The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022780	Ralstonia solanacearum strain SL3822 chromosome, complete genome	3837023	213992	227787	3837023		Acidithiobacillus_phage(75.0%)	18	NA	NA
AXW34987.1|213992_214976_-	ATP-binding protein	NA	R4TQL5	Phaeocystis_globosa_virus	27.7	5.1e-15
AXW32032.1|215732_217970_-	hypothetical protein	NA	K4I1D0	Acidithiobacillus_phage	66.5	1.1e-291
AXW32033.1|218019_218481_-	excisionase	NA	K4ICM4	Acidithiobacillus_phage	63.4	3.4e-46
AXW32034.1|218708_218972_+	DNA-binding protein	NA	K4I3X3	Acidithiobacillus_phage	69.3	5.3e-20
AXW32035.1|218982_219465_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	58.2	3.4e-44
AXW32036.1|219772_220225_+	HNH endonuclease	NA	A0A1B0TRC1	Escherichia_phage	39.3	3.4e-22
AXW32037.1|220211_220970_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	61.7	2.9e-82
AXW32038.1|220966_221227_+	hypothetical protein	NA	K4I1D6	Acidithiobacillus_phage	76.8	8.4e-18
AXW32039.1|221223_223512_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	63.5	1.4e-286
AXW32040.1|223642_224107_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	67.6	1.0e-53
AXW32041.1|224108_224318_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32042.1|224310_224694_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AXW32043.1|224748_225015_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AXW32044.1|225014_225314_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXW32045.1|225267_225483_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32046.1|225416_225713_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34988.1|225847_226393_+	hypothetical protein	NA	A0A2H4P763	Pseudomonas_phage	39.6	2.0e-24
AXW32047.1|226374_227787_+	DNA modification methylase	NA	K4I3Y2	Acidithiobacillus_phage	59.3	1.3e-152
>prophage 2
CP022780	Ralstonia solanacearum strain SL3822 chromosome, complete genome	3837023	232251	280103	3837023	head,transposase,terminase,capsid,portal,protease	uncultured_Caudovirales_phage(20.0%)	39	NA	NA
AXW32051.1|232251_232728_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	60.0	5.5e-23
AXW32052.1|233544_233766_-	hypothetical protein	NA	NA	NA	NA	NA
AXW32053.1|233863_234400_+	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	82.6	1.5e-72
AXW34989.1|234402_236370_+|terminase	terminase	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	85.8	0.0e+00
AXW32054.1|236413_236923_+	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	44.4	2.8e-25
AXW32055.1|236933_237326_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32056.1|237326_237548_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	58.9	5.9e-12
AXW32057.1|237547_239095_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.1	7.3e-149
AXW32058.1|239104_240355_+|protease	Clp protease ClpP	protease	K4HZZ6	Acidithiobacillus_phage	45.0	2.4e-62
AXW32059.1|240364_240742_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	49.6	6.1e-25
AXW32060.1|240750_241755_+|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	66.6	9.6e-110
AXW32061.1|241757_242060_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32062.1|242065_242512_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32063.1|242612_243386_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.6	3.1e-47
AXW32064.1|243394_243790_+	hypothetical protein	NA	NA	NA	NA	NA
AXW34990.1|243786_244008_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32065.1|243982_244627_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32066.1|244669_244960_-	DNA-binding protein	NA	NA	NA	NA	NA
AXW32067.1|245145_246612_-	YOPP/AvrRxv family protein	NA	NA	NA	NA	NA
AXW34991.1|247221_248349_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	53.5	1.1e-98
AXW32068.1|248414_252518_+	hypothetical protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	27.8	6.0e-25
AXW32069.1|252523_252919_+	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	52.3	1.6e-31
AXW32070.1|252919_256510_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.7	0.0e+00
AXW32071.1|256532_257699_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32072.1|257702_258185_+	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	44.0	3.1e-13
AXW32073.1|258181_258580_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32074.1|258584_260429_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	46.1	2.4e-106
AXW32075.1|260438_260663_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32076.1|260730_261021_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	46.4	4.1e-13
AXW32077.1|261017_261494_+	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	85.9	1.4e-71
