342.1|4123634_4124174_-	endopeptidase	NA	A0A059VF51	Pseudomonas_phage	39.5	9.0e-14
AXV31343.1|4124173_4124665_-	glycoside hydrolase family 24	NA	D6QWN8	uncultured_phage	38.1	4.4e-15
AXV31344.1|4124664_4124877_-	hypothetical protein	NA	NA	NA	NA	NA
AXV31345.1|4125526_4125808_-	hypothetical protein	NA	NA	NA	NA	NA
AXV31346.1|4125944_4126871_+	hypothetical protein	NA	NA	NA	NA	NA
AXV31347.1|4129709_4130705_-	ATPase	NA	A0A1B2RW50	Lymphocystis_disease_virus	29.0	3.7e-13
AXV31348.1|4130909_4131971_-	DNA adenine methylase	NA	A0A1I9KF79	Aeromonas_phage	74.4	1.5e-129
AXV31349.1|4134434_4136975_-	hypothetical protein	NA	NA	NA	NA	NA
AXV31350.1|4137535_4137736_-|transposase	transposase	transposase	U5P429	Shigella_phage	53.6	1.6e-08
AXV31351.1|4137904_4138525_-	antitermination protein	NA	NA	NA	NA	NA
AXV31352.1|4138524_4138815_-	hypothetical protein	NA	Q3HQZ9	Burkholderia_phage	54.5	5.2e-24
AXV31353.1|4138898_4139888_-	hypothetical protein	NA	A0A1V0E819	Vibrio_phage	31.0	2.1e-32
AXV31354.1|4139884_4140148_-	hypothetical protein	NA	NA	NA	NA	NA
AXV31355.1|4140891_4141287_-	hypothetical protein	NA	A0A1B0YZW9	Pseudomonas_phage	35.8	4.4e-10
AXV31356.1|4141276_4141753_-	hypothetical protein	NA	NA	NA	NA	NA
AXV31357.1|4141755_4141974_-	hypothetical protein	NA	NA	NA	NA	NA
AXV31358.1|4141973_4142672_-	DNA-binding protein	NA	A0A1I9KFA9	Aeromonas_phage	63.6	1.0e-78
AXV31359.1|4142688_4142943_-	hypothetical protein	NA	A0A1I9KFB1	Aeromonas_phage	46.8	6.8e-12
AXV32373.1|4142942_4143323_-	hypothetical protein	NA	NA	NA	NA	NA
AXV31360.1|4143411_4144533_-	hypothetical protein	NA	A5VW95	Enterobacteria_phage	32.4	1.5e-15
AXV31361.1|4144655_4145612_-	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	41.5	2.1e-45
AXV31362.1|4146006_4146504_-	transcriptional regulator	NA	NA	NA	NA	NA
AXV31363.1|4147104_4147503_+	hypothetical protein	NA	A0A2H4J8I0	uncultured_Caudovirales_phage	44.5	1.1e-16
AXV31364.1|4147901_4148129_-	hypothetical protein	NA	NA	NA	NA	NA
AXV32374.1|4148443_4148665_+	hypothetical protein	NA	NA	NA	NA	NA
AXV31365.1|4148702_4149689_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	41.3	3.6e-53
AXV31366.1|4149685_4150123_+	hypothetical protein	NA	NA	NA	NA	NA
AXV31367.1|4150098_4150293_+	hypothetical protein	NA	NA	NA	NA	NA
AXV31368.1|4150374_4150632_+	hypothetical protein	NA	NA	NA	NA	NA
AXV32375.1|4150862_4151051_+	hypothetical protein	NA	NA	NA	NA	NA
AXV31369.1|4151026_4152334_+|integrase	integrase	integrase	Q8W658	Enterobacteria_phage	39.8	8.7e-79
4159869:4159884	attR	GTTACCTGCTCAACGC	NA	NA	NA	NA
>prophage 10
CP016989	Aeromonas hydrophila strain ZYAH72 chromosome, complete genome	5159182	4286918	4296854	5159182	tRNA	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
AXV31478.1|4286918_4288775_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
AXV31479.1|4288997_4290785_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	5.2e-74
AXV31480.1|4290873_4291317_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	48.6	1.7e-26
AXV31481.1|4291727_4292741_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	6.9e-108
AXV31482.1|4292825_4293809_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	1.7e-34
AXV31483.1|4293856_4294897_-	peptidoglycan-binding protein	NA	A0A0A7NU10	Lactobacillus_phage	35.6	1.1e-12
AXV31484.1|4294907_4295489_-	hypothetical protein	NA	NA	NA	NA	NA
AXV31485.1|4295485_4296103_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	5.3e-34
AXV31486.1|4296107_4296854_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.7	2.1e-69
