The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	0	9670	4119128		Acinetobacter_phage(25.0%)	8	NA	NA
AXX39511.1|99_294_+	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	96.8	4.6e-29
AXX39512.1|544_1177_-	hypothetical protein	NA	NA	NA	NA	NA
AXX39513.1|1324_2011_-	DNA polymerase III subunit epsilon	NA	A0A059VJT9	Pseudomonas_phage	41.6	1.4e-35
AXX43231.1|2260_3490_+	triacylglycerol lipase	NA	NA	NA	NA	NA
AXX39514.1|3519_3675_-	hypothetical protein	NA	NA	NA	NA	NA
AXX39515.1|3735_4989_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.3	2.3e-97
AXX39516.1|5029_6478_-	RND transporter	NA	NA	NA	NA	NA
AXX39517.1|6490_9670_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.7	1.9e-66
>prophage 2
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	14586	17637	4119128		Planktothrix_phage(33.33%)	4	NA	NA
AXX39523.1|14586_15363_+	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	36.8	4.8e-24
AXX39524.1|15434_15764_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AXX39525.1|16000_16264_-	(4Fe-4S)-binding protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	49.4	6.5e-18
AXX39526.1|16266_17637_-	U32 family peptidase	NA	Q6DW11	Phage_TP	62.9	2.0e-126
>prophage 3
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	25330	27815	4119128		Bacillus_phage(66.67%)	3	NA	NA
AXX39532.1|25330_25690_+	hypothetical protein	NA	A0A1I9LJU6	Stx_converting_phage	48.1	3.3e-12
AXX39533.1|25797_26460_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.1	5.0e-22
AXX39534.1|26456_27815_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	7.6e-17
>prophage 4
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	33641	34655	4119128		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AXX39541.1|33641_34655_-	glycosyl transferase	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	46.7	2.2e-77
>prophage 5
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	49650	52738	4119128		Salicola_phage(33.33%)	4	NA	NA
AXX39555.1|49650_50517_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.3	2.1e-44
AXX39556.1|50650_50896_-	oxidoreductase	NA	NA	NA	NA	NA
AXX39557.1|51270_51483_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	50.0	1.5e-12
AXX39558.1|51568_52738_+	ATP-dependent RNA helicase RhlB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.7	3.4e-50
>prophage 6
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	58908	67660	4119128	tRNA	Mollivirus(25.0%)	8	NA	NA
AXX39567.1|58908_60450_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.6	1.9e-85
AXX39568.1|60528_62418_+	peptidase M48	NA	NA	NA	NA	NA
AXX39569.1|62518_63175_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39570.1|63186_64152_+	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	28.3	3.8e-15
AXX43234.1|64296_65724_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39571.1|65815_66262_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	40.8	1.9e-17
AXX39572.1|66288_66504_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXX39573.1|66649_67660_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	66.3	2.1e-125
>prophage 7
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	71424	74768	4119128		Iragoides_fasciata_nucleopolyhedrovirus(50.0%)	2	NA	NA
AXX39577.1|71424_72228_+	protein kinase	NA	B6VC32	Iragoides_fasciata_nucleopolyhedrovirus	33.9	1.3e-05
AXX39578.1|73010_74768_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	27.7	3.5e-38
>prophage 8
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	116811	121700	4119128	transposase	Burkholderia_virus(50.0%)	4	NA	NA
AXX39610.1|116811_118299_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.9	6.1e-60
AXX39611.1|118689_118800_-	ADP-ribose pyrophosphatase	NA	NA	NA	NA	NA
AXX39612.1|119451_120006_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXX39613.1|120674_121700_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
>prophage 9
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	132470	133403	4119128	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
AXX39621.1|132470_133403_+|transposase	IS5 family transposase ISAba13	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
>prophage 10
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	141577	146781	4119128		Planktothrix_phage(50.0%)	4	NA	NA
AXX39629.1|141577_142603_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	9.1e-31
AXX39630.1|142678_143545_-	NLPA lipoprotein	NA	NA	NA	NA	NA
AXX39631.1|143794_145081_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AXX43239.1|145206_146781_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	47.6	7.1e-67
>prophage 11
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	158258	159704	4119128		Escherichia_phage(100.0%)	1	NA	NA
AXX39642.1|158258_159704_-	replicative DNA helicase	NA	O80281	Escherichia_phage	51.7	2.5e-119
>prophage 12
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	167193	169572	4119128		Hokovirus(100.0%)	1	NA	NA
AXX39652.1|167193_169572_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	6.3e-176
>prophage 13
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	187480	196861	4119128		Staphylococcus_phage(33.33%)	8	NA	NA
AXX39669.1|187480_189124_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	38.1	1.1e-78
AXX39670.1|189170_189749_-	flavin reductase	NA	NA	NA	NA	NA
AXX39671.1|189918_190695_+	molybdopterin biosynthesis protein	NA	NA	NA	NA	NA
AXX39672.1|190753_192052_+	kinase	NA	A0A0R6PEF3	Moraxella_phage	49.1	1.3e-106
AXX39673.1|192067_192448_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AXX39674.1|192404_192842_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine pyrophosphokinase	NA	NA	NA	NA	NA
AXX39675.1|193103_194813_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AXX39676.1|194821_196861_+	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	27.6	1.1e-38
>prophage 14
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	212935	230994	4119128	integrase,transposase	Acinetobacter_phage(42.86%)	30	212197:212213	235899:235915
212197:212213	attL	AAAAAGTGAAAATTGAG	NA	NA	NA	NA
AXX39685.1|212935_214144_+|integrase	integrase	integrase	A0A0P0IKP2	Acinetobacter_phage	48.0	2.8e-108
AXX39686.1|214140_214410_-	DNA-binding protein	NA	A0A0N7IRE8	Acinetobacter_phage	53.5	1.8e-15
AXX39687.1|214411_214747_-	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	59.1	4.6e-32
AXX39688.1|214743_215145_-	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	96.1	6.2e-36
AXX39689.1|215141_215435_-	hypothetical protein	NA	NA	NA	NA	NA
AXX39690.1|215572_216601_-	hypothetical protein	NA	A0A2I7QY11	Vibrio_phage	27.8	5.0e-13
AXX39691.1|216613_217294_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AXX39692.1|217464_217836_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	38.8	4.9e-11
AXX39693.1|217832_218162_-	hypothetical protein	NA	NA	NA	NA	NA
AXX39694.1|218220_218481_-	hypothetical protein	NA	NA	NA	NA	NA
AXX39695.1|218566_219370_-	DUF2303 domain-containing protein	NA	A0A2R2Z323	Escherichia_phage	32.8	2.1e-27
AXX39696.1|219410_219743_-	hypothetical protein	NA	NA	NA	NA	NA
AXX39697.1|219958_220234_-	hypothetical protein	NA	NA	NA	NA	NA
AXX39698.1|220245_220935_-	peptidase S24	NA	A0A0R6PCY1	Moraxella_phage	37.1	5.0e-25
AXX39699.1|221061_221295_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXX39700.1|221327_221702_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39701.1|221735_221936_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39702.1|221932_222118_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39703.1|222114_222570_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39704.1|222566_223184_+	hypothetical protein	NA	R9VWB9	Serratia_phage	40.3	3.2e-31
AXX39705.1|223180_223720_+	HNH endonuclease	NA	Q94MV4	Myxococcus_phage	54.9	2.4e-30
AXX39706.1|223716_224325_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43242.1|224330_224717_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39707.1|224713_226192_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	53.3	9.7e-135
AXX39708.1|226195_227239_+	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
AXX39709.1|227235_228000_+	DNA replication protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.4	3.0e-63
AXX39710.1|227996_228536_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39711.1|228525_229257_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39712.1|229253_229625_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39713.1|229968_230994_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
235899:235915	attR	AAAAAGTGAAAATTGAG	NA	NA	NA	NA
>prophage 15
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	240100	242006	4119128		Acinetobacter_phage(50.0%)	2	NA	NA
AXX39722.1|240100_241042_+	HicB family protein	NA	A0A0D4DCG1	Acinetobacter_phage	29.6	5.4e-06
AXX39723.1|241106_242006_+	hypothetical protein	NA	A5VW58	Enterobacteria_phage	42.9	3.8e-41
>prophage 16
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	246973	255219	4119128	terminase	Escherichia_phage(50.0%)	10	NA	NA
AXX39730.1|246973_247432_+	hypothetical protein	NA	A0A143FJ28	Bacillus_phage	38.5	1.8e-10
AXX39731.1|247443_247671_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39732.1|247743_248649_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39733.1|248651_249455_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39734.1|249447_249648_+	conjugal transfer protein TraR	NA	G3EN77	Psychrobacter_phage	42.4	2.2e-05
AXX39735.1|249659_250172_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39736.1|250191_252183_+|terminase	terminase	terminase	A0A077SK57	Escherichia_phage	54.9	3.6e-07
AXX39737.1|252255_253794_+	sperm-activating peptide	NA	NA	NA	NA	NA
AXX39738.1|253808_254087_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39739.1|254088_255219_+	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	35.2	1.3e-22
>prophage 17
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	261597	287658	4119128	transposase	Acinetobacter_phage(33.33%)	20	NA	NA
AXX39748.1|261597_262494_-	hypothetical protein	NA	A5VW58	Enterobacteria_phage	49.2	3.7e-44
AXX39749.1|262734_262986_+	transcriptional regulator	NA	NA	NA	NA	NA
AXX39750.1|263152_263278_-	hypothetical protein	NA	NA	NA	NA	NA
AXX39751.1|263531_263807_+	antitoxin	NA	NA	NA	NA	NA
AXX39752.1|263769_264036_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.0	6.8e-15
AXX39753.1|264163_264811_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39754.1|264810_265260_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39755.1|265259_266153_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39756.1|266162_276521_+	sugar-binding protein	NA	A0A126DKX0	Acinetobacter_phage	26.3	3.1e-78
AXX39757.1|276565_276886_+	hypothetical protein	NA	U5PWK1	Acinetobacter_phage	56.2	6.1e-26
AXX39758.1|276885_277548_+	hypothetical protein	NA	U5PVV9	Acinetobacter_phage	51.8	9.9e-55
AXX39759.1|277600_277795_-	hypothetical protein	NA	NA	NA	NA	NA
AXX39760.1|277953_279489_+	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	26.2	9.4e-32
AXX39761.1|279488_280142_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39762.1|280215_282168_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39763.1|282167_283619_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	42.8	1.1e-82
AXX39764.1|283769_284399_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39765.1|284395_285475_+	DNA-binding protein	NA	A0A0U4JD08	Gordonia_phage	31.9	2.6e-36
AXX39766.1|285690_286404_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39767.1|286632_287658_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
>prophage 18
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	291198	295486	4119128		uncultured_Caudovirales_phage(66.67%)	5	NA	NA
AXX39773.1|291198_291969_+	TIGR02594 family protein	NA	A0A0B5L5G5	Acinetobacter_phage	98.4	1.7e-151
AXX39774.1|292094_292454_-	hypothetical protein	NA	NA	NA	NA	NA
AXX39775.1|292837_293536_-	hypothetical protein	NA	NA	NA	NA	NA
AXX39776.1|293689_294988_-	DNA polymerase V subunit UmuC	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	62.6	6.1e-157
AXX39777.1|294991_295486_-	DNA polymerase V	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.1	1.3e-43
>prophage 19
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	309215	311168	4119128		Wolbachia_phage(100.0%)	1	NA	NA
AXX39790.1|309215_311168_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	33.1	3.5e-84
>prophage 20
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	315501	317907	4119128	tRNA	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AXX39797.1|315501_316011_-	cyclophilin	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	34.0	9.4e-13
AXX39798.1|316179_317907_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	57.2	1.2e-187
>prophage 21
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	328511	330224	4119128		Acinetobacter_phage(100.0%)	1	NA	NA
AXX39807.1|328511_330224_+	helicase	NA	A0A172Q090	Acinetobacter_phage	40.0	1.7e-77
>prophage 22
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	347005	347476	4119128		Acinetobacter_phage(100.0%)	1	NA	NA
AXX39821.1|347005_347476_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.4	1.4e-31
>prophage 23
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	354049	361978	4119128		Hokovirus(33.33%)	7	NA	NA
AXX39829.1|354049_355636_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.4	3.5e-21
AXX39830.1|355895_356339_-	universal stress protein	NA	NA	NA	NA	NA
AXX39831.1|356627_356855_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39832.1|357033_357207_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39833.1|357479_357923_+	RDD family protein	NA	NA	NA	NA	NA
AXX39834.1|358486_361243_+	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.3	1.4e-38
AXX39835.1|361258_361978_+	methyltransferase	NA	G3MA03	Bacillus_virus	38.5	1.0e-12
>prophage 24
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	371445	377241	4119128		Tupanvirus(33.33%)	4	NA	NA
AXX39844.1|371445_372705_+	esterase	NA	A0A2K9L1U3	Tupanvirus	23.5	1.0e-12
AXX39845.1|372752_373331_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXX39846.1|373456_374935_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	27.1	3.8e-30
AXX39847.1|375108_377241_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	39.4	1.6e-42
>prophage 25
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	393011	434532	4119128	terminase,transposase,integrase,head,plate	Acinetobacter_phage(94.0%)	61	392834:392851	435161:435178
392834:392851	attL	GGATTCTACTTCTTTTAT	NA	NA	NA	NA
AXX39859.1|393011_394274_+|integrase	integrase	integrase	A0A0P0IKP2	Acinetobacter_phage	98.3	1.3e-244
AXX39860.1|394279_394549_-	DNA-binding protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
AXX39861.1|394549_395326_-	DUF551 domain-containing protein	NA	A0A0P0HSE1	Acinetobacter_phage	98.4	2.0e-155
AXX39862.1|395329_395575_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
AXX39863.1|395576_396551_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	85.8	3.1e-153
AXX39864.1|396547_397669_-	AAA family ATPase	NA	A0A0N7IRE0	Acinetobacter_phage	100.0	5.2e-213
AXX39865.1|397680_398004_-	hypothetical protein	NA	A0A0P0IKP4	Acinetobacter_phage	97.2	1.3e-55
AXX39866.1|398006_398447_-	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	98.6	7.5e-75
AXX39867.1|398652_399486_-	hypothetical protein	NA	NA	NA	NA	NA
AXX39868.1|399487_400306_-	hypothetical protein	NA	NA	NA	NA	NA
AXX39869.1|400362_401049_-	LexA family transcriptional repressor	NA	NA	NA	NA	NA
AXX39870.1|401154_401343_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39871.1|401351_401708_+	transcriptional regulator	NA	J7I452	Acinetobacter_phage	96.6	5.7e-57
AXX43251.1|401757_402042_+	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	85.7	5.4e-34
AXX43252.1|402113_402338_+	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	98.6	6.5e-35
AXX39872.1|402330_403212_+	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	100.0	9.8e-143
AXX39873.1|403214_404015_+	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.9	2.5e-145
AXX39874.1|404011_404467_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39875.1|404466_404862_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	89.3	1.4e-61
AXX39876.1|404858_405356_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	97.0	1.6e-89
AXX39877.1|405462_406107_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39878.1|406156_406375_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39879.1|406495_406930_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39880.1|406974_407622_+|transposase	transposase	transposase	A0A0N7IRF1	Acinetobacter_phage	100.0	5.0e-128