AXW32078.1|261490_261952_+	glycoside hydrolase	NA	K4I410	Acidithiobacillus_phage	81.6	2.3e-66
AXW32079.1|262019_262319_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32080.1|262381_262720_-	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
AXW32081.1|272702_272891_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32082.1|273435_273678_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32083.1|273652_276193_+	hemagglutinin	NA	A0A0R6PJK4	Moraxella_phage	31.2	7.5e-18
AXW32084.1|276204_277956_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
AXW32085.1|277968_278814_+	hypothetical protein	NA	NA	NA	NA	NA
AXW34992.1|279314_280103_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
CP022780	Ralstonia solanacearum strain SL3822 chromosome, complete genome	3837023	854416	919687	3837023	transposase,protease,coat	Lake_Baikal_phage(25.0%)	58	NA	NA
AXW32551.1|854416_855382_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
AXW32552.1|855753_863229_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32553.1|863878_864196_-	hypothetical protein	NA	NA	NA	NA	NA
AXW32554.1|864677_864890_-	hypothetical protein	NA	NA	NA	NA	NA
AXW32555.1|864988_865243_-	translation initiation factor 1	NA	NA	NA	NA	NA
AXW32556.1|865325_865556_-	isochorismatase	NA	NA	NA	NA	NA
AXW32557.1|866011_866176_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	57.1	3.2e-07
AXW32558.1|866224_867553_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AXW32559.1|868064_868391_+	hypothetical protein	NA	NA	NA	NA	NA
AXW35031.1|868484_868769_+	hypothetical protein	NA	NA	NA	NA	NA
AXW35032.1|868855_869230_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32560.1|870107_870425_+	hypothetical protein	NA	NA	NA	NA	NA
AXW35033.1|870577_870874_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32561.1|870970_871831_+	transglutaminase family protein	NA	NA	NA	NA	NA
AXW32562.1|871847_872108_-	hypothetical protein	NA	NA	NA	NA	NA
AXW32563.1|873453_873957_+|coat	spore coat protein	coat	NA	NA	NA	NA
AXW32564.1|874006_874510_+|coat	spore coat protein	coat	NA	NA	NA	NA
AXW32565.1|874628_875348_+	phytochrome sensor protein	NA	NA	NA	NA	NA
AXW32566.1|875397_877662_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AXW32567.1|877658_878168_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32568.1|878237_878780_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32569.1|879385_880330_+	hydrogen peroxide-inducible genes activator	NA	A0A2P0ZL89	Lactobacillus_phage	23.9	4.0e-09
AXW32570.1|880548_880797_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32571.1|880855_881098_+	hypothetical protein	NA	NA	NA	NA	NA
AXW32572.1|881256_881757_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	36.2	2.1e-20
AXW32573.1|881830_882706_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AXW32574.1|882702_882981_-	hypothetical protein	NA	NA	NA	NA	NA
AXW32575.1|883002_883827_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AXW32576.1|883861_884584_-	YggS family pyridoxal phosphate enzyme	NA	NA	NA	NA	NA
AXW32577.1|884708_885752_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AXW32578.1|885804_886944_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AXW32579.1|887138_887579_+	type IV pilin protein	NA	NA	NA	NA	NA
AXW32580.1|887582_888071_+	general secretion pathway protein GspH	NA	NA	NA	NA	NA
AXW32581.1|888067_888658_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
AXW32582.1|888654_889683_+	pilus assembly protein PilW	NA	NA	NA	NA	NA
AXW32583.1|889686_890223_+	pilus assembly protein	NA	NA	NA	NA	NA
AXW32584.1|890254_893467_+	pilus assembly protein PilY	NA	NA	NA	NA	NA
AXW35034.1|893562_894060_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.0	3.3e-26
AXW32585.1|894076_894775_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
AXW32586.1|894817_895297_-	cupin	NA	NA	NA	NA	NA
AXW32587.1|895347_895743_-	VOC family protein	NA	NA	NA	NA	NA
AXW32588.1|895901_896624_-	LrgB family protein	NA	NA	NA	NA	NA
AXW32589.1|896620_896998_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
AXW32590.1|897049_898297_-	glycolate oxidase iron-sulfur subunit	NA	NA	NA	NA	NA
AXW32591.1|898306_899425_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
AXW32592.1|899435_900929_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXW32593.1|901099_901990_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXW32594.1|902000_903419_-	2-hydroxy-acid oxidase	NA	NA	NA	NA	NA
AXW32595.1|903539_904097_+	ATP:cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
AXW32596.1|904169_905066_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AXW32597.1|905350_905686_+	transcriptional regulator	NA	NA	NA	NA	NA