AXX39881.1|407670_408180_+	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	100.0	1.2e-89
AXX39882.1|408176_409835_+|terminase	terminase	terminase	A0A0P0IVT4	Acinetobacter_phage	98.6	0.0e+00
AXX39883.1|409845_411261_+	hypothetical protein	NA	A0A0P0I486	Acinetobacter_phage	78.6	2.0e-209
AXX43253.1|411331_411922_+|head	phage head morphogenesis protein	head	A0A0P0IKX5	Acinetobacter_phage	95.9	1.1e-102
AXX39884.1|411922_412240_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39885.1|412255_412630_+	hypothetical protein	NA	NA	NA	NA	NA
AXX39886.1|412637_413966_+	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	65.3	4.8e-133
AXX39887.1|413971_414460_+	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	67.3	2.1e-54
AXX39888.1|414523_415549_+	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	73.8	1.2e-147
AXX39889.1|415562_415973_+	hypothetical protein	NA	A0A0P0IYA6	Acinetobacter_phage	42.7	1.1e-19
AXX39890.1|415976_416363_+	DUF4054 domain-containing protein	NA	A0A0P0IKR4	Acinetobacter_phage	100.0	2.3e-67
AXX39891.1|416359_416920_+	hypothetical protein	NA	A0A0P0J0D1	Acinetobacter_phage	94.6	4.2e-91
AXX39892.1|416906_417275_+	hypothetical protein	NA	A0A0P0HSK8	Acinetobacter_phage	100.0	5.9e-65
AXX39893.1|417277_417817_+	hypothetical protein	NA	A0A0P0IVT9	Acinetobacter_phage	100.0	3.3e-101
AXX39894.1|417820_419296_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	98.6	1.4e-271
AXX39895.1|419310_419754_+	DUF3277 domain-containing protein	NA	A0A0P0IKY2	Acinetobacter_phage	100.0	3.3e-78
AXX39896.1|419753_420215_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	99.3	5.8e-78
AXX43254.1|420190_420403_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	49.0	4.6e-06
AXX39897.1|420410_422435_+	hypothetical protein	NA	A0A0P0IE11	Acinetobacter_phage	99.7	0.0e+00
AXX39898.1|422431_422788_-	DUF1311 domain-containing protein	NA	A0A0P0IRF2	Acinetobacter_phage	100.0	4.5e-62
AXX39899.1|422787_423015_-	hypothetical protein	NA	A0A0P0I8G2	Acinetobacter_phage	100.0	1.5e-31
AXX39900.1|423019_423208_+	hypothetical protein	NA	A0A0P0IYB4	Acinetobacter_phage	100.0	6.5e-28
AXX39901.1|423374_423971_+	hypothetical protein	NA	A0A0P0IKS1	Acinetobacter_phage	100.0	7.9e-104
AXX39902.1|423973_424267_+	hypothetical protein	NA	A0A0P0J0D9	Acinetobacter_phage	100.0	2.1e-49
AXX39903.1|424267_425227_+	hypothetical protein	NA	A0A0P0HSL6	Acinetobacter_phage	93.1	2.7e-170
AXX39904.1|425229_425892_+	hypothetical protein	NA	A0A0N7IRF4	Acinetobacter_phage	95.9	2.9e-123
AXX39905.1|425926_426280_+	hypothetical protein	NA	A0A0P0IVU6	Acinetobacter_phage	99.1	6.9e-63
AXX39906.1|426282_427467_+|plate	phage baseplate protein	plate	A0A0P0I499	Acinetobacter_phage	100.0	7.1e-221
AXX39907.1|427466_428057_+	DUF2612 domain-containing protein	NA	A0A0P0IKZ0	Acinetobacter_phage	92.9	3.5e-104
AXX39908.1|428049_428658_+	hypothetical protein	NA	A0A0P0IE19	Acinetobacter_phage	99.0	4.0e-111
AXX39909.1|428721_430776_+	hypothetical protein	NA	A0A0P0IRG3	Acinetobacter_phage	99.6	0.0e+00
AXX39910.1|430777_431005_+	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	98.7	1.1e-34
AXX39911.1|431082_431472_+	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	100.0	1.1e-66
AXX39912.1|431514_432057_+	hypothetical protein	NA	A0A0N7IRF5	Acinetobacter_phage	99.4	2.0e-101
AXX39913.1|432189_432702_-	hypothetical protein	NA	NA	NA	NA	NA
AXX39914.1|432739_434038_-	DNA polymerase V subunit UmuC	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	60.9	1.9e-158
AXX39915.1|434034_434532_-	DNA polymerase V	NA	A0A2H4J538	uncultured_Caudovirales_phage	59.6	1.2e-44
435161:435178	attR	GGATTCTACTTCTTTTAT	NA	NA	NA	NA
>prophage 26
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	439508	440837	4119128		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AXX39920.1|439508_440837_-	DNA methylase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	44.3	2.4e-100
>prophage 27
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	460813	463283	4119128		uncultured_Caudovirales_phage(66.67%)	5	NA	NA
AXX39936.1|460813_461125_-	sulfite reductase	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	43.1	2.0e-18
AXX39937.1|461144_461429_-	DsrH like protein	NA	NA	NA	NA	NA
AXX39938.1|461446_461797_-	hypothetical protein	NA	NA	NA	NA	NA
AXX39939.1|461841_462210_-	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	37.0	6.8e-13
AXX39940.1|462275_463283_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	31.9	9.5e-49
>prophage 28
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	478960	479713	4119128		Flavobacterium_phage(100.0%)	1	NA	NA
AXX39956.1|478960_479713_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	42.2	7.4e-22
>prophage 29
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	490454	491504	4119128		Bacillus_phage(100.0%)	1	NA	NA
AXX39966.1|490454_491504_-	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	59.4	5.7e-113
>prophage 30
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	499929	516185	4119128	protease	Tupanvirus(16.67%)	12	NA	NA
AXX39977.1|499929_501108_+|protease	serine protease	protease	A0A2K9L570	Tupanvirus	40.6	1.5e-32
AXX39978.1|501155_502610_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	69.5	1.0e-181
AXX39979.1|502856_503486_-	DUF159 family protein	NA	A0A218MNF5	uncultured_virus	54.5	3.5e-57
AXX39980.1|503840_505283_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
AXX39981.1|505337_505781_-	universal stress protein	NA	NA	NA	NA	NA
AXX39982.1|505906_508000_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	28.2	1.3e-15
AXX39983.1|508606_508822_-	hypothetical protein	NA	NA	NA	NA	NA
AXX39984.1|509012_509477_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXX39985.1|510108_510615_+	PEGA domain-containing protein	NA	B9UDL3	Salmonella_phage	44.2	7.1e-21
AXX39986.1|510659_512378_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
AXX39987.1|512364_513312_-	1-phosphofructokinase	NA	NA	NA	NA	NA
AXX39988.1|513326_516185_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	32.8	1.0e-15
>prophage 31
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	534547	602956	4119128	protease,transposase	Streptococcus_phage(18.18%)	66	NA	NA
AXX40012.1|534547_535417_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AXX40013.1|535684_536293_-	DUF1449 domain-containing protein	NA	NA	NA	NA	NA
AXX40014.1|536318_536627_-	Rieske	NA	NA	NA	NA	NA
AXX40015.1|536643_537648_-	adenosine kinase	NA	NA	NA	NA	NA
AXX40016.1|537885_540000_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AXX40017.1|540236_543191_+	peptidase M16	NA	NA	NA	NA	NA
AXX40018.1|543211_544363_+	phospholipase	NA	NA	NA	NA	NA
AXX40019.1|544404_545742_-	potassium transporter TrkH	NA	NA	NA	NA	NA
AXX43263.1|545760_546411_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
AXX40020.1|546555_548097_-	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
AXX40021.1|548204_548876_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
AXX40022.1|548875_549556_+	M48 family peptidase	NA	NA	NA	NA	NA
AXX40023.1|550446_551316_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AXX40024.1|552235_553291_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AXX40025.1|553366_554125_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40026.1|554134_554548_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.0	2.9e-12
AXX40027.1|554557_556834_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.3	5.3e-164
AXX40028.1|556837_557200_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	62.6	1.6e-27
AXX40029.1|557626_558682_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A1Z1LZD8	Serratia_phage	46.1	2.8e-83
AXX40030.1|558728_559646_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXX40031.1|559648_560209_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXX40032.1|560344_562369_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
AXX40033.1|562439_562847_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AXX40034.1|562889_563606_+	lipase	NA	NA	NA	NA	NA
AXX40035.1|563625_564720_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXX40036.1|564773_565619_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AXX40037.1|565854_566343_-	internalin	NA	NA	NA	NA	NA
AXX40038.1|566566_568204_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.7	1.4e-150
AXX40039.1|568235_569093_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.4	1.5e-50
AXX40040.1|569138_570428_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	59.8	1.0e-135
AXX40041.1|570523_571201_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AXX40042.1|571807_572197_+	cell division protein FtsB	NA	NA	NA	NA	NA
AXX40043.1|572162_572879_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AXX40044.1|573228_573900_+	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AXX40045.1|573918_574572_+	CoA transferase subunit B	NA	NA	NA	NA	NA
AXX40046.1|574584_575796_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AXX40047.1|575798_577154_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
AXX40048.1|577150_577936_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AXX40049.1|577978_579334_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
AXX40050.1|579349_579763_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AXX40051.1|579773_580499_+	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
AXX40052.1|580513_581143_+	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
AXX43264.1|581211_582039_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.8	4.9e-19
AXX40053.1|582058_583510_+	3-dehydroshikimate dehydratase	NA	NA	NA	NA	NA
AXX40054.1|583569_584889_+	carbohydrate porin	NA	NA	NA	NA	NA
AXX40055.1|584971_587401_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AXX40056.1|588031_588499_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40057.1|588602_589349_-|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	4.3e-14
AXX40058.1|589494_589908_+	transporter component	NA	NA	NA	NA	NA
AXX40059.1|589912_590326_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
AXX40060.1|590330_591197_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXX40061.1|591289_592102_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AXX40062.1|592144_593065_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXX40063.1|593153_594395_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXX40064.1|594412_595534_+	phosphotransferase family protein	NA	NA	NA	NA	NA
AXX40065.1|595530_596229_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AXX40066.1|596244_596988_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AXX40067.1|597023_597248_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40068.1|597701_598019_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40069.1|598256_599282_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
AXX40070.1|599376_599517_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40071.1|599646_600045_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43265.1|600191_600518_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40072.1|600723_601305_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40073.1|601343_601727_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40074.1|601790_602956_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
>prophage 32
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	619077	620242	4119128	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
AXX40088.1|619077_620242_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
>prophage 33
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	635958	645815	4119128		Bacillus_virus(40.0%)	10	NA	NA
AXX40102.1|635958_637011_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	45.1	2.8e-88
AXX40103.1|637440_638460_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXX40104.1|638462_639473_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AXX40105.1|639469_640234_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	6.1e-16
AXX40106.1|640236_640725_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXX40107.1|640719_641508_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXX40108.1|641606_642416_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AXX40109.1|642597_643482_+	ribose-phosphate pyrophosphokinase	NA	A0A291LA84	Escherichia_phage	35.2	1.3e-33
AXX40110.1|643493_644987_+	nicotinate phosphoribosyltransferase	NA	A0A1W6DY18	Aeromonas_phage	50.9	5.4e-141
AXX40111.1|645047_645815_+	NUDIX domain-containing protein	NA	G3MA14	Bacillus_virus	33.0	1.9e-25
>prophage 34
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	652613	654853	4119128	transposase	Faecalibacterium_phage(50.0%)	3	NA	NA
AXX40116.1|652613_653639_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
AXX40117.1|653639_653924_+	multidrug resistance protein A	NA	NA	NA	NA	NA
AXX40118.1|653920_654853_+|transposase	IS5 family transposase ISAba13	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
>prophage 35
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	664234	664675	4119128		Vibrio_phage(100.0%)	1	NA	NA
AXX40125.1|664234_664675_-	HD domain-containing protein	NA	A0A0B5H2U9	Vibrio_phage	35.5	1.3e-13
>prophage 36
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	679789	686069	4119128	capsid	Prochlorococcus_phage(33.33%)	5	NA	NA
AXX40138.1|679789_680899_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.5	1.5e-31
AXX43268.1|681128_682880_-|capsid	phage capsid protein	capsid	A0A076G822	Escherichia_phage	37.3	2.3e-106
AXX40139.1|683182_684346_+	catalase	NA	NA	NA	NA	NA
AXX40140.1|684423_684789_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40141.1|685601_686069_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	52.4	3.8e-37
>prophage 37
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	701628	702249	4119128		Planktothrix_phage(100.0%)	1	NA	NA
AXX40156.1|701628_702249_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	8.5e-16
>prophage 38
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	711848	712634	4119128		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AXX40167.1|711848_712634_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.1	5.2e-10
>prophage 39
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	720249	721182	4119128	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
AXX40172.1|720249_721182_-|transposase	IS5 family transposase ISAba13	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
>prophage 40
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	737533	741723	4119128		Burkholderia_virus(33.33%)	5	NA	NA
AXX40187.1|737533_738820_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.6	8.1e-37
AXX40188.1|738859_739141_-	DUF971 domain-containing protein	NA	NA	NA	NA	NA
AXX40189.1|739253_739532_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40190.1|739673_740378_+	serine/threonine-protein phosphatase 2	NA	K7P6H8	Enterobacteria_phage	41.2	8.7e-41
AXX40191.1|740640_741723_+	DNA-binding protein	NA	A0A0U4JD08	Gordonia_phage	36.4	4.0e-37
>prophage 41
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	748861	793221	4119128	integrase,transposase	Salmonella_phage(25.0%)	46	741031:741046	784186:784201
741031:741046	attL	ATAAACACTCCTCAAG	NA	NA	NA	NA
AXX40198.1|748861_750026_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.8	2.6e-50
AXX40199.1|750134_750599_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
AXX40200.1|750709_751138_+	DoxX family protein	NA	NA	NA	NA	NA
AXX40201.1|751134_752241_+	MexH family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXX40202.1|752253_755346_+	MexW/MexI family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.1	1.6e-59
AXX40203.1|755338_756748_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40204.1|756982_757603_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.1	4.3e-44
AXX40205.1|758072_759163_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXX40206.1|759252_760068_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
AXX40207.1|760154_760457_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AXX40208.1|760350_760602_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40209.1|761792_762221_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AXX40210.1|762942_764118_-	tetracycline efflux MFS transporter Tet(G)	NA	NA	NA	NA	NA
AXX40211.1|764221_764848_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXX40212.1|764844_765027_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AXX40213.1|765054_766269_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	24.1	4.4e-16