AXW32598.1|905809_906889_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	45.0	1.1e-76
AXW32599.1|907281_908742_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AXW32600.1|908769_909639_-	acyltransferase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	25.3	8.3e-09
AXW32601.1|909644_913925_-	TIGR02099 family protein	NA	NA	NA	NA	NA
AXW32602.1|914104_916972_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
AXW32603.1|916968_917589_+	rhombosortase	NA	NA	NA	NA	NA
AXW32604.1|917644_919687_-|protease	MprA protease, GlyGly-CTERM protein-sorting domain-containing form	protease	A0A1B0T6A2	Bacillus_phage	34.7	6.0e-10
>prophage 4
CP022780	Ralstonia solanacearum strain SL3822 chromosome, complete genome	3837023	936693	946832	3837023		Hokovirus(14.29%)	9	NA	NA
AXW32621.1|936693_938655_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.8	1.4e-149
AXW32622.1|938789_939932_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.7	2.9e-22
AXW32623.1|939967_941848_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	37.3	6.1e-57
AXW32624.1|941803_942490_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.2	1.5e-13
AXW32625.1|942497_943205_-	ABC transporter permease	NA	NA	NA	NA	NA
AXW32626.1|943216_944041_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	31.3	2.4e-34
AXW32627.1|944097_944742_-	deoxynucleoside kinase	NA	M1IA15	Paramecium_bursaria_Chlorella_virus	27.3	8.3e-06
AXW32628.1|944775_945285_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AXW32629.1|945284_946832_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	33.6	3.6e-23
>prophage 5
CP022780	Ralstonia solanacearum strain SL3822 chromosome, complete genome	3837023	2735994	2794605	3837023	transposase	Acidithiobacillus_phage(27.78%)	46	NA	NA
AXW34075.1|2735994_2737323_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
AXW34076.1|2737374_2738277_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.8	8.2e-52
AXW34077.1|2738380_2738698_-	competence protein ComE	NA	NA	NA	NA	NA
AXW34078.1|2738827_2739823_-	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	R9S880	Prochlorococcus_phage	32.3	4.1e-28
AXW34079.1|2739819_2740767_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.6	9.0e-17
AXW34080.1|2740793_2742167_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.9	1.9e-76
AXW34081.1|2742226_2743504_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
AXW34082.1|2743507_2743828_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
AXW34083.1|2744013_2744436_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	38.9	4.7e-10
AXW34084.1|2744472_2746161_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AXW34085.1|2746300_2746993_-	cytidylate kinase	NA	NA	NA	NA	NA
AXW34086.1|2747016_2748327_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AXW34087.1|2748348_2749245_-	prephenate dehydrogenase/arogenate dehydrogenase family protein	NA	NA	NA	NA	NA
AXW34088.1|2749341_2750466_-	histidinol-phosphate aminotransferase	NA	A0A142C026	Faustovirus	27.7	1.2e-15
AXW34089.1|2750524_2751640_-	chorismate mutase	NA	NA	NA	NA	NA
AXW34090.1|2751728_2752865_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.6	4.4e-87
AXW34091.1|2752979_2753540_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
AXW34092.1|2753666_2756324_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.5	3.0e-102
AXW34093.1|2756732_2757389_+	hypothetical protein	NA	NA	NA	NA	NA
AXW34094.1|2757546_2758050_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AXW34095.1|2758211_2758928_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
AXW34096.1|2758924_2759614_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AXW34097.1|2759722_2763508_+	DUF748 domain-containing protein	NA	NA	NA	NA	NA
AXW35129.1|2764186_2764300_-	elements of external origin	NA	NA	NA	NA	NA
AXW34098.1|2764566_2764857_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34099.1|2765323_2765638_+	hypothetical protein	NA	NA	NA	NA	NA
AXW34100.1|2766132_2767458_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXW34101.1|2767586_2768027_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AXW34102.1|2768059_2769442_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	59.3	9.1e-135
AXW34103.1|2769438_2769936_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	38.8	4.5e-20
AXW34104.1|2770515_2771949_-|transposase	transposase	transposase	NA	NA	NA	NA
AXW34105.1|2771972_2773745_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34106.1|2774056_2774317_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34107.1|2775701_2785184_-	filamentous hemagglutinin	NA	A0A0R6PJK4	Moraxella_phage	35.2	1.3e-35
AXW34108.1|2785399_2786356_+|transposase	IS5/IS1182 family transposase IS1420	transposase	A0A1V0E8E1	Vibrio_phage	44.4	4.6e-61
AXW35130.1|2788103_2788442_+	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
AXW34109.1|2788504_2788804_-	hypothetical protein	NA	NA	NA	NA	NA
AXW35131.1|2788871_2789333_-	glycoside hydrolase	NA	K4I410	Acidithiobacillus_phage	80.3	1.1e-65
AXW34110.1|2789329_2789812_-	HNH endonuclease	NA	A0A076YKQ7	Mycobacterium_phage	48.3	2.8e-22
AXW34111.1|2789798_2790281_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	71.6	4.8e-59
AXW34112.1|2790277_2790568_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	47.6	7.0e-13
AXW34113.1|2790634_2790859_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34114.1|2791189_2792176_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
AXW34115.1|2792451_2792829_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34116.1|2793186_2793723_-	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	50.3	1.8e-46
AXW34117.1|2793780_2794605_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP022780	Ralstonia solanacearum strain SL3822 chromosome, complete genome	3837023	2813281	2935056	3837023	head,transposase,terminase,capsid,portal,integrase,protease	Acidithiobacillus_phage(37.21%)	115	2848029:2848088	2914013:2915143
AXW34132.1|2813281_2814432_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	60.7	5.9e-95
AXW34133.1|2814748_2815021_-	hypothetical protein	NA	NA	NA	NA	NA
AXW35135.1|2815020_2816490_-	virulence factor	NA	NA	NA	NA	NA
AXW34134.1|2816498_2818706_-	hypothetical protein	NA	A0A077K801	Ralstonia_phage	32.9	1.9e-41
AXW34135.1|2818710_2821431_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.9	3.3e-88
AXW34136.1|2821886_2822120_+	hypothetical protein	NA	NA	NA	NA	NA
AXW34137.1|2822165_2822573_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34138.1|2822562_2822772_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34139.1|2823006_2825304_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	72.1	0.0e+00
AXW34140.1|2825287_2825677_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34141.1|2825682_2826087_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	50.4	6.3e-28
AXW34142.1|2826159_2826792_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	67.5	8.0e-62
AXW34143.1|2826809_2827682_-	hypothetical protein	NA	K4HZX9	Acidithiobacillus_phage	65.7	2.4e-101
AXW34144.1|2827678_2828176_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34145.1|2828172_2828457_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34146.1|2828878_2829484_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXW34147.1|2829638_2830451_+	oxidoreductase	NA	NA	NA	NA	NA
AXW34148.1|2830660_2831662_+	NADPH:quinone oxidoreductase	NA	NA	NA	NA	NA
AXW34149.1|2832090_2833065_-	hypothetical protein	NA	NA	NA	NA	NA
AXW35136.1|2833061_2834285_-	glycine hydroxymethyltransferase	NA	NA	NA	NA	NA
AXW34150.1|2834682_2835789_-	serine/threonine acetyltransferase	NA	NA	NA	NA	NA
AXW34151.1|2836448_2836889_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AXW34152.1|2836921_2838304_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	59.9	4.5e-134
AXW34153.1|2838300_2838798_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	38.8	1.2e-20
AXW34154.1|2839810_2840902_-|transposase	transposase	transposase	NA	NA	NA	NA
AXW34155.1|2841099_2841933_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34156.1|2841945_2843697_-	peptide transporter	NA	NA	NA	NA	NA
AXW34157.1|2843708_2846255_-	hemagglutinin	NA	A0A0R6PJK4	Moraxella_phage	30.7	4.9e-17
AXW34158.1|2846659_2847985_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2848029:2848088	attL	GGCGTTGTTGCATAAATCGAATTTGAAGACACAGGTCCACCTATGATCTTGAATTCAGGC	NA	NA	NA	NA
AXW34159.1|2848082_2849039_-|transposase	IS5/IS1182 family transposase IS1420	transposase	A0A1V0E8E1	Vibrio_phage	44.4	4.6e-61
AXW34160.1|2849360_2849648_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34161.1|2850124_2850616_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34162.1|2850625_2859166_-	hemagglutinin	NA	NA	NA	NA	NA
AXW34163.1|2860287_2860620_+	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
AXW35137.1|2860671_2860968_-	hypothetical protein	NA	NA	NA	NA	NA
AXW35138.1|2861035_2861497_-	glycoside hydrolase	NA	K4I410	Acidithiobacillus_phage	80.3	1.1e-65
AXW34164.1|2861493_2861976_-	HNH endonuclease	NA	A0A076YKQ7	Mycobacterium_phage	48.3	4.7e-22
AXW34165.1|2861962_2862445_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	71.0	5.3e-58