AXX40214.1|766762_768256_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXX40215.1|768466_768691_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40216.1|768687_769425_-	resolvase	NA	NA	NA	NA	NA
AXX40217.1|769572_769905_+	transcriptional regulator	NA	NA	NA	NA	NA
AXX40218.1|769901_770669_+	FMN reductase	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	63.3	1.4e-76
AXX40219.1|770665_771172_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	42.6	3.0e-27
AXX40220.1|771168_772236_+	arsenical-resistance protein	NA	NA	NA	NA	NA
AXX40221.1|772350_772554_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40222.1|772590_772815_-	toxin of toxin-antitoxin system	NA	NA	NA	NA	NA
AXX40223.1|772878_773127_-	hypothetical protein	NA	NA	NA	NA	NA
AXX43272.1|773131_774559_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
AXX40224.1|774569_774806_-	entry exclusion lipoprotein TrbK	NA	NA	NA	NA	NA
AXX40225.1|774818_775598_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
AXX40226.1|775738_775927_-	stabilization protein	NA	NA	NA	NA	NA
AXX40227.1|776959_777841_-	replication protein C	NA	NA	NA	NA	NA
AXX40228.1|778660_778882_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXX40229.1|779029_780232_-|integrase	integrase	integrase	T1S9J3	Salmonella_phage	55.1	5.0e-121
AXX40230.1|780501_781029_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40231.1|781045_781813_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AXX40232.1|781904_783092_-	MFS transporter	NA	NA	NA	NA	NA
AXX40233.1|783130_783550_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AXX40234.1|783576_783792_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40235.1|784072_785119_-	cytoplasmic protein	NA	NA	NA	NA	NA
784186:784201	attR	ATAAACACTCCTCAAG	NA	NA	NA	NA
AXX40236.1|785303_786734_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40237.1|786752_787844_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40238.1|787863_788715_-|transposase	transposase	transposase	NA	NA	NA	NA
AXX40239.1|788711_790601_-|transposase	transposase	transposase	NA	NA	NA	NA
AXX40240.1|790593_791292_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
AXX40241.1|791353_792385_-	photosystem I reaction center subunit VIII	NA	NA	NA	NA	NA
AXX40242.1|792381_793221_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	9.0e-37
>prophage 42
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	798574	799924	4119128		Ochrobactrum_phage(100.0%)	1	NA	NA
AXX40248.1|798574_799924_+	chromate transporter	NA	A0A219VHC2	Ochrobactrum_phage	66.7	1.2e-30
>prophage 43
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	821879	822971	4119128		Pandoravirus(100.0%)	1	NA	NA
AXX40268.1|821879_822971_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.1	1.4e-77
>prophage 44
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	856802	860406	4119128		Edwardsiella_phage(50.0%)	3	NA	NA
AXX40304.1|856802_857912_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.5	9.3e-82
AXX40305.1|857987_858731_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AXX40306.1|858837_860406_-	histidine-type phosphatase	NA	A0A218MNG5	uncultured_virus	65.8	3.1e-115
>prophage 45
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	881810	982240	4119128	terminase,transposase,capsid,tRNA,integrase,head,protease,tail,portal	uncultured_Caudovirales_phage(26.19%)	102	930569:930590	969195:969216
AXX40323.1|881810_882275_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AXX40324.1|882489_882768_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40325.1|883004_884378_+	ABC transporter	NA	M1HE59	Acanthocystis_turfacea_Chlorella_virus	25.7	5.5e-07
AXX40326.1|884598_885891_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXX40327.1|885912_887118_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXX40328.1|887237_888461_-	alkane 1-monooxygenase	NA	A0A1V0SBK9	Catovirus	36.3	9.4e-51
AXX40329.1|888650_889598_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXX40330.1|889637_891503_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXX40331.1|891634_891907_-	HU family DNA-binding protein	NA	Q6QIE5	Burkholderia_phage	65.2	1.3e-24
AXX40332.1|892076_892532_-	poly(hydroxyalcanoate) granule associated protein	NA	NA	NA	NA	NA
AXX40333.1|892742_893390_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40334.1|893500_893974_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AXX40335.1|893975_895193_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
AXX40336.1|895259_895646_+	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	79.0	6.0e-52
AXX40337.1|895676_895997_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	2.0e-24
AXX40338.1|896082_896601_+	co-chaperone protein HscB	NA	NA	NA	NA	NA
AXX40339.1|896639_898499_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	40.9	4.7e-102
AXX40340.1|898517_898856_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AXX40341.1|898904_900374_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A218MLZ2	uncultured_virus	29.3	5.5e-21
AXX40342.1|900426_900861_-	HIT domain-containing protein	NA	NA	NA	NA	NA
AXX40343.1|901061_904523_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AXX40344.1|904657_905014_-	hypothetical protein	NA	NA	NA	NA	NA
AXX43274.1|905093_906026_-	peroxidase	NA	NA	NA	NA	NA
AXX40345.1|906171_906954_-	glutathione S-transferase	NA	NA	NA	NA	NA
AXX40346.1|906978_907485_-	ribonuclease activity regulator protein RraA	NA	NA	NA	NA	NA
AXX40347.1|907497_908163_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
AXX40348.1|908375_908642_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AXX40349.1|908698_909433_-	phosphoglycerate mutase family protein	NA	NA	NA	NA	NA
AXX40350.1|909490_910348_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
AXX40351.1|910657_911026_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40352.1|911079_911814_-	DUF159 family protein	NA	A0A218MNF5	uncultured_virus	41.3	1.2e-48
AXX40353.1|911846_913577_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	6.7e-18
AXX40354.1|913589_914732_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AXX40355.1|914739_915678_-	ABC transporter permease	NA	NA	NA	NA	NA
AXX40356.1|915690_917724_-	Zn-dependent oligopeptidase	NA	A0A1V0SID3	Klosneuvirus	29.9	1.8e-75
AXX40357.1|917724_919548_-	heme-binding protein	NA	NA	NA	NA	NA
AXX40358.1|919563_921354_-	heme-binding protein	NA	NA	NA	NA	NA
AXX43275.1|922212_924801_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.5	1.9e-45
AXX40359.1|924945_925662_+	energy transducer TonB	NA	NA	NA	NA	NA
AXX40360.1|925702_926584_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
AXX40361.1|926599_927022_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXX40362.1|927041_927455_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXX40363.1|927520_927970_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXX40364.1|928073_930239_-	malate synthase G	NA	NA	NA	NA	NA
930569:930590	attL	AAAAAGCGCTCAATTTAGAGCG	NA	NA	NA	NA
AXX40365.1|931347_931716_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40366.1|931715_932225_-	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	58.6	4.5e-47
AXX40367.1|932208_932475_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40368.1|932523_938751_-|tail	phage tail protein	tail	A0A0R6PIC9	Moraxella_phage	63.0	0.0e+00
AXX40369.1|938806_939463_-|tail	tail assembly protein	tail	A0A2D1GNM2	Pseudomonas_phage	44.2	1.2e-39
AXX40370.1|939446_940202_-|tail	phage tail protein	tail	A0A0R6PIM4	Moraxella_phage	56.6	2.1e-85
AXX40371.1|940208_941018_-|tail	phage minor tail protein L	tail	A0A0R6PIJ5	Moraxella_phage	63.2	3.6e-91
AXX40372.1|941004_942147_-|tail	phage tail protein	tail	A0A0N7IRE5	Acinetobacter_phage	96.5	2.0e-135
AXX40373.1|942201_942543_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXX40374.1|942619_946303_-	replication protein	NA	D4FUM0	Pseudomonas_phage	31.5	6.3e-42
AXX40375.1|946508_947444_-	hypothetical protein	NA	A0A0N7IRE6	Acinetobacter_phage	67.7	4.9e-116
AXX40376.1|947521_947737_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40377.1|947772_948288_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40378.1|948287_948761_-	structural protein 3 family protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	59.2	2.5e-52
AXX40379.1|948837_949209_-	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	47.1	1.2e-20
AXX40380.1|949208_949694_-	hypothetical protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	44.0	1.4e-26
AXX40381.1|949697_950054_-|head,tail	head-tail adaptor protein	head,tail	A0A1J0GUY4	Halomonas_phage	50.0	1.2e-19
AXX40382.1|950055_950343_-	hypothetical protein	NA	A0A2H4J711	uncultured_Caudovirales_phage	47.5	1.1e-18
AXX40383.1|950563_951736_-|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	47.2	9.2e-88
AXX40384.1|951728_952391_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	62.3	6.2e-73
AXX40385.1|952383_953610_-|portal	phage portal protein	portal	A0A2H4J6S3	uncultured_Caudovirales_phage	75.9	8.8e-182
AXX40386.1|953606_955298_-|terminase	terminase large subunit	terminase	A0A2H4J559	uncultured_Caudovirales_phage	81.5	2.0e-269
AXX40387.1|955301_955784_-	hypothetical protein	NA	A0A2H4J8R0	uncultured_Caudovirales_phage	44.1	1.7e-24
AXX40388.1|955975_956179_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40389.1|956175_956475_-	HNH endonuclease	NA	A0A0R6PH58	Moraxella_phage	58.8	3.2e-21
AXX40390.1|956404_956695_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40391.1|956700_956925_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40392.1|956914_957445_-	hypothetical protein	NA	A0A2H4JB76	uncultured_Caudovirales_phage	44.0	5.7e-37
AXX40393.1|958694_959591_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40394.1|959656_960151_-	hypothetical protein	NA	A0A0P0I4C3	Acinetobacter_phage	35.5	2.9e-19
AXX40395.1|960147_960471_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40396.1|960467_960746_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40397.1|960742_962074_-	DNA helicase	NA	A0A0P0IVX0	Acinetobacter_phage	55.0	3.7e-125
AXX40398.1|962073_962940_-	DUF1376 domain-containing protein	NA	A0A2I7RGZ2	Vibrio_phage	58.6	1.9e-29
AXX40399.1|962939_963236_-	hypothetical protein	NA	NA	NA	NA	NA
AXX43277.1|963294_963480_-	hypothetical protein	NA	A0A2H4JCB6	uncultured_Caudovirales_phage	52.6	6.6e-09
AXX43276.1|963608_964301_+	peptidase	NA	A0A0P0J076	Acinetobacter_phage	48.3	7.4e-53
AXX40400.1|964550_965282_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40401.1|965284_965764_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40402.1|965747_965984_+	hypothetical protein	NA	A0A2H4J515	uncultured_Caudovirales_phage	40.3	4.2e-08
AXX40403.1|965986_966460_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40404.1|966464_966833_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40405.1|967597_967885_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40406.1|967881_968133_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40407.1|968098_969058_-|integrase	integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	35.4	7.6e-48
AXX40408.1|969234_970377_-	cell division protein ZapE	NA	NA	NA	NA	NA
969195:969216	attR	AAAAAGCGCTCAATTTAGAGCG	NA	NA	NA	NA
AXX43278.1|970460_971438_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXX40409.1|971601_973149_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXX40410.1|973389_974415_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
AXX40411.1|975196_975895_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AXX40412.1|976061_976427_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
AXX40413.1|976451_976754_-	integration host factor subunit beta	NA	B5TA87	Burkholderia_phage	42.9	5.6e-13
AXX40414.1|976910_978584_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AXX40415.1|978688_979375_-	cytidylate kinase	NA	NA	NA	NA	NA
AXX40416.1|979382_979826_-	SRPBCC family protein	NA	NA	NA	NA	NA
AXX40417.1|979895_980399_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	31.3	2.9e-06
AXX40418.1|980405_981530_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
AXX40419.1|981526_982240_-	uracil-DNA glycosylase	NA	A0A0B4Q626	Equid_gammaherpesvirus	47.6	1.1e-51
>prophage 46
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	990277	994797	4119128		Bacillus_phage(33.33%)	5	NA	NA
AXX40431.1|990277_992005_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.4	6.6e-58
AXX40432.1|992001_992430_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXX40433.1|992445_993081_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
AXX40434.1|993130_994018_-	chromosome partitioning protein	NA	I3NLC2	Bifidobacterium_phage	31.6	7.4e-13
AXX40435.1|994014_994797_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	26.7	3.3e-17
>prophage 47
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1011167	1017700	4119128		Bacillus_phage(33.33%)	6	NA	NA
AXX40452.1|1011167_1013015_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	9.0e-29
AXX40453.1|1013014_1013455_+	dehydratase	NA	NA	NA	NA	NA
AXX40454.1|1013563_1014589_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXX40455.1|1014627_1015002_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
AXX40456.1|1015096_1015804_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	43.5	2.7e-34
AXX40457.1|1016209_1017700_+	sodium/proline symporter PutP	NA	A0A240F3J2	Aeromonas_phage	23.7	2.4e-08
>prophage 48
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1029727	1030894	4119128		Staphylococcus_phage(100.0%)	1	NA	NA
AXX40468.1|1029727_1030894_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	61.6	1.4e-125
>prophage 49
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1052261	1053494	4119128	integrase	Moraxella_phage(100.0%)	1	1045511:1045525	1053926:1053940
1045511:1045525	attL	CAAAATTTAGCTTAA	NA	NA	NA	NA
AXX40491.1|1052261_1053494_-|integrase	integrase	integrase	A0A0R6PHM8	Moraxella_phage	42.4	7.9e-82
AXX40491.1|1052261_1053494_-|integrase	integrase	integrase	A0A0R6PHM8	Moraxella_phage	42.4	7.9e-82
1053926:1053940	attR	TTAAGCTAAATTTTG	NA	NA	NA	NA
>prophage 50
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1059481	1060225	4119128		Planktothrix_phage(100.0%)	1	NA	NA
AXX40498.1|1059481_1060225_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	8.0e-29
>prophage 51
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1069976	1071053	4119128		Planktothrix_phage(100.0%)	1	NA	NA
AXX40508.1|1069976_1071053_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	8.3e-35
>prophage 52
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1083801	1084287	4119128		Fowlpox_virus(100.0%)	1	NA	NA
AXX40521.1|1083801_1084287_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	39.6	3.0e-24
>prophage 53
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1090114	1093678	4119128		Streptomyces_phage(100.0%)	1	NA	NA
AXX40526.1|1090114_1093678_+	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	34.6	4.0e-174
>prophage 54
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1098561	1100127	4119128		Lactococcus_phage(100.0%)	1	NA	NA
AXX40530.1|1098561_1100127_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.8	1.3e-25
>prophage 55
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1103618	1104461	4119128		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
AXX40535.1|1103618_1103948_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.2	4.5e-24
AXX40536.1|1104032_1104461_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	60.6	3.1e-41
>prophage 56
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1141301	1142792	4119128		Streptococcus_phage(100.0%)	1	NA	NA
AXX40572.1|1141301_1142792_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	30.2	8.6e-22
>prophage 57
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1150359	1153228	4119128		Tupanvirus(50.0%)	2	NA	NA
AXX40581.1|1150359_1151292_+	hypothetical protein	NA	A0A2K9L2D2	Tupanvirus	35.7	2.2e-44
AXX40582.1|1151266_1153228_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.5	4.2e-93
>prophage 58
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1157646	1164828	4119128		Planktothrix_phage(50.0%)	7	NA	NA
AXX40588.1|1157646_1158378_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.5	5.6e-35
AXX40589.1|1158380_1159046_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXX43284.1|1159035_1159671_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXX40590.1|1159759_1159912_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40591.1|1159979_1160264_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXX40592.1|1160407_1161367_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXX40593.1|1161363_1164828_-	hybrid sensor histidine kinase/response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.7	1.7e-33
>prophage 59
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1167991	1178546	4119128		uncultured_Caudovirales_phage(20.0%)	12	NA	NA
AXX40597.1|1167991_1168603_-	DNA polymerase V	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.4	4.9e-48
AXX40598.1|1168885_1169122_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40599.1|1169182_1170418_-	stress-induced protein	NA	NA	NA	NA	NA
AXX40600.1|1170902_1171316_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40601.1|1171457_1172336_+	NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	42.1	2.2e-54
AXX40602.1|1172390_1174535_-	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	47.1	5.2e-137
AXX40603.1|1174589_1175999_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
AXX40604.1|1176314_1176794_+	damage-inducible protein CinA	NA	A0A218MNG4	uncultured_virus	50.3	3.1e-34
AXX40605.1|1177079_1177301_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40606.1|1177406_1177724_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40607.1|1177808_1178030_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40608.1|1178117_1178546_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.8	2.1e-26
>prophage 60
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1184776	1193861	4119128		Staphylococcus_phage(33.33%)	7	NA	NA
AXX40613.1|1184776_1186471_-	fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	1.0e-26
AXX43286.1|1186582_1187176_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXX40614.1|1187344_1188517_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXX40615.1|1188541_1190143_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	69.4	3.9e-20
AXX40616.1|1190152_1190956_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AXX40617.1|1190967_1192959_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
AXX40618.1|1192955_1193861_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	39.6	1.8e-46
>prophage 61
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1209959	1210721	4119128		Bacillus_phage(100.0%)	1	NA	NA
AXX40631.1|1209959_1210721_+	3-oxoacyl-ACP reductase FabG	NA	W8CYX9	Bacillus_phage	45.2	3.2e-09
>prophage 62
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1214597	1215530	4119128	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
AXX40634.1|1214597_1215530_-|transposase	IS5 family transposase ISAba13	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
>prophage 63
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1219045	1220878	4119128		Pelagibacter_phage(100.0%)	1	NA	NA
AXX40637.1|1219045_1220878_+	hypothetical protein	NA	M1ICZ5	Pelagibacter_phage	29.5	1.3e-51
>prophage 64
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1234508	1235711	4119128		Bacillus_virus(100.0%)	1	NA	NA
AXX40649.1|1234508_1235711_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	7.1e-27
>prophage 65
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1295521	1363507	4119128	transposase,plate	Enterobacteria_phage(18.18%)	55	NA	NA
AXX40706.1|1295521_1296004_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	39.8	2.4e-18
AXX43289.1|1296019_1296667_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40707.1|1296839_1297691_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXX40708.1|1297693_1298647_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A0H4TGB9	Bacillus_phage	33.3	2.8e-10
AXX40709.1|1298654_1299257_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40710.1|1299269_1300076_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40711.1|1300093_1301458_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXX40712.1|1301474_1302569_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AXX40713.1|1302592_1305274_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.7	1.7e-81
AXX40714.1|1305493_1305757_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AXX40715.1|1305773_1306541_-	OmpA family protein	NA	NA	NA	NA	NA
AXX40716.1|1306543_1307503_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
AXX40717.1|1307540_1311365_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AXX40718.1|1311395_1312808_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40719.1|1312804_1313803_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXX40720.1|1313766_1315578_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXX40721.1|1315594_1316071_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXX40722.1|1316150_1316654_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AXX40723.1|1316703_1318185_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AXX40724.1|1318697_1319390_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40725.1|1320478_1320880_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40726.1|1320975_1321920_+	ABC transporter permease	NA	NA	NA	NA	NA
AXX40727.1|1321919_1322801_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	5.0e-38
AXX40728.1|1322852_1323875_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXX40729.1|1323871_1325683_-	allophanate hydrolase	NA	NA	NA	NA	NA
AXX40730.1|1325695_1326130_-	transcriptional regulator	NA	NA	NA	NA	NA
AXX40731.1|1326134_1326260_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40732.1|1326451_1326805_-	transcriptional regulator	NA	NA	NA	NA	NA
AXX40733.1|1326898_1327435_+	flavodoxin	NA	NA	NA	NA	NA
AXX40734.1|1327474_1331080_-	urea carboxylase	NA	NA	NA	NA	NA
AXX40735.1|1331082_1331736_-	urea carboxylase	NA	NA	NA	NA	NA
AXX40736.1|1331751_1332492_-	urea carboxylase	NA	NA	NA	NA	NA
AXX40737.1|1332805_1333969_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.7	5.3e-11
AXX40738.1|1334221_1334653_+	SRPBCC family protein	NA	NA	NA	NA	NA
AXX40739.1|1334713_1335274_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXX40740.1|1335916_1336501_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40741.1|1337580_1338801_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	29.6	1.4e-33
AXX40742.1|1339103_1340822_-	acetyl/propionyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
AXX40743.1|1340821_1342405_-	allophanate hydrolase	NA	NA	NA	NA	NA
AXX40744.1|1342437_1343244_-	DUF1445 domain-containing protein	NA	NA	NA	NA	NA
AXX40745.1|1343255_1344020_-	LamB/YcsF family protein	NA	NA	NA	NA	NA
AXX40746.1|1344054_1345308_-	divalent metal cation transporter	NA	NA	NA	NA	NA
AXX40747.1|1345653_1346565_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXX43290.1|1346848_1347157_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40748.1|1347434_1348367_+|transposase	IS5 family transposase ISAba13	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
AXX40749.1|1348704_1349034_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40750.1|1349402_1349690_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40751.1|1350048_1350300_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40752.1|1351022_1351454_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40753.1|1351525_1352458_+|transposase	IS5 family transposase ISAba13	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
AXX40754.1|1352425_1357408_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	56.0	1.1e-52
AXX40755.1|1357427_1360610_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	63.8	2.2e-256
AXX40756.1|1361232_1362480_+	serine hydrolase	NA	NA	NA	NA	NA
AXX40757.1|1362525_1362954_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXX40758.1|1363048_1363507_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.1	6.9e-31
>prophage 66
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1375078	1376011	4119128		Morganella_phage(100.0%)	1	NA	NA
AXX40772.1|1375078_1376011_-	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	34.7	1.0e-41
>prophage 67
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1379719	1448350	4119128	terminase,transposase,tRNA,integrase,head,tail	Acinetobacter_phage(34.21%)	76	1397876:1397929	1440065:1440118
AXX40776.1|1379719_1382365_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.9	1.5e-32
AXX43292.1|1382429_1382960_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXX40777.1|1383305_1383629_+	ferredoxin family protein	NA	NA	NA	NA	NA
AXX40778.1|1383809_1384481_+	peptidase M15	NA	NA	NA	NA	NA
AXX40779.1|1384620_1385289_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	43.3	3.3e-26
AXX40780.1|1385405_1386248_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	2.6e-36
AXX40781.1|1386403_1387015_-	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	54.0	3.6e-11
AXX40782.1|1387007_1387607_-	hypothetical protein	NA	A0A1X9I5T8	Streptococcus_phage	36.6	3.8e-21
AXX40783.1|1387699_1388890_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXX40784.1|1388886_1391028_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.7	2.7e-29
AXX40785.1|1391024_1392491_-	RND transporter	NA	NA	NA	NA	NA
AXX40786.1|1392765_1393512_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
AXX40787.1|1393511_1394060_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AXX40788.1|1394043_1394592_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AXX40789.1|1394629_1395169_-	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	NA	NA	NA	NA
AXX40790.1|1395172_1396150_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	5.6e-38
AXX40791.1|1396363_1397785_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.8	1.5e-55
1397876:1397929	attL	AACCTTGCCAAGGTTGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCAAAATT	NA	NA	NA	NA
AXX40792.1|1398138_1399152_+|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	40.6	2.9e-66
AXX40793.1|1399180_1399378_-	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	71.1	6.8e-12
AXX40794.1|1399515_1400133_-	lysozyme	NA	A0A075DXC6	Acinetobacter_phage	63.5	3.9e-69
AXX40795.1|1400143_1400515_-	hypothetical protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	62.6	2.0e-36
AXX40796.1|1400620_1400845_-	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	83.6	1.3e-27
AXX43293.1|1400846_1403132_-|tail	phage tail protein	tail	A0A0P0IRG3	Acinetobacter_phage	94.7	0.0e+00
AXX40797.1|1403225_1410044_-	GNAT family N-acetyltransferase	NA	Q775D4	Bordetella_phage	24.2	1.3e-104
AXX40798.1|1410132_1410351_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40799.1|1410363_1410813_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40800.1|1410813_1411212_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40801.1|1411213_1413463_-	transglycosylase	NA	NA	NA	NA	NA
AXX40802.1|1413463_1414132_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40803.1|1414128_1414599_-	DUF2833 domain-containing protein	NA	NA	NA	NA	NA
AXX40804.1|1414595_1416611_-	hypothetical protein	NA	Q775D1	Bordetella_phage	38.8	7.5e-130
AXX40805.1|1416611_1417166_-	hypothetical protein	NA	W6MVD9	Pseudomonas_phage	26.2	2.4e-06
AXX40806.1|1417171_1417459_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40807.1|1417470_1417875_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40808.1|1417888_1418911_-	hypothetical protein	NA	Q775C7	Bordetella_phage	50.3	5.6e-89
AXX40809.1|1418922_1419588_-	hypothetical protein	NA	A0A2I7RHR0	Vibrio_phage	35.6	1.0e-11
AXX40810.1|1419553_1419886_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40811.1|1419882_1421574_-|head,tail	phage head-tail adapter protein	head,tail	G9L6C2	Escherichia_phage	31.2	1.6e-69
AXX40812.1|1421575_1421860_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40813.1|1421937_1423560_-|terminase	terminase	terminase	Q775B9	Bordetella_phage	60.3	4.9e-188
AXX40814.1|1423543_1423816_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40815.1|1423812_1424451_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40816.1|1424443_1425193_-|terminase	terminase small subunit	terminase	A0A1Y0SUQ3	Pseudomonas_phage	45.4	3.1e-44
AXX40817.1|1425192_1425402_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40818.1|1425413_1425842_-	hypothetical protein	NA	A0A0P0HSP6	Acinetobacter_phage	88.5	7.1e-62
AXX40819.1|1425834_1426587_-	DNA replication protein	NA	A0A0D4DBZ2	Acinetobacter_phage	51.7	1.2e-59
AXX40820.1|1426583_1427468_-	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
AXX40821.1|1427464_1428292_-	DNA methyltransferase	NA	Q5QF26	Pseudomonas_virus	44.7	3.6e-62
AXX40822.1|1428288_1428660_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40823.1|1428656_1430192_-	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	52.0	4.5e-135
AXX40824.1|1430188_1430767_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40825.1|1430763_1430985_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40826.1|1431003_1431336_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40827.1|1431287_1431593_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40828.1|1431708_1432527_+	peptidase S24	NA	A0A0P0I8E0	Acinetobacter_phage	54.6	3.7e-51
AXX40829.1|1432688_1433063_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40830.1|1433131_1434013_+	DUF2303 domain-containing protein	NA	I6NVL7	Burkholderia_virus	35.0	2.5e-29
AXX40831.1|1434142_1434715_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40832.1|1434716_1435697_+	recombinase	NA	A0A0A7RWR9	Clostridium_phage	35.7	1.1e-49
AXX40833.1|1435708_1436641_+	transcriptional regulator	NA	A0A2H4J6I3	uncultured_Caudovirales_phage	64.8	6.5e-52
AXX40834.1|1436712_1438194_+	ATP-dependent helicase	NA	A0A075DXT4	Acinetobacter_phage	34.4	3.0e-67
AXX40835.1|1438190_1438424_+	protein ninH	NA	NA	NA	NA	NA
AXX40836.1|1438420_1438858_+	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	94.9	4.7e-45
AXX40837.1|1438854_1439064_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	92.8	2.4e-31
AXX40838.1|1439310_1439607_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40839.1|1439630_1439918_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40840.1|1440473_1441103_-	hypothetical protein	NA	NA	NA	NA	NA
1440065:1440118	attR	AACCTTGCCAAGGTTGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCAAAATT	NA	NA	NA	NA
AXX40841.1|1441156_1442089_-|transposase	IS5 family transposase ISAba13	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
AXX40842.1|1442535_1443129_-	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
AXX40843.1|1443651_1443855_-	peptidoglycan-binding protein	NA	A0A0N7IRF5	Acinetobacter_phage	89.6	5.0e-18
AXX43294.1|1443868_1444135_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40844.1|1444284_1444731_-	transcriptional regulator	NA	NA	NA	NA	NA
AXX40845.1|1444842_1446057_+	MFS transporter	NA	NA	NA	NA	NA
AXX40846.1|1446051_1447158_-|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	66.9	9.1e-146
AXX40847.1|1447255_1447600_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40848.1|1447891_1448350_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.1	6.0e-27
>prophage 68
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1451617	1464287	4119128	transposase	Acinetobacter_phage(57.14%)	17	NA	NA
AXX40853.1|1451617_1451833_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.0	7.7e-17
AXX40854.1|1452343_1452961_+	LysE family translocator	NA	NA	NA	NA	NA
AXX40855.1|1453027_1453573_-	hypothetical protein	NA	A0A0N7IRF5	Acinetobacter_phage	73.5	3.5e-74
AXX40856.1|1453610_1454000_-	hypothetical protein	NA	A0A0P0IVR6	Acinetobacter_phage	74.4	1.4e-48
AXX40857.1|1454167_1454365_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40858.1|1454600_1455272_+	peptidase S24	NA	A0A1B1P9J5	Acinetobacter_phage	56.6	1.4e-64
AXX40859.1|1455423_1455657_-|transposase	transposase	transposase	NA	NA	NA	NA
AXX40860.1|1456162_1457425_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	23.2	3.3e-14
AXX40861.1|1457417_1457612_+	exodeoxyribonuclease VII	NA	NA	NA	NA	NA
AXX40862.1|1457836_1458061_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40863.1|1458111_1458705_-	multidrug transporter MatE	NA	NA	NA	NA	NA
AXX40864.1|1458936_1459119_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40865.1|1459145_1459475_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	63.8	3.1e-33
AXX40866.1|1459954_1460311_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AXX40867.1|1460903_1461311_-	aldehyde-activating protein	NA	NA	NA	NA	NA
AXX40868.1|1461338_1461740_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AXX40869.1|1461815_1464287_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.6	1.1e-95
>prophage 69
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1479258	1491142	4119128		Salmonella_phage(33.33%)	9	NA	NA
AXX40884.1|1479258_1480617_+	aromatic acid/H+ symport family MFS transporter	NA	S4TR35	Salmonella_phage	29.0	4.6e-06
AXX40885.1|1480661_1481924_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