AXW34166.1|2862441_2862732_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	46.4	2.7e-12
AXW34167.1|2862798_2863023_-	hypothetical protein	NA	A0A088C533	Shewanella_sp._phage	47.0	2.2e-06
AXW34168.1|2863032_2864877_-	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	46.4	1.1e-106
AXW34169.1|2864881_2865280_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34170.1|2865276_2865759_-	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	42.7	1.5e-12
AXW34171.1|2865762_2866929_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34172.1|2866940_2870531_-	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.7	0.0e+00
AXW34173.1|2870531_2870927_-	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	52.3	1.6e-31
AXW34174.1|2870932_2875036_-	hypothetical protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	27.5	1.3e-24
AXW35139.1|2875101_2876229_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	54.6	9.1e-101
AXW34175.1|2878204_2878624_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34176.1|2878993_2879638_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34177.1|2879612_2879834_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34178.1|2879830_2880220_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34179.1|2880228_2881002_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.6	1.2e-46
AXW34180.1|2881102_2881549_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34181.1|2881554_2881857_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34182.1|2881859_2882864_-|capsid	minor capsid protein E	capsid	A0A1B2LRS0	Wolbachia_phage	66.9	2.1e-109
AXW34183.1|2882870_2883248_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	52.0	2.7e-25
AXW34184.1|2883257_2884499_-|protease	Clp protease ClpP	protease	K4HZZ6	Acidithiobacillus_phage	40.3	1.1e-59
AXW34185.1|2884510_2886079_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.1	3.3e-149
AXW34186.1|2886078_2886300_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	56.2	3.8e-11
AXW34187.1|2886300_2886693_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34188.1|2886703_2887213_-	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	45.0	1.3e-25
AXW35140.1|2887256_2889236_-|terminase	terminase	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	86.3	0.0e+00
AXW34189.1|2889238_2889775_-	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	82.0	2.0e-74
AXW34190.1|2889871_2890366_+	hypothetical protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	57.3	3.1e-21
AXW35141.1|2890493_2890844_+	hypothetical protein	NA	NA	NA	NA	NA
AXW34191.1|2890940_2891129_+	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	64.2	7.7e-13
AXW34192.1|2891353_2891719_+	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	58.8	3.4e-33
AXW35142.1|2891972_2892629_+	type III secretion system effector protein	NA	NA	NA	NA	NA
AXW34193.1|2892636_2893905_-	DNA methylase N-4	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	79.6	2.2e-196
AXW34194.1|2893901_2895302_-	DNA modification methylase	NA	K4I3Y2	Acidithiobacillus_phage	62.3	8.5e-165
AXW34195.1|2895799_2896207_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34196.1|2896196_2896409_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34197.1|2896640_2898938_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	65.1	1.1e-294
AXW34198.1|2898921_2899320_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34199.1|2899325_2899730_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	48.9	6.9e-27
AXW35143.1|2899802_2900435_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	60.5	1.6e-62
AXW34200.1|2900453_2901326_-	hypothetical protein	NA	K4HZX9	Acidithiobacillus_phage	66.1	6.4e-102
AXW34201.1|2901322_2901820_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34202.1|2901816_2902107_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34203.1|2902844_2903501_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34204.1|2903633_2904287_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34205.1|2904594_2904801_+|integrase	integrase	integrase	NA	NA	NA	NA
AXW35144.1|2904989_2906270_+	hypothetical protein	NA	NA	NA	NA	NA
AXW34206.1|2906484_2907459_-	hypothetical protein	NA	NA	NA	NA	NA
AXW35145.1|2907455_2908679_-	glycine hydroxymethyltransferase	NA	NA	NA	NA	NA
AXW34207.1|2908954_2909920_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
AXW34208.1|2910998_2911415_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34209.1|2911610_2912597_+|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
AXW34210.1|2914066_2915023_-|transposase	IS5/IS1182 family transposase IS1420	transposase	A0A1V0E8E1	Vibrio_phage	44.4	4.6e-61
AXW34211.1|2915832_2916075_+	hypothetical protein	NA	NA	NA	NA	NA
2914013:2915143	attR	GGCGTTGTTGCATAAATCGAATTTGAAGACACAGGTCCACCTATGATCTTGAATTCAGGCGATACGGACGGAGTGCGGGCGAGCGAGAGCCGCGATGCGGTTGAGCACGCCCGCACGAATCGAAACCTCGGTTGCCTGGGAGTCAACTTTGCGCGCCCACAGGCACGGACCGGTGAGCGTCTTGAGCCGGTACATCAGGTTCTCCACCAGCGAGCGCCGGTGGTAGCCGCTAGCCTCCTTCCATTCGCACCTGCTGGTCTTGGCAATGGCGTCGATGGCAGCGTTGCGCCATGCCGCGCCGGGCGTGGCTTCAGGCCACGAACTTGCACCTTCGCGCGGTGGAATCGAGGGCCGCGCACCGCGCTTGGCAATCGCCGCATGACACTGCTTGCTGTCGTACGCGCCGTCCCCGCCGACGATGTCCACGGATATGTCGGGCGGCAATTGGTCGAGCAAGTCGGGCAGTACGTCAGCGTCGCCCACATCCTGGTGGGTCATCAGCGCCGCGCATATCTGGCCTGTTTTCGCGTCCATCGCAAGATGGACCTTGCGCCAGGTGCGACGCTTGGACCAGCCGTGCTTGCGCACCTTCCACTCACCTTCACCGAACACTTTCAGGCCGGTGCTGTCGAGCAGCATGTGCACTGGTTCGCCGGTGTGCAACGCAGGCAGGACGACTTGCAGGTCCTGTGCTCGACGGCTCAGCGTCGTGTAGTTGGGAACCGGCAACTCAGGATAGGCAAGCCTGCGCAGGCTCATGGCAAAGCCTTGCAGTGCGCGCAACGGCAGGTGGAAGACTTGCTTCAGACCGAGCAGGCCCTGAATCAAAGCGTCCGAGTAGACCAGCGGGTGGCCGCGCTTGCGGGCCTGCGCAGCAGATGCCTTGCACATACCCTCGTCGATCCACATCGTGACATCTCCTCTGGCGATCAGCCCTGCGTTGTACTGCGCCCAGTTCTTGACGCGATACGTGGCCTTGGGCTCGGCTTGCTTGTGGGTGTCCCTGTGCATGTTCCCGGCAAAAATCGAGAATCTACGCAGGAACCCGGTTTGTTTACAGCGTTACCGCCATGTCGTTGCGCGTAAACGTCAGCACGGCCTCACCACGACCCTGATTTATGCAACAACGCC	NA	NA	NA	NA
AXW34212.1|2916078_2916486_+	hypothetical protein	NA	NA	NA	NA	NA
AXW34213.1|2916487_2917942_+	molybdopterin biosynthesis protein MoeB	NA	NA	NA	NA	NA
AXW34214.1|2918254_2918458_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34215.1|2918916_2919213_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34216.1|2919389_2919590_+	hypothetical protein	NA	NA	NA	NA	NA
AXW34217.1|2920618_2920924_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34218.1|2920944_2921673_-	nitroreductase family protein	NA	NA	NA	NA	NA
AXW35146.1|2921806_2922406_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXW34219.1|2922636_2922843_+	hypothetical protein	NA	NA	NA	NA	NA
AXW34220.1|2922857_2923664_-	endoglucanase	NA	NA	NA	NA	NA
AXW35147.1|2924058_2924679_-	glutathione transferase GstA	NA	NA	NA	NA	NA
AXW34221.1|2924842_2925097_+	transcriptional regulator	NA	NA	NA	NA	NA
AXW34222.1|2925168_2925567_-	hypothetical protein	NA	NA	NA	NA	NA
AXW34223.1|2925955_2926588_+	LysE family translocator	NA	NA	NA	NA	NA
AXW34224.1|2926659_2927910_+	oxidase	NA	NA	NA	NA	NA
AXW34225.1|2927920_2928292_+	sulfite:cytochrome C oxidoreductase subunit B	NA	NA	NA	NA	NA
AXW34226.1|2928305_2928533_-	SirA family protein	NA	NA	NA	NA	NA
AXW34227.1|2928572_2929154_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AXW34228.1|2929172_2930210_-	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
AXW34229.1|2930262_2930451_-	tautomerase	NA	NA	NA	NA	NA
AXW34230.1|2930463_2931249_-	class II aldolase	NA	NA	NA	NA	NA
AXW35148.1|2931331_2932552_-	MFS transporter	NA	NA	NA	NA	NA
AXW34231.1|2932660_2933569_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXW34232.1|2933643_2935056_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 1
CP022781	Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence	2134808	565547	625722	2134808	holin,transposase	Ralstonia_phage(22.22%)	54	NA	NA
AXW35589.1|565547_566513_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
AXW35590.1|567443_569330_-	hypothetical protein	NA	NA	NA	NA	NA
AXW35591.1|569486_572939_-|holin	choline dehydrogenase	holin	NA	NA	NA	NA
AXW35592.1|573458_574424_-	hypothetical protein	NA	NA	NA	NA	NA
AXW35593.1|574420_574879_-	hypothetical protein	NA	NA	NA	NA	NA
AXW35594.1|575107_575809_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXW35595.1|575941_576205_+	hypothetical protein	NA	NA	NA	NA	NA
AXW35596.1|576258_577797_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AXW35597.1|577780_578440_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXW35598.1|578575_579103_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
AXW36723.1|579175_579616_-	universal stress protein	NA	NA	NA	NA	NA
AXW35599.1|579862_580111_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
AXW35600.1|580085_581060_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXW35601.1|581110_581542_-	hypothetical protein	NA	NA	NA	NA	NA
AXW36724.1|581538_581844_-	glycoprotein	NA	NA	NA	NA	NA
AXW35602.1|582541_585289_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	31.0	8.1e-10
AXW35603.1|585977_586787_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AXW35604.1|586803_587541_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	2.0e-19
AXW35605.1|587537_588224_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AXW35606.1|588485_589400_-	glutaminase	NA	NA	NA	NA	NA