AXX40886.1|1482024_1483131_-	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AXX40887.1|1483225_1487083_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.1	6.4e-45
AXX40888.1|1487435_1487999_+	peroxiredoxin	NA	NA	NA	NA	NA
AXX40889.1|1488191_1488407_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
AXX40890.1|1488471_1489059_-	DUF1442 domain-containing protein	NA	NA	NA	NA	NA
AXX40891.1|1489095_1489314_-	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
AXX43295.1|1489576_1491142_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.8	1.3e-25
>prophage 70
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1505034	1509267	4119128		uncultured_virus(33.33%)	3	NA	NA
AXX40904.1|1505034_1505523_+	CinA family protein	NA	A0A218MNG4	uncultured_virus	43.3	4.0e-29
AXX40905.1|1505580_1508160_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.4	1.3e-123
AXX40906.1|1508460_1509267_+	M23 family peptidase	NA	G9BW84	Planktothrix_phage	36.6	1.8e-18
>prophage 71
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1513954	1584409	4119128	terminase,capsid,tRNA,integrase,head,tail	Acinetobacter_phage(89.04%)	86	1508446:1508462	1532956:1532972
1508446:1508462	attL	TTTTTGAAATTAAAAAT	NA	NA	NA	NA
AXX40913.1|1513954_1515274_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.0	4.8e-69
AXX40914.1|1515338_1516505_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
AXX40915.1|1516780_1517806_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AXX40916.1|1518075_1520712_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
AXX40917.1|1520998_1522204_+|integrase	integrase	integrase	A0A0R6PDI8	Moraxella_phage	51.1	5.9e-106
AXX40918.1|1522516_1523269_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40919.1|1523382_1524027_+	DUF159 family protein	NA	A0A218MNF5	uncultured_virus	49.3	4.6e-57
AXX40920.1|1524142_1524637_+	DNA polymerase V	NA	A0A2H4J538	uncultured_Caudovirales_phage	59.6	4.1e-45
AXX40921.1|1524640_1525939_+	DNA polymerase V subunit UmuC	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	62.9	2.3e-164
AXX40922.1|1525977_1526394_+	hypothetical protein	NA	NA	NA	NA	NA
AXX40923.1|1526503_1527049_-	hypothetical protein	NA	A0A0N7IRE7	Acinetobacter_phage	93.4	2.1e-95
AXX40924.1|1527091_1527481_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	8.6e-67
AXX40925.1|1527549_1530975_-	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	93.2	0.0e+00
AXX40926.1|1530967_1531330_-	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	6.2e-51
AXX40927.1|1531326_1531833_-	hypothetical protein	NA	J7HXQ5	Acinetobacter_phage	97.6	1.5e-90
AXX40928.1|1531832_1532231_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.0	1.2e-71
AXX40929.1|1532295_1532688_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40930.1|1532691_1533444_-	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	34.8	8.4e-34
1532956:1532972	attR	ATTTTTAATTTCAAAAA	NA	NA	NA	NA
AXX40931.1|1533518_1537817_-	tape measure domain-containing protein	NA	A0A0D4DC37	Acinetobacter_phage	77.6	0.0e+00
AXX40932.1|1537879_1538206_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40933.1|1538277_1538961_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40934.1|1538993_1539317_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AXX40935.1|1539325_1539502_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	57.7	6.3e-09
AXX40936.1|1539600_1540005_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
AXX40937.1|1540097_1540280_-	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
AXX43296.1|1540348_1540678_-	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	59.0	1.3e-26
AXX40938.1|1540605_1541121_-	hypothetical protein	NA	A0A0P0J095	Acinetobacter_phage	99.3	6.3e-73
AXX40939.1|1541190_1542108_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	97.7	1.0e-166
AXX40940.1|1542204_1543356_-|tail	phage tail protein	tail	A0A0N7IRE5	Acinetobacter_phage	45.6	9.7e-74
AXX40941.1|1543355_1543709_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	99.1	3.5e-59
AXX40942.1|1543777_1544176_-	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	95.5	5.5e-69
AXX43297.1|1544177_1544546_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	83.6	1.6e-54
AXX40943.1|1544517_1544925_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.1	9.1e-51
AXX40944.1|1545140_1545815_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40945.1|1545852_1546221_-	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	98.4	6.5e-64
AXX40946.1|1546222_1546612_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	100.0	6.6e-67
AXX40947.1|1546616_1547282_-	stress-responsive nuclear envelope protein	NA	A0A0D4DBW4	Acinetobacter_phage	69.7	1.4e-72
AXX40948.1|1547348_1548305_-|capsid	phage capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	99.7	6.0e-178
AXX40949.1|1548332_1549100_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
AXX40950.1|1549213_1549528_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	49.0	1.8e-14
AXX40951.1|1549580_1549805_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40952.1|1549817_1550048_-	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	62.0	3.7e-17
AXX40953.1|1550146_1550575_-	hypothetical protein	NA	A0A0D4DBV9	Acinetobacter_phage	98.6	1.3e-71
AXX40954.1|1550584_1551688_-|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	88.6	2.1e-187
AXX40955.1|1551698_1553141_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	89.6	8.3e-256
AXX40956.1|1553137_1554565_-|terminase	terminase	terminase	J7I460	Acinetobacter_phage	95.1	2.7e-259
AXX40957.1|1554554_1555025_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
AXX40958.1|1555083_1555725_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	100.0	9.4e-127
AXX40959.1|1555693_1556128_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	95.1	5.1e-76
AXX40960.1|1556223_1556982_-	hypothetical protein	NA	A0A0P0J0C5	Acinetobacter_phage	75.8	3.6e-109
AXX40961.1|1557147_1557360_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40962.1|1557532_1558285_-	hypothetical protein	NA	A0A0P0J081	Acinetobacter_phage	92.8	9.0e-129
AXX40963.1|1558295_1558697_-	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	96.2	1.1e-67
AXX40964.1|1558696_1559020_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40965.1|1559009_1559216_-	hypothetical protein	NA	NA	NA	NA	NA
AXX40966.1|1559333_1560083_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	96.4	2.7e-133
AXX40967.1|1560075_1561005_-	DUF1376 domain-containing protein	NA	A0A0P0I481	Acinetobacter_phage	100.0	4.3e-173
AXX40968.1|1560997_1561360_-	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	99.1	2.4e-55
AXX40969.1|1561356_1561653_-	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	95.9	1.7e-46
AXX40970.1|1561649_1561922_-	hypothetical protein	NA	A0A0D4DCC3	Acinetobacter_phage	92.2	1.4e-36
AXX40971.1|1561969_1562236_-	hypothetical protein	NA	A0A0D4DBY7	Acinetobacter_phage	100.0	1.6e-43
AXX40972.1|1562272_1562503_-	hypothetical protein	NA	A0A0D4DBS7	Acinetobacter_phage	100.0	6.1e-36
AXX40973.1|1562629_1563355_+	hypothetical protein	NA	A0A0D4DBI5	Acinetobacter_phage	100.0	1.8e-134
AXX40974.1|1563394_1563694_+	hypothetical protein	NA	A0A0D4DCL0	Acinetobacter_phage	100.0	1.5e-47
AXX40975.1|1563733_1564024_+	hypothetical protein	NA	A0A0D4DCB9	Acinetobacter_phage	100.0	7.9e-49
AXX40976.1|1564081_1564297_+	KTSC domain-containing protein	NA	A0A0D4DBY2	Acinetobacter_phage	100.0	5.0e-32
AXX40977.1|1564347_1564638_+	hypothetical protein	NA	A0A0D4DBS2	Acinetobacter_phage	100.0	1.5e-44
AXX40978.1|1565129_1565570_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	95.2	1.2e-72
AXX40979.1|1565572_1565896_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	96.3	9.7e-56
AXX40980.1|1565906_1567028_+	AAA family ATPase	NA	A0A0N7IRE0	Acinetobacter_phage	100.0	5.2e-213
AXX40981.1|1567024_1568101_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	75.7	7.8e-142
AXX40982.1|1568102_1568348_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	97.5	1.6e-39
AXX40983.1|1568351_1568801_+	DUF551 domain-containing protein	NA	A0A0P0HSE1	Acinetobacter_phage	93.1	6.0e-80
AXX40984.1|1568797_1569007_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	92.8	4.1e-31
AXX40985.1|1569003_1569219_+	hypothetical protein	NA	I2GUB6	Acinetobacter_phage	94.3	3.8e-32
AXX40986.1|1569219_1569489_+	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	98.9	9.6e-41
AXX40987.1|1569603_1570188_+	type 1 glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	1.7e-111
AXX40988.1|1570283_1573049_-	aminopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	98.6	0.0e+00
AXX40989.1|1573062_1575795_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	97.8	0.0e+00
AXX43298.1|1576150_1577200_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	99.7	1.1e-188
AXX40990.1|1577209_1578016_+	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	99.3	3.9e-146
AXX40991.1|1578025_1578721_+	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
AXX40992.1|1578731_1579715_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	93.3	5.6e-179
AXX40993.1|1579721_1582097_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	98.6	0.0e+00
AXX40994.1|1582098_1583598_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	96.4	1.2e-276
AXX40995.1|1583854_1584409_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	2.7e-98
>prophage 72
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1595952	1600552	4119128		Bacillus_phage(33.33%)	4	NA	NA
AXX41006.1|1595952_1597548_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	45.5	4.0e-25
AXX43299.1|1597544_1599128_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.2e-12
AXX41007.1|1599147_1599303_-	hypothetical protein	NA	NA	NA	NA	NA
AXX41008.1|1599400_1600552_-	histidine decarboxylase	NA	A7J7V4	Paramecium_bursaria_Chlorella_virus	33.7	8.0e-52
>prophage 73
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1611054	1618290	4119128		Brazilian_cedratvirus(33.33%)	5	NA	NA
AXX41014.1|1611054_1611825_-	siderophore ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.0	2.5e-17
AXX41015.1|1611821_1612769_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AXX41016.1|1612768_1613719_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	41.2	1.9e-62
AXX43301.1|1614341_1616372_+	acinetobactin biosynthesis protein	NA	NA	NA	NA	NA
AXX41017.1|1616442_1618290_-	peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.5	8.9e-37
>prophage 74
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1642073	1646105	4119128		Xanthomonas_phage(33.33%)	5	NA	NA
AXX41036.1|1642073_1642904_-	peptidoglycan-binding protein	NA	A0A292GJG6	Xanthomonas_phage	45.7	7.6e-12
AXX41037.1|1643018_1643786_-	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	45.3	2.0e-54
AXX41038.1|1643888_1644260_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41039.1|1644407_1644830_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41040.1|1644956_1646105_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	36.8	1.0e-62
>prophage 75
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1649298	1650687	4119128		Bodo_saltans_virus(100.0%)	1	NA	NA
AXX41045.1|1649298_1650687_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.2	9.5e-100
>prophage 76
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1653922	1663551	4119128	protease	Bodo_saltans_virus(25.0%)	7	NA	NA
AXX41048.1|1653922_1654885_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	27.8	5.9e-24
AXX41049.1|1655032_1655935_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	8.0e-15
AXX41050.1|1655948_1657319_-	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AXX41051.1|1657342_1658722_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AXX41052.1|1658822_1659854_-	phosphonate ABC transporter substrate-binding protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	39.2	5.0e-61
AXX41053.1|1660309_1661689_-	aromatic amino acid transporter AroP	NA	NA	NA	NA	NA
AXX41054.1|1661829_1663551_-	pyruvate decarboxylase	NA	E5EQ70	Micromonas_sp._RCC1109_virus	24.1	3.5e-27
>prophage 77
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1667484	1668858	4119128		Klosneuvirus(100.0%)	1	NA	NA
AXX41058.1|1667484_1668858_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.7	2.2e-24
>prophage 78
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1675585	1678423	4119128		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AXX41066.1|1675585_1678423_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	4.3e-22
>prophage 79
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1685398	1688161	4119128		Tupanvirus(100.0%)	1	NA	NA
AXX41075.1|1685398_1688161_-	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	26.3	3.7e-18
>prophage 80
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1694347	1695604	4119128		Phage_21(100.0%)	1	NA	NA
AXX41083.1|1694347_1695604_-	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	81.5	2.4e-17
>prophage 81
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1701224	1706093	4119128		Stx2-converting_phage(50.0%)	4	NA	NA
AXX41087.1|1701224_1702544_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.1	1.7e-37
AXX41088.1|1702642_1703929_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXX41089.1|1704064_1704547_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXX41090.1|1704650_1706093_+	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	32.7	1.9e-58
>prophage 82
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1711896	1713033	4119128		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AXX41096.1|1711896_1713033_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.1	3.7e-25
>prophage 83
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1719378	1720512	4119128		Streptococcus_phage(100.0%)	1	NA	NA
AXX41101.1|1719378_1720512_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.1	1.6e-68
>prophage 84
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1726212	1729886	4119128		Tupanvirus(50.0%)	3	NA	NA
AXX41105.1|1726212_1726800_-	hypothetical protein	NA	A0A2K9L4H1	Tupanvirus	33.5	2.5e-17
AXX41106.1|1726893_1728915_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
AXX41107.1|1729094_1729886_+	hypothetical protein	NA	A0A127KNK1	Pseudomonas_phage	48.7	8.8e-26
>prophage 85
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1739588	1748573	4119128	protease	Streptococcus_phage(50.0%)	9	NA	NA
AXX41120.1|1739588_1740281_-	ribonuclease 3	NA	M1H9B8	Acanthocystis_turfacea_Chlorella_virus	37.0	2.6e-21
AXX41121.1|1740252_1740627_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
AXX41122.1|1740651_1741479_-	signal peptidase I	NA	NA	NA	NA	NA
AXX41123.1|1741549_1743367_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	1.7e-19
AXX41124.1|1743541_1743994_-	thioesterase	NA	NA	NA	NA	NA
AXX41125.1|1744114_1745506_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.4	4.7e-22
AXX41126.1|1745721_1747365_+	L-aspartate oxidase	NA	NA	NA	NA	NA
AXX41127.1|1747418_1747835_-	thioesterase	NA	NA	NA	NA	NA
AXX41128.1|1747973_1748573_-	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	42.1	1.5e-33
>prophage 86
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1754183	1755245	4119128		Bacillus_virus(100.0%)	1	NA	NA
AXX41135.1|1754183_1755245_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.1	9.7e-28
>prophage 87
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1758274	1769475	4119128		Bacillus_phage(16.67%)	11	NA	NA
AXX41139.1|1758274_1758985_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.7	5.7e-40
AXX41140.1|1759013_1759697_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	38.4	6.7e-30
AXX41141.1|1759710_1760127_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41142.1|1760217_1760904_+	ATPase	NA	NA	NA	NA	NA
AXX41143.1|1760921_1761383_+	peroxiredoxin	NA	NA	NA	NA	NA
AXX41144.1|1761505_1762075_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41145.1|1762145_1762778_-	nicotinamide-nucleotide adenylyltransferase	NA	A0A292GDD2	Xanthomonas_phage	36.3	1.1e-21
AXX41146.1|1762845_1763646_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AXX41147.1|1763642_1763960_-	NGG1p interacting factor NIF3	NA	A0A1E1EXH0	Acanthamoeba_castellanii_mimivirus	28.4	1.1e-11
AXX41148.1|1764353_1765559_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	28.8	4.2e-27
AXX41149.1|1765641_1769475_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.2	1.5e-107
>prophage 88
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1779957	1780929	4119128		Klosneuvirus(100.0%)	1	NA	NA
AXX43309.1|1779957_1780929_+	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	36.9	5.5e-46