AXW35607.1|589610_590651_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXW35608.1|590778_591312_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXW35609.1|591587_592484_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXW35610.1|592967_595250_+	type VI secretion protein	NA	NA	NA	NA	NA
AXW36725.1|595301_595724_+	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
AXW35611.1|595737_600303_+	hypothetical protein	NA	NA	NA	NA	NA
AXW35612.1|600304_600883_+	hypothetical protein	NA	NA	NA	NA	NA
AXW35613.1|601118_601547_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
AXW35614.1|601676_602078_+	hypothetical protein	NA	NA	NA	NA	NA
AXW35615.1|602201_602669_+	hypothetical protein	NA	NA	NA	NA	NA
AXW35616.1|602822_603809_+|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
AXW35617.1|604089_605055_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
AXW35618.1|605256_606681_-	type III effector protein	NA	NA	NA	NA	NA
AXW35619.1|607003_607327_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXW35620.1|607424_607919_+	arsenate reductase ArsC	NA	NA	NA	NA	NA
AXW35621.1|607924_608590_+	aquaporin family protein	NA	NA	NA	NA	NA
AXW35622.1|608762_609734_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXW35623.1|610082_611150_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	47.2	3.2e-87
AXW35624.1|611173_612094_-	oxidoreductase	NA	NA	NA	NA	NA
AXW35625.1|612175_613264_-	hydrolase	NA	NA	NA	NA	NA
AXW35626.1|613475_614069_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXW35627.1|614415_615566_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.1	1.7e-94
AXW35628.1|615597_615990_-	hypothetical protein	NA	NA	NA	NA	NA
AXW35629.1|616114_616852_-	oxidoreductase	NA	NA	NA	NA	NA
AXW35630.1|617532_617910_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AXW35631.1|618026_619007_-	amidohydrolase	NA	NA	NA	NA	NA
AXW35632.1|619008_619698_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AXW35633.1|619694_620759_-	hydroxyacid dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	41.6	1.2e-78
AXW35634.1|620782_621082_-	superoxide dismutase	NA	NA	NA	NA	NA
AXW35635.1|621319_622324_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXW35636.1|622471_622840_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AXW35637.1|622860_623793_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AXW36726.1|623795_624500_+	transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	31.8	6.1e-10
AXW35638.1|624897_625722_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP022781	Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence	2134808	887807	899017	2134808	integrase,transposase	Ralstonia_phage(92.31%)	15	NA	NA
AXW35817.1|887807_888200_-	helix-turn-helix domain-containing protein	NA	S6B0T3	Ralstonia_phage	98.5	2.6e-63
AXW35818.1|888315_888522_+	hypothetical protein	NA	S6B968	Ralstonia_phage	100.0	3.3e-33
AXW35819.1|888521_889649_+	replication initiation protein	NA	A0A0K2QQ01	Ralstonia_phage	99.2	9.1e-218
AXW35820.1|889653_889965_+	hypothetical protein	NA	A0JC22	Ralstonia_phage	100.0	8.2e-52
AXW35821.1|889971_890232_+	hypothetical protein	NA	A0JC23	Ralstonia_phage	98.8	2.6e-35
AXW35822.1|890231_890567_+	hypothetical protein	NA	A0JC24	Ralstonia_phage	100.0	1.6e-56
AXW35823.1|890646_891927_+	hypothetical protein	NA	A0A0K2QQ05	Ralstonia_phage	99.1	1.8e-217
AXW35824.1|891923_892199_+	DUF2523 domain-containing protein	NA	A0JC27	Ralstonia_phage	100.0	4.3e-36
AXW35825.1|892195_893290_+	zonular occludens toxin	NA	A0JC28	Ralstonia_phage	98.9	2.5e-204
AXW36741.1|893436_894111_+	hypothetical protein	NA	A0A097ZIG8	Ralstonia_phage	54.1	7.0e-48
AXW35826.1|894154_894586_+	DUF29 domain-containing protein	NA	A0A0K2QQ08	Ralstonia_phage	98.6	6.0e-77
AXW35827.1|894823_895789_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
AXW35828.1|896507_897983_+|integrase	integrase	integrase	NA	NA	NA	NA
AXW35829.1|898125_898341_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXW35830.1|898237_899017_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.5	4.9e-29
>prophage 3
CP022781	Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence	2134808	1100692	1154439	2134808	plate,transposase	uncultured_Caudovirales_phage(33.33%)	41	NA	NA
AXW35976.1|1100692_1101494_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXW35977.1|1101513_1102632_-	hypothetical protein	NA	NA	NA	NA	NA
AXW35978.1|1103153_1103978_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXW36755.1|1106262_1107396_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXW35979.1|1107413_1110170_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.6	2.1e-37