>prophage 89
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1789981	1797862	4119128		Prochlorococcus_phage(20.0%)	7	NA	NA
AXX41168.1|1789981_1791052_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	47.9	6.5e-80
AXX41169.1|1791048_1791678_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.9	1.4e-26
AXX41170.1|1791741_1792551_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXX41171.1|1792569_1793586_-	signal peptide peptidase SppA	NA	A0A2I6UH21	Salinibacter_virus	26.5	5.5e-12
AXX41172.1|1793722_1794706_+	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
AXX41173.1|1794658_1797091_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	31.4	5.9e-28
AXX41174.1|1797175_1797862_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	36.2	3.4e-34
>prophage 90
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1802177	1803257	4119128		Streptococcus_phage(100.0%)	1	NA	NA
AXX41178.1|1802177_1803257_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	50.3	4.8e-91
>prophage 91
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1809535	1818746	4119128		Shigella_phage(33.33%)	7	NA	NA
AXX41184.1|1809535_1810516_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	45.9	1.2e-67
AXX41185.1|1810515_1810896_+	GtrA family protein	NA	NA	NA	NA	NA
AXX41186.1|1810905_1812552_+	dolichyl-phosphate-mannose--protein mannosyltransferase	NA	NA	NA	NA	NA
AXX41187.1|1812602_1815317_-	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	29.3	5.6e-96
AXX41188.1|1815683_1816616_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
AXX41189.1|1816633_1817383_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AXX41190.1|1817819_1818746_-	tyrosine recombinase XerC	NA	A0A2L1IV36	Escherichia_phage	32.4	2.8e-15
>prophage 92
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1826470	1828509	4119128		Tupanvirus(50.0%)	2	NA	NA
AXX41198.1|1826470_1827445_-	EF-P lysine aminoacylase GenX	NA	A0A2K9KZX5	Tupanvirus	29.0	5.8e-27
AXX41199.1|1827441_1828509_-	DUF3410 domain-containing protein	NA	M1NSB9	Streptococcus_phage	29.2	4.5e-17
>prophage 93
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1832799	1833966	4119128		Streptococcus_phage(100.0%)	1	NA	NA
AXX41203.1|1832799_1833966_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.6	1.8e-38
>prophage 94
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1843015	1848548	4119128	transposase	Tupanvirus(50.0%)	2	NA	NA
AXX41215.1|1843015_1847014_-	peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	33.3	1.5e-68
AXX41216.1|1847615_1848548_+|transposase	IS5 family transposase ISAba13	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
>prophage 95
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1852119	1854392	4119128	tRNA	Escherichia_phage(50.0%)	2	NA	NA
AXX41221.1|1852119_1853025_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.6	6.2e-92
AXX41222.1|1853528_1854392_+	transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	53.6	2.7e-36
>prophage 96
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1862417	1864401	4119128		uncultured_virus(100.0%)	2	NA	NA
AXX41229.1|1862417_1864052_-	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	60.9	8.1e-175
AXX41230.1|1864110_1864401_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	51.1	2.3e-16
>prophage 97
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1882273	1885921	4119128		Burkholderia_virus(50.0%)	4	NA	NA
AXX41237.1|1882273_1883605_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.8	3.1e-39
AXX41238.1|1883721_1884144_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41239.1|1884163_1884832_-	methyltransferase	NA	NA	NA	NA	NA
AXX41240.1|1885072_1885921_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.4	1.6e-25
>prophage 98
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1890241	1892922	4119128		Micromonas_pusilla_virus(50.0%)	2	NA	NA
AXX41244.1|1890241_1892137_-	cell division protein FtsH	NA	M4QMW8	Micromonas_pusilla_virus	46.4	1.4e-106
AXX41245.1|1892271_1892922_-	ribosomal RNA large subunit methyltransferase E	NA	A0A140HEP8	Marsac_virus	25.1	4.1e-05
>prophage 99
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1899982	1900615	4119128		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AXX41252.1|1899982_1900615_+	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	35.5	3.5e-17
>prophage 100
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1920163	1921666	4119128		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AXX41257.1|1920163_1921666_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	32.2	2.6e-18
>prophage 101
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1925388	1929041	4119128		Tupanvirus(50.0%)	3	NA	NA
AXX41261.1|1925388_1926279_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.6	2.9e-17
AXX41262.1|1926293_1927460_-	succinyl-CoA ligase subunit beta	NA	NA	NA	NA	NA
AXX41263.1|1927607_1929041_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.7	1.2e-41
>prophage 102
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1942165	1944052	4119128		Vibrio_phage(100.0%)	1	NA	NA
AXX41276.1|1942165_1944052_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.3e-38
>prophage 103
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1951861	1953133	4119128	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AXX41286.1|1951861_1953133_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.9	2.0e-96
>prophage 104
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1969009	1971889	4119128	tRNA	Klosneuvirus(100.0%)	1	NA	NA
AXX41303.1|1969009_1971889_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.5	2.8e-146
>prophage 105
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1976185	1977373	4119128		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AXX43316.1|1976185_1977373_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	36.0	3.1e-43
>prophage 106
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1987536	1988391	4119128		Pandoravirus(100.0%)	1	NA	NA
AXX41315.1|1987536_1988391_+	SPFH/Band 7/PHB domain protein	NA	S4VVY8	Pandoravirus	29.3	4.0e-08
>prophage 107
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	1993199	2004425	4119128	integrase	Acinetobacter_phage(40.0%)	13	1991675:1991687	1995090:1995102
1991675:1991687	attL	ATTGGTGGCTTAA	NA	NA	NA	NA
AXX43318.1|1993199_1994525_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.3	1.7e-58
AXX41320.1|1994612_1995332_+	hypothetical protein	NA	NA	NA	NA	NA
1995090:1995102	attR	ATTGGTGGCTTAA	NA	NA	NA	NA
AXX41321.1|1995455_1995671_+	transcriptional regulator	NA	NA	NA	NA	NA
AXX41322.1|1995673_1996336_+	DNA-binding protein	NA	A0A0K1LJZ5	Vibrio_phage	45.4	1.9e-42
AXX41323.1|1996332_1996647_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41324.1|1996643_1997198_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41325.1|1997347_1998178_+	helix-turn-helix domain-containing protein	NA	A0A190XCE7	Acinetobacter_phage	58.6	1.3e-24
AXX41326.1|1998174_1999542_+	replicative DNA helicase	NA	A0A068CDC8	Acinetobacter_phage	34.8	3.7e-72
AXX41327.1|1999538_1999952_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41328.1|2000125_2000662_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43319.1|2000854_2001286_-	hypothetical protein	NA	NA	NA	NA	NA
AXX41329.1|2001338_2001806_-	hypothetical protein	NA	NA	NA	NA	NA
AXX41330.1|2001899_2004425_-	hypothetical protein	NA	A0A193GZ61	Enterobacter_phage	32.7	2.9e-115
>prophage 108
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2040275	2049543	4119128		Bacillus_phage(40.0%)	8	NA	NA
AXX41364.1|2040275_2041697_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	8.7e-16
AXX43321.1|2041843_2042143_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43322.1|2042165_2043770_-	two-component sensor histidine kinase	NA	Q8QKV4	Ectocarpus_siliculosus_virus	23.6	9.3e-06
AXX41365.1|2043847_2044564_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.7	3.1e-38
AXX41366.1|2044560_2044767_-	hypothetical protein	NA	NA	NA	NA	NA
AXX41367.1|2045096_2047931_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	46.4	7.7e-181
AXX41368.1|2047987_2048122_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AXX41369.1|2048259_2049543_+	ribonucleotide-diphosphate reductase subunit beta	NA	M1IA80	Paramecium_bursaria_Chlorella_virus	33.4	5.4e-41
>prophage 109
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2058581	2065568	4119128		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AXX41377.1|2058581_2065568_-	hypothetical protein	NA	A0A2H4JEI4	uncultured_Caudovirales_phage	33.5	2.7e-17
>prophage 110
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2076966	2078277	4119128		Burkholderia_virus(100.0%)	1	NA	NA
AXX41387.1|2076966_2078277_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.9	1.5e-49
>prophage 111
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2094134	2094614	4119128		Streptococcus_phage(100.0%)	1	NA	NA
AXX41400.1|2094134_2094614_-	glycosyltransferase	NA	M1PFU9	Streptococcus_phage	43.9	4.5e-25
>prophage 112
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2101381	2101654	4119128		uncultured_virus(100.0%)	1	NA	NA
AXX41406.1|2101381_2101654_+	DUF2218 domain-containing protein	NA	A0A218MNG7	uncultured_virus	45.3	1.1e-07
>prophage 113
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2116086	2117442	4119128		Pandoravirus(100.0%)	1	NA	NA
AXX43327.1|2116086_2117442_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	35.9	1.8e-26
>prophage 114
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2141741	2144513	4119128		uncultured_virus(100.0%)	1	NA	NA
AXX41433.1|2141741_2144513_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.5	1.4e-65
>prophage 115
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2149952	2156388	4119128	tRNA	Streptomyces_phage(33.33%)	7	NA	NA
AXX41438.1|2149952_2150279_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	43.2	2.0e-16
AXX41439.1|2150600_2151869_+	transcription termination factor Rho	NA	NA	NA	NA	NA
AXX41440.1|2152064_2152190_-	hypothetical protein	NA	NA	NA	NA	NA
AXX41441.1|2152284_2152530_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41442.1|2152700_2152997_-	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	39.3	3.5e-12
AXX41443.1|2152993_2155375_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AXX41444.1|2155407_2156388_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.8	1.2e-35
>prophage 116
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2161614	2166134	4119128	tRNA	Agrobacterium_phage(33.33%)	3	NA	NA
AXX41452.1|2161614_2162166_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.6	1.9e-11
AXX41453.1|2162171_2164094_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	37.9	2.6e-124
AXX41454.1|2164505_2166134_+	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	26.9	8.7e-28
>prophage 117
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2170060	2171524	4119128		Bacillus_virus(100.0%)	1	NA	NA
AXX41461.1|2170060_2171524_-	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	31.1	3.5e-20
>prophage 118
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2176100	2182237	4119128		Erysipelothrix_phage(33.33%)	4	NA	NA
AXX41466.1|2176100_2177492_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.0	2.0e-28
AXX41467.1|2177501_2178320_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AXX41468.1|2178342_2179257_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.3	4.9e-52
AXX41469.1|2179429_2182237_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	29.4	2.2e-50
>prophage 119
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2195367	2196132	4119128	tRNA	Pandoravirus(100.0%)	1	NA	NA
AXX41485.1|2195367_2196132_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	S4VW33	Pandoravirus	29.6	1.5e-14
>prophage 120
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2202484	2225103	4119128	tRNA,transposase	Faecalibacterium_phage(22.22%)	17	NA	NA
AXX41491.1|2202484_2204077_-	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	32.9	1.5e-11
AXX41492.1|2204280_2205144_-	hypothetical protein	NA	NA	NA	NA	NA
AXX41493.1|2205440_2206466_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
AXX41494.1|2206566_2207346_+	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	34.3	5.8e-30
AXX41495.1|2207735_2208761_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
AXX41496.1|2208859_2209432_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXX41497.1|2209649_2210213_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXX41498.1|2210820_2212875_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	37.9	2.6e-21
AXX41499.1|2213205_2214222_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AXX41500.1|2214254_2214746_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AXX41501.1|2214745_2216470_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	5.4e-52
AXX41502.1|2216974_2217304_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AXX41503.1|2217490_2220115_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	41.4	2.0e-175
AXX41504.1|2220142_2220652_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41505.1|2220671_2221661_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AXX41506.1|2221768_2223106_+	MacA family efflux pump subunit	NA	A0A140XAI1	Dickeya_phage	50.0	9.7e-17
AXX41507.1|2223108_2225103_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.1	1.6e-36
>prophage 121
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2228416	2230950	4119128		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	4	NA	NA
AXX41510.1|2228416_2228983_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.0	2.0e-27
AXX41511.1|2229108_2230167_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
AXX41512.1|2230264_2230681_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AXX41513.1|2230692_2230950_+	glutaredoxin 3	NA	A0A248SKD6	Salicola_phage	39.7	1.2e-08
>prophage 122
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2235746	2237039	4119128	tRNA	Orpheovirus(100.0%)	1	NA	NA
AXX41519.1|2235746_2237039_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	2.4e-20
>prophage 123
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2241125	2246167	4119128	protease,tail	Powai_lake_megavirus(50.0%)	5	NA	NA
AXX41524.1|2241125_2241557_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.5	2.0e-19
AXX41525.1|2241670_2241871_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AXX41526.1|2241970_2242522_-	PAP2 family protein	NA	NA	NA	NA	NA
AXX41527.1|2242546_2243845_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AXX41528.1|2243983_2246167_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	48.7	2.0e-184
>prophage 124
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2250212	2251478	4119128		Streptococcus_phage(100.0%)	1	NA	NA
AXX41531.1|2250212_2251478_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	49.9	3.6e-98
>prophage 125
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2265452	2267473	4119128	protease	Bacillus_virus(50.0%)	2	NA	NA
AXX41541.1|2265452_2266766_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.0e-127
AXX41542.1|2266867_2267473_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.6	1.2e-62
>prophage 126
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2271799	2272492	4119128		Synechococcus_phage(100.0%)	1	NA	NA
AXX41545.1|2271799_2272492_+	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	34.2	1.3e-20
>prophage 127
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2277237	2277861	4119128		Cassava_brown_streak_virus(100.0%)	1	NA	NA
AXX41550.1|2277237_2277861_+	non-canonical purine NTP pyrophosphatase	NA	D2KCJ6	Cassava_brown_streak_virus	30.7	8.8e-13
>prophage 128
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2288176	2289573	4119128		Geobacillus_virus(50.0%)	2	NA	NA
AXX41560.1|2288176_2289019_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	61.8	7.1e-98
AXX41561.1|2289063_2289573_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	46.0	3.1e-24
>prophage 129
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2300855	2313333	4119128		Bacillus_phage(25.0%)	11	NA	NA
AXX41574.1|2300855_2302835_-	ATP-dependent DNA helicase PcrA	NA	A7KV33	Bacillus_phage	28.4	7.0e-64
AXX41575.1|2302951_2303524_-	hypothetical protein	NA	NA	NA	NA	NA
AXX41576.1|2303661_2304420_-	hypothetical protein	NA	NA	NA	NA	NA
AXX41577.1|2304507_2307144_-	DNA topoisomerase I	NA	A0A1V0SB35	Catovirus	33.5	2.0e-90
AXX41578.1|2307179_2307629_-	hypothetical protein	NA	NA	NA	NA	NA
AXX41579.1|2307776_2308154_-	HxlR family transcriptional regulator	NA	NA	NA	NA	NA
AXX41580.1|2308253_2309264_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AXX41581.1|2309311_2309557_-	SlyX protein	NA	NA	NA	NA	NA
AXX41582.1|2309589_2311500_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.1	3.7e-46
AXX41583.1|2311645_2312278_+	LysE family translocator	NA	NA	NA	NA	NA
AXX41584.1|2312397_2313333_+	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	33.0	1.0e-41
>prophage 130
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2334163	2336458	4119128		Hokovirus(100.0%)	1	NA	NA
AXX41605.1|2334163_2336458_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	29.2	4.7e-19
>prophage 131
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2360219	2366748	4119128		Ostreococcus_lucimarinus_virus(33.33%)	9	NA	NA
AXX41621.1|2360219_2361518_+	ABC transporter	NA	G9E4X0	Ostreococcus_lucimarinus_virus	31.1	2.2e-29
AXX43342.1|2361619_2361874_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AXX41622.1|2362126_2362459_+	HopJ type III effector protein	NA	NA	NA	NA	NA
AXX41623.1|2362887_2363268_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	54.2	1.4e-24
AXX41624.1|2363503_2363914_-	aldehyde-activating protein	NA	NA	NA	NA	NA
AXX41625.1|2363991_2365197_-	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
AXX41626.1|2365186_2365819_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXX41627.1|2365912_2366107_+	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
AXX41628.1|2366103_2366748_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.6	5.3e-21
>prophage 132
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2384486	2385443	4119128		Megavirus(100.0%)	1	NA	NA
AXX41645.1|2384486_2385443_+	DNA-binding protein	NA	K7YGN1	Megavirus	50.6	2.3e-12
>prophage 133
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2392169	2397710	4119128		Brevibacillus_phage(50.0%)	2	NA	NA
AXX41651.1|2392169_2393921_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	22.8	4.4e-17
AXX43343.1|2394029_2397710_-	exonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.1	9.9e-11
>prophage 134
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2406189	2411686	4119128		Ostreococcus_mediterraneus_virus(50.0%)	4	NA	NA
AXX41658.1|2406189_2407809_+	2-octaprenylphenol hydroxylase	NA	A0A0P0C0S7	Ostreococcus_mediterraneus_virus	25.9	5.4e-30
AXX41659.1|2407933_2409247_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
AXX41660.1|2409400_2410174_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
AXX41661.1|2410183_2411686_+	DNA helicase	NA	A0A075DXT4	Acinetobacter_phage	36.0	2.4e-80
>prophage 135
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2420108	2422808	4119128		Bodo_saltans_virus(100.0%)	1	NA	NA
AXX41670.1|2420108_2422808_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.4	7.2e-27
>prophage 136
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2443241	2444096	4119128		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AXX41691.1|2443241_2444096_-	cysteine methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	53.3	4.7e-17
>prophage 137
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2450016	2450931	4119128		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AXX41697.1|2450016_2450931_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.3	4.0e-38
>prophage 138
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2460966	2462886	4119128		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AXX41707.1|2460966_2462886_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	2.6e-119
>prophage 139
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2465974	2476967	4119128		uncultured_virus(33.33%)	6	NA	NA
AXX41711.1|2465974_2466847_-	alpha/beta hydrolase	NA	A0A218MNI3	uncultured_virus	30.9	7.8e-07
AXX41712.1|2466970_2467468_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AXX41713.1|2467496_2467853_-	DNA transfer protein p32	NA	NA	NA	NA	NA
AXX41714.1|2468066_2468432_-	DNA transfer protein p32	NA	NA	NA	NA	NA
AXX41715.1|2468598_2472792_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.9	1.2e-68
AXX41716.1|2472878_2476967_-	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	26.0	3.6e-22
>prophage 140
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2480939	2551999	4119128	tRNA,transposase	Staphylococcus_phage(14.29%)	67	NA	NA
AXX41723.1|2480939_2482130_-	elongation factor Tu	NA	A0A1M7XUR5	Cedratvirus	31.3	8.1e-15
AXX41724.1|2482807_2484301_-	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	30.4	3.0e-35
AXX41725.1|2484409_2485078_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AXX41726.1|2485143_2485773_-	FHA domain-containing protein	NA	NA	NA	NA	NA
AXX41727.1|2485813_2488084_-	type II secretion system protein GspD	NA	R9TEZ5	Vibrio_phage	34.9	9.0e-31
AXX41728.1|2488125_2488962_-	general secretion pathway protein	NA	NA	NA	NA	NA
AXX41729.1|2488961_2489705_-	general secretion pathway protein	NA	NA	NA	NA	NA
AXX41730.1|2490037_2490364_-	DNA-binding protein	NA	NA	NA	NA	NA
AXX41731.1|2490446_2491472_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
AXX41732.1|2491648_2492032_-	thioesterase	NA	NA	NA	NA	NA
AXX43345.1|2492096_2493209_-	hypothetical protein	NA	NA	NA	NA	NA
AXX41733.1|2493299_2494139_-	hypothetical protein	NA	NA	NA	NA	NA
AXX41734.1|2494147_2494915_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AXX41735.1|2494919_2495849_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AXX41736.1|2495937_2496678_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXX41737.1|2496738_2497878_-	alginate biosynthesis protein	NA	NA	NA	NA	NA
AXX41738.1|2497868_2499302_+	argininosuccinate lyase	NA	NA	NA	NA	NA
AXX41739.1|2499311_2499581_+	Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
AXX41740.1|2499896_2500619_-	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AXX41741.1|2500727_2502059_-	RND transporter	NA	NA	NA	NA	NA
AXX41742.1|2502154_2503060_-	EamA family transporter	NA	NA	NA	NA	NA
AXX41743.1|2503052_2503634_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXX43346.1|2503759_2504824_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41744.1|2505082_2506960_+	phosphomethylpyrimidine synthase	NA	NA	NA	NA	NA
AXX41745.1|2507035_2507662_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AXX41746.1|2507666_2508479_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
AXX41747.1|2508689_2509226_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AXX41748.1|2509228_2510161_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AXX41749.1|2510211_2511408_-	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
AXX41750.1|2511432_2512779_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AXX41751.1|2512939_2513191_-	hypothetical protein	NA	NA	NA	NA	NA
AXX41752.1|2513211_2515065_-	ferrous iron transporter B	NA	NA	NA	NA	NA
AXX43347.1|2515061_2515325_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
AXX41753.1|2515468_2516389_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	2.3e-33
AXX41754.1|2516535_2517351_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AXX41755.1|2517595_2518897_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AXX41756.1|2518952_2520092_+	threonine synthase	NA	NA	NA	NA	NA
AXX41757.1|2520199_2521207_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AXX41758.1|2521458_2522094_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXX43348.1|2522149_2523673_+	histidine kinase	NA	NA	NA	NA	NA
AXX41759.1|2523696_2525118_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXX41760.1|2525121_2526306_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	23.0	8.3e-12
AXX41761.1|2526321_2527869_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AXX41762.1|2527994_2529065_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AXX41763.1|2529064_2530165_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AXX41764.1|2530308_2531757_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	5.5e-50
AXX41765.1|2531749_2532157_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AXX41766.1|2532195_2532834_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41767.1|2532964_2533183_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41768.1|2533241_2533901_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.6	1.5e-34
AXX41769.1|2533943_2535236_-	DNA modification methylase	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.6	2.5e-38
AXX41770.1|2535232_2536318_-	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.3	1.9e-47
AXX41771.1|2536333_2536792_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AXX41772.1|2536950_2538348_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	5.4e-34
AXX41773.1|2538405_2538744_-	transcriptional regulator	NA	NA	NA	NA	NA
AXX41774.1|2539023_2539251_+	membrane fusogenic activity	NA	NA	NA	NA	NA
AXX41775.1|2539316_2540174_+	ATP-binding protein	NA	NA	NA	NA	NA
AXX41776.1|2540256_2542053_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41777.1|2542347_2543835_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.4	8.3e-219
AXX41778.1|2543847_2544699_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
AXX41779.1|2544766_2545066_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41780.1|2545138_2545510_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41781.1|2545884_2547315_-|transposase	transposase	transposase	NA	NA	NA	NA
AXX41782.1|2547307_2548423_-|transposase	transposase	transposase	NA	NA	NA	NA
AXX41783.1|2548452_2549373_-|transposase	transposase	transposase	NA	NA	NA	NA
AXX41784.1|2549377_2551288_-|transposase	transposase	transposase	NA	NA	NA	NA
AXX41785.1|2551288_2551999_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
>prophage 141
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2559239	2570345	4119128		uncultured_Caudovirales_phage(33.33%)	10	NA	NA
AXX41792.1|2559239_2559767_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.2	9.6e-61
AXX41793.1|2559894_2560305_-	hypothetical protein	NA	A0A2H4J146	uncultured_Caudovirales_phage	43.8	2.4e-14
AXX41794.1|2560399_2560783_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41795.1|2560821_2562501_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.2e-34
AXX41796.1|2562798_2565018_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.9	4.2e-81
AXX41797.1|2565171_2566491_-	MFS transporter	NA	NA	NA	NA	NA
AXX41798.1|2566573_2567218_-	hypothetical protein	NA	NA	NA	NA	NA
AXX41799.1|2567263_2567731_-	SEC-C motif-containing protein	NA	NA	NA	NA	NA
AXX41800.1|2567802_2569395_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.1	8.8e-41
AXX43349.1|2569739_2570345_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.8	2.5e-12
>prophage 142
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2575472	2577851	4119128		Pseudomonas_phage(100.0%)	1	NA	NA
AXX41806.1|2575472_2577851_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	79.2	2.8e-115
>prophage 143
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2581997	2582996	4119128		Lactococcus_phage(100.0%)	1	NA	NA
AXX41812.1|2581997_2582996_-	cysteine synthase A	NA	A0A1W6JHY1	Lactococcus_phage	52.1	1.1e-73
>prophage 144
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2594606	2598185	4119128		Synechococcus_phage(33.33%)	4	NA	NA
AXX41818.1|2594606_2595137_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.6	3.8e-17
AXX41819.1|2595259_2596414_+	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
AXX41820.1|2596434_2597571_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.5	1.4e-24
AXX41821.1|2597615_2598185_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	26.4	5.1e-07
>prophage 145
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2609465	2610254	4119128		Staphylococcus_phage(100.0%)	1	NA	NA
AXX41834.1|2609465_2610254_+	zinc ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.1	7.5e-17
>prophage 146
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2615012	2616803	4119128	tRNA	Orpheovirus(100.0%)	1	NA	NA
AXX41839.1|2615012_2616803_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	21.5	1.0e-16
>prophage 147
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2621884	2623453	4119128		Hokovirus(100.0%)	1	NA	NA
AXX41847.1|2621884_2623453_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.8	4.3e-24
>prophage 148
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2627600	2635085	4119128	transposase	Mycobacterium_phage(33.33%)	9	NA	NA
AXX41853.1|2627600_2628443_-	ParA family protein	NA	V5UP47	Mycobacterium_phage	26.1	6.5e-11
AXX41854.1|2628519_2628912_-	invasion protein expression up-regulator SirB	NA	NA	NA	NA	NA
AXX41855.1|2628923_2629232_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AXX41856.1|2629757_2630519_-	phosphopantetheine-protein transferase	NA	NA	NA	NA	NA
AXX41857.1|2630511_2631273_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXX41858.1|2631312_2632245_-|transposase	IS5 family transposase ISAba40	transposase	Q1MVF0	Enterobacteria_phage	40.8	2.5e-56
AXX41859.1|2632595_2633012_+	DUF4902 domain-containing protein	NA	NA	NA	NA	NA
AXX41860.1|2633075_2633642_+	N-acylhomoserine lactone synthase	NA	NA	NA	NA	NA
AXX43351.1|2633732_2635085_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.0	2.7e-51
>prophage 149
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2638177	2639827	4119128		Staphylococcus_phage(100.0%)	1	NA	NA
AXX41864.1|2638177_2639827_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	39.0	4.9e-79
>prophage 150
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2656855	2663432	4119128	transposase	Enterobacteria_phage(50.0%)	4	NA	NA
AXX41878.1|2656855_2657788_+|transposase	IS5 family transposase ISAba13	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
AXX41879.1|2658356_2658866_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXX41880.1|2659267_2659843_-	DUF4126 domain-containing protein	NA	NA	NA	NA	NA
AXX41881.1|2660570_2663432_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	44.3	2.5e-09
>prophage 151
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2678286	2679303	4119128		Tupanvirus(100.0%)	1	NA	NA
AXX41892.1|2678286_2679303_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	45.2	6.1e-80
>prophage 152
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2682342	2683218	4119128		Bacillus_phage(100.0%)	1	NA	NA
AXX41895.1|2682342_2683218_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	45.9	1.2e-60
>prophage 153
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2687445	2690735	4119128		Klosneuvirus(100.0%)	3	NA	NA
AXX41900.1|2687445_2688576_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	50.0	1.5e-106
AXX41901.1|2688588_2689698_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AXX41902.1|2689700_2690735_-	UDP-glucose 4-epimerase	NA	A0A1V0SJP4	Klosneuvirus	33.5	6.5e-37
>prophage 154
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2695336	2701772	4119128		Tupanvirus(33.33%)	5	NA	NA
AXX41907.1|2695336_2696377_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L4U8	Tupanvirus	47.0	3.6e-75
AXX41908.1|2696400_2697675_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	28.9	2.2e-26
AXX41909.1|2698032_2699133_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41910.1|2699137_2699566_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AXX41911.1|2699585_2701772_+	tyrosine protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	33.7	1.5e-19
>prophage 155
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2722350	2723151	4119128		Bacillus_virus(100.0%)	1	NA	NA
AXX41933.1|2722350_2723151_+	aliphatic sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.9	4.3e-28
>prophage 156
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2727117	2729955	4119128	tRNA	Tupanvirus(100.0%)	1	NA	NA
AXX41938.1|2727117_2729955_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.0	2.1e-77
>prophage 157
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2737882	2739654	4119128		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AXX41942.1|2737882_2738440_-	peptidylprolyl isomerase A	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	33.9	1.1e-14
AXX41943.1|2738583_2739654_-	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	27.3	9.8e-12
>prophage 158
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2743725	2745666	4119128		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AXX41947.1|2743725_2745666_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.3	1.3e-147
>prophage 159
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2751654	2752167	4119128		Tetraselmis_virus(100.0%)	1	NA	NA
AXX41950.1|2751654_2752167_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.9	1.0e-19
>prophage 160
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2756698	2762861	4119128		Escherichia_phage(33.33%)	6	NA	NA