AXW35980.1|1110190_1112908_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.0	4.5e-85
AXW35981.1|1112940_1114032_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXW35982.1|1113995_1115846_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXW35983.1|1115908_1116382_-	type VI secretion protein	NA	NA	NA	NA	NA
AXW35984.1|1116442_1116946_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AXW35985.1|1117034_1118525_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AXW35986.1|1118517_1119030_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AXW35987.1|1119066_1119714_-	hypothetical protein	NA	NA	NA	NA	NA
AXW35988.1|1119988_1120663_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AXW35989.1|1120706_1122053_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXW35990.1|1122049_1122841_+	type VI secretion system protein ImpK	NA	NA	NA	NA	NA
AXW35991.1|1122899_1125647_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AXW35992.1|1125654_1127139_+	hypothetical protein	NA	NA	NA	NA	NA
AXW35993.1|1127135_1128080_+	hypothetical protein	NA	NA	NA	NA	NA
AXW35994.1|1129229_1130147_+	hypothetical protein	NA	NA	NA	NA	NA
AXW35995.1|1130165_1131053_+	hypothetical protein	NA	NA	NA	NA	NA
AXW35996.1|1134047_1135721_-	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
AXW35997.1|1136308_1137541_+	fatty acid hydroxylase	NA	NA	NA	NA	NA
AXW35998.1|1137548_1138067_+	hypothetical protein	NA	NA	NA	NA	NA
AXW35999.1|1138077_1138278_-	hypothetical protein	NA	NA	NA	NA	NA
AXW36756.1|1138596_1139403_-	L-aspartate dehydrogenase	NA	NA	NA	NA	NA
AXW36000.1|1140319_1140799_-	hypothetical protein	NA	NA	NA	NA	NA
AXW36001.1|1140911_1142123_-	lipase	NA	NA	NA	NA	NA
AXW36002.1|1142026_1142443_-	hypothetical protein	NA	NA	NA	NA	NA
AXW36003.1|1142478_1143039_-	FMN-binding protein	NA	NA	NA	NA	NA
AXW36004.1|1143070_1144447_-	porin	NA	NA	NA	NA	NA
AXW36757.1|1144472_1145717_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AXW36005.1|1146587_1146788_+	hypothetical protein	NA	NA	NA	NA	NA
AXW36006.1|1146804_1147332_-	hypothetical protein	NA	NA	NA	NA	NA
AXW36007.1|1147395_1148268_-	D-amino-acid transaminase	NA	NA	NA	NA	NA
AXW36008.1|1148430_1148955_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXW36009.1|1149286_1149889_+	DUF1326 domain-containing protein	NA	NA	NA	NA	NA
AXW36758.1|1149942_1150755_+	hypothetical protein	NA	NA	NA	NA	NA
AXW36010.1|1150762_1151674_+	EamA family transporter	NA	NA	NA	NA	NA
AXW36011.1|1151718_1152915_-	cytochrome P450	NA	NA	NA	NA	NA
AXW36012.1|1153473_1154439_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
>prophage 4
CP022781	Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence	2134808	1468722	1478799	2134808		Acidithiobacillus_phage(66.67%)	12	NA	NA
AXW36210.1|1468722_1469217_+	hypothetical protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	57.3	1.8e-21
AXW36211.1|1469338_1469527_+	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	64.2	4.5e-13
AXW36212.1|1469751_1470117_+	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	58.8	2.9e-32
AXW36213.1|1470158_1471379_-	DNA methylase N-4	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	80.5	6.0e-191
AXW36214.1|1471375_1472776_-	DNA modification methylase	NA	K4I3Y2	Acidithiobacillus_phage	62.1	1.0e-165
AXW36215.1|1473273_1473681_-	hypothetical protein	NA	NA	NA	NA	NA
AXW36216.1|1473670_1473883_-	hypothetical protein	NA	NA	NA	NA	NA
AXW36217.1|1474114_1476412_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	65.2	2.5e-294
AXW36218.1|1476395_1476794_-	hypothetical protein	NA	NA	NA	NA	NA
AXW36219.1|1476799_1477204_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	49.6	4.8e-28
AXW36220.1|1477276_1477909_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	67.5	3.6e-62
AXW36221.1|1477926_1478799_-	hypothetical protein	NA	K4HZX9	Acidithiobacillus_phage	66.1	7.1e-101
>prophage 5
CP022781	Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence	2134808	1521894	1531502	2134808	transposase	Burkholderia_virus(33.33%)	7	NA	NA
AXW36245.1|1521894_1523220_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	49.8	1.1e-102
AXW36246.1|1523449_1524436_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
AXW36247.1|1524596_1525508_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	47.6	2.4e-75
AXW36248.1|1525613_1526600_+|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
AXW36249.1|1526872_1527652_-	phosphohydrolase	NA	NA	NA	NA	NA
AXW36250.1|1528153_1528594_+	hypothetical protein	NA	A4PE55	Ralstonia_virus	54.5	4.1e-33
AXW36251.1|1529255_1531502_+	peptidase M1	NA	A0A0P0IY26	Acinetobacter_phage	27.0	1.4e-52