AXX41955.1|2756698_2757655_+	hypothetical protein	NA	A0A1D7XFL1	Escherichia_phage	32.8	1.3e-31
AXX41956.1|2757843_2758209_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41957.1|2758230_2759391_+	glutathionylspermidine synthase family protein	NA	E5E3Y5	Acinetobacter_phage	44.5	1.2e-95
AXX41958.1|2759681_2760737_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
AXX41959.1|2760793_2762119_+	guanine deaminase	NA	NA	NA	NA	NA
AXX41960.1|2762333_2762861_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.5	3.6e-15
>prophage 161
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2768679	2779755	4119128		Staphylococcus_phage(20.0%)	10	NA	NA
AXX41967.1|2768679_2769000_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	49.4	6.3e-15
AXX41968.1|2769010_2769403_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AXX41969.1|2769432_2769567_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AXX41970.1|2770237_2771635_+	chromosomal replication initiator protein DnaA	NA	A0A1B1IPE6	uncultured_Mediterranean_phage	31.0	5.2e-05
AXX41971.1|2771732_2772881_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.6	1.0e-46
AXX41972.1|2772895_2773978_+	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AXX41973.1|2774030_2776499_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.1	7.6e-116
AXX41974.1|2776536_2776929_+	cytochrome B	NA	NA	NA	NA	NA
AXX41975.1|2777014_2777572_-	hypothetical protein	NA	NA	NA	NA	NA
AXX41976.1|2777823_2779755_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	31.3	1.6e-65
>prophage 162
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2783749	2851861	4119128	tRNA,transposase	Escherichia_phage(27.78%)	62	NA	NA
AXX41980.1|2783749_2784085_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.5	1.2e-24
AXX41981.1|2784139_2784985_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXX41982.1|2785112_2786240_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AXX41983.1|2786301_2787534_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AXX41984.1|2794519_2795245_-	hypothetical protein	NA	NA	NA	NA	NA
AXX41985.1|2795840_2797319_+	sodium-dependent transporter	NA	NA	NA	NA	NA
AXX41986.1|2797331_2797475_+	putative methionine/alanine importer small subunit	NA	NA	NA	NA	NA
AXX41987.1|2797517_2798822_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
AXX41988.1|2798818_2799781_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.1	2.9e-07
AXX41989.1|2800129_2801959_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AXX41990.1|2802272_2803562_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43360.1|2803664_2804372_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AXX41991.1|2804380_2805271_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXX41992.1|2805350_2806646_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	65.3	3.2e-150
AXX41993.1|2806946_2809631_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AXX41994.1|2809801_2810425_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXX41995.1|2810574_2811675_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXX41996.1|2811677_2814803_+	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AXX41997.1|2814942_2815320_+	hypothetical protein	NA	NA	NA	NA	NA
AXX41998.1|2815424_2816537_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.3	1.9e-29
AXX41999.1|2816651_2817002_-	hypothetical protein	NA	NA	NA	NA	NA
AXX42000.1|2817186_2818008_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AXX42001.1|2818059_2818713_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42002.1|2818752_2819943_-	MFS transporter	NA	NA	NA	NA	NA
AXX42003.1|2819947_2820751_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.3	6.0e-38
AXX42004.1|2820871_2821774_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXX42005.1|2821757_2822132_-	hypothetical protein	NA	NA	NA	NA	NA
AXX42006.1|2822139_2822262_-	hypothetical protein	NA	NA	NA	NA	NA
AXX42007.1|2822222_2823647_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AXX42008.1|2823649_2824678_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	30.7	6.5e-45
AXX42009.1|2824716_2825277_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
AXX42010.1|2825307_2825553_-	hypothetical protein	NA	NA	NA	NA	NA
AXX42011.1|2825562_2826099_-	M23 family peptidase	NA	NA	NA	NA	NA
AXX42012.1|2826146_2827181_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AXX42013.1|2827321_2827684_-	HIT family protein	NA	NA	NA	NA	NA
AXX42014.1|2827869_2828607_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
AXX42015.1|2828778_2828937_-	DUF1328 domain-containing protein	NA	A0A0R6PJ30	Moraxella_phage	60.8	6.2e-08
AXX42016.1|2829131_2829590_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
AXX42017.1|2830007_2830712_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXX42018.1|2831688_2832333_-	nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	40.2	2.5e-26
AXX42019.1|2832662_2833556_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AXX43361.1|2833571_2834174_+	lipoprotein-34 precursor (NlpB)	NA	NA	NA	NA	NA
AXX42020.1|2834211_2834931_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	35.8	3.1e-38
AXX42021.1|2835123_2835327_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42022.1|2835612_2836452_+	formate transporter	NA	E7DYY8	Enterobacteria_phage	36.7	1.3e-40
AXX42023.1|2836466_2837732_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	4.5e-80
AXX42024.1|2837837_2838770_-	glucose dehydrogenase	NA	NA	NA	NA	NA
AXX42025.1|2838825_2839530_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXX42026.1|2839773_2840634_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AXX42027.1|2840711_2841245_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AXX42028.1|2841302_2842091_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AXX42029.1|2842211_2842526_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42030.1|2842525_2843353_+	oxacillin-hydrolyzing class D beta-lactamase OXA-2	NA	NA	NA	NA	NA
AXX42031.1|2843808_2844156_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXX42032.1|2844149_2844989_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AXX42033.1|2844918_2845098_-	hypothetical protein	NA	NA	NA	NA	NA
AXX42034.1|2845116_2845617_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXX43362.1|2845792_2846575_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
AXX42035.1|2846564_2848088_-|transposase	IS21 family transposase IS1326	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
AXX42036.1|2848210_2849755_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
AXX42037.1|2849805_2850666_-|transposase	transposase	transposase	NA	NA	NA	NA
AXX42038.1|2851156_2851861_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 163
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2863263	2864376	4119128		Gordonia_phage(100.0%)	1	NA	NA
AXX42048.1|2863263_2864376_-	acyltransferase	NA	A0A166XZF2	Gordonia_phage	25.6	9.6e-10
>prophage 164
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2868068	2869607	4119128		Catovirus(100.0%)	1	NA	NA
AXX42051.1|2868068_2869607_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.2	8.4e-89
>prophage 165
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2877000	2883715	4119128		Staphylococcus_phage(50.0%)	7	NA	NA
AXX42057.1|2877000_2878839_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.0	3.8e-128
AXX42058.1|2878851_2880216_-	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.6	5.8e-33
AXX42059.1|2880232_2880748_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
AXX42060.1|2880725_2881643_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
AXX42061.1|2881658_2882108_-	N utilization substance protein B	NA	NA	NA	NA	NA
AXX42062.1|2882111_2882582_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.3	5.2e-34
AXX42063.1|2882593_2883715_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	34.9	1.9e-53
>prophage 166
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2888673	2889888	4119128		Agrobacterium_phage(100.0%)	1	NA	NA
AXX42069.1|2888673_2889888_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	4.3e-48
>prophage 167
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2893220	2895299	4119128		Bacillus_phage(100.0%)	2	NA	NA
AXX42073.1|2893220_2894579_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	32.1	2.7e-30
AXX42074.1|2894588_2895299_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	36.2	3.0e-33
>prophage 168
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2904895	2908279	4119128		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AXX42084.1|2904895_2908279_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	71.9	0.0e+00
>prophage 169
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2915358	2917242	4119128		Bacillus_virus(100.0%)	1	NA	NA
AXX42091.1|2915358_2917242_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.4	4.9e-99
>prophage 170
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2928335	2930616	4119128		Bacillus_phage(50.0%)	2	NA	NA
AXX42104.1|2928335_2929529_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.3	4.0e-22
AXX42105.1|2929704_2930616_-	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	28.2	1.9e-08
>prophage 171
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2934468	2936013	4119128		Burkholderia_phage(100.0%)	1	NA	NA
AXX42111.1|2934468_2936013_-	hypothetical protein	NA	C7BGE8	Burkholderia_phage	25.0	8.6e-09
>prophage 172
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2950285	2950978	4119128		Bacillus_virus(100.0%)	1	NA	NA
AXX42124.1|2950285_2950978_+	M23 family peptidase	NA	G3MBP9	Bacillus_virus	39.3	4.5e-18
>prophage 173
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2961017	2968638	4119128		Klosneuvirus(33.33%)	6	NA	NA
AXX42132.1|2961017_2962484_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	1.9e-90
AXX42133.1|2962633_2963971_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AXX42134.1|2963981_2964638_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AXX42135.1|2964638_2966339_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.5	3.5e-64
AXX42136.1|2966382_2967150_-	putative porin	NA	NA	NA	NA	NA
AXX42137.1|2967585_2968638_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	4.2e-07
>prophage 174
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2974334	2976284	4119128		Staphylococcus_phage(100.0%)	1	NA	NA
AXX42144.1|2974334_2976284_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.7	1.9e-93
>prophage 175
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2981610	2985108	4119128		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AXX42151.1|2981610_2985108_-	hybrid sensor histidine kinase/response regulator	NA	Q8QNA2	Ectocarpus_siliculosus_virus	24.0	1.0e-12
>prophage 176
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	2988366	2996860	4119128	holin	Vibrio_phage(33.33%)	4	NA	NA
AXX42154.1|2988366_2990334_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.2	1.7e-25
AXX42155.1|2990393_2991293_-	carbapenem susceptibility porin CarO	NA	NA	NA	NA	NA
AXX42156.1|2992285_2993992_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	31.9	2.9e-13
AXX42157.1|2994025_2996860_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.5	0.0e+00
>prophage 177
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3000539	3003766	4119128		Acinetobacter_phage(50.0%)	3	NA	NA
AXX42163.1|3000539_3001622_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	52.3	2.4e-90
AXX42164.1|3001768_3003133_+	MFS transporter	NA	NA	NA	NA	NA
AXX42165.1|3003184_3003766_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	57.6	9.6e-38
>prophage 178
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3007245	3010194	4119128		Streptococcus_phage(50.0%)	2	NA	NA
AXX42170.1|3007245_3008790_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.7	6.6e-17
AXX42171.1|3008901_3010194_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.2e-25
>prophage 179
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3041096	3044808	4119128		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AXX42199.1|3041096_3042974_+	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	32.9	8.7e-72
AXX42200.1|3043029_3043473_-	hypothetical protein	NA	NA	NA	NA	NA
AXX42201.1|3043704_3044808_+	endonuclease	NA	H6X497	Enterobacteria_phage	37.0	5.0e-27
>prophage 180
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3060214	3062454	4119128		Bacillus_phage(100.0%)	2	NA	NA
AXX42221.1|3060214_3061672_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.4	2.0e-15
AXX42222.1|3061689_3062454_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.2	2.8e-29
>prophage 181
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3069181	3072418	4119128		Pandoravirus(50.0%)	2	NA	NA
AXX42225.1|3069181_3070459_-	O-acetylhomoserine aminocarboxypropyltransferase	NA	A0A0B5JD48	Pandoravirus	26.3	5.3e-12
AXX42226.1|3070756_3072418_+	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	27.4	5.8e-43
>prophage 182
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3116157	3116748	4119128		Lactococcus_phage(100.0%)	1	NA	NA
AXX42259.1|3116157_3116748_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	32.7	8.9e-15
>prophage 183
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3123942	3127238	4119128		Salmonella_phage(50.0%)	3	NA	NA
AXX42267.1|3123942_3126048_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	35.3	5.3e-09
AXX42268.1|3126257_3126536_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AXX42269.1|3126608_3127238_-	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	30.6	6.8e-13
>prophage 184
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3145028	3146261	4119128		Catovirus(100.0%)	1	NA	NA
AXX42286.1|3145028_3146261_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	6.3e-103
>prophage 185
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3152024	3156211	4119128		Salmonella_phage(100.0%)	3	NA	NA
AXX42293.1|3152024_3153254_+	multidrug transporter MdfA	NA	S4TR35	Salmonella_phage	22.3	4.6e-13
AXX42294.1|3153290_3155441_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AXX42295.1|3155635_3156211_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	59.1	7.1e-41
>prophage 186
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3164423	3168900	4119128	transposase	Enterobacteria_phage(50.0%)	3	NA	NA
AXX42304.1|3164423_3165356_-|transposase	IS5 family transposase ISAba13	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
AXX42305.1|3166269_3167541_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AXX42306.1|3167685_3168900_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.4	3.0e-25
>prophage 187
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3197384	3197987	4119128		Staphylococcus_phage(100.0%)	1	NA	NA
AXX42333.1|3197384_3197987_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.4	8.7e-42
>prophage 188
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3201558	3204628	4119128		Catovirus(50.0%)	2	NA	NA
AXX42336.1|3201558_3203406_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	27.6	8.9e-45
AXX43378.1|3203809_3204628_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	1.5e-23
>prophage 189
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3208288	3208870	4119128		Orpheovirus(100.0%)	1	NA	NA
AXX42341.1|3208288_3208870_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.2	9.1e-12
>prophage 190
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3222436	3223984	4119128		Klebsiella_phage(100.0%)	1	NA	NA
AXX42352.1|3222436_3223984_-	ATP-binding protein	NA	A0A248XCZ8	Klebsiella_phage	40.9	1.2e-74
>prophage 191
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3249382	3254003	4119128		Klosneuvirus(50.0%)	2	NA	NA
AXX42392.1|3249382_3251437_-	oligopeptidase A	NA	A0A1V0SIU1	Klosneuvirus	20.5	8.2e-31
AXX42393.1|3251570_3254003_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.7	3.3e-71
>prophage 192
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3268193	3273003	4119128	tRNA	Pseudomonas_phage(50.0%)	3	NA	NA
AXX43382.1|3268193_3269237_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.9	1.1e-47
AXX42406.1|3269319_3270771_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AXX42407.1|3271059_3273003_+	lytic transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	39.7	7.5e-10
>prophage 193
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3290365	3291292	4119128		Mollivirus(100.0%)	1	NA	NA
AXX42421.1|3290365_3291292_+	2,4-dienoyl-CoA reductase	NA	A0A0M4JSW6	Mollivirus	22.3	4.1e-06
>prophage 194
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3297700	3298129	4119128	protease	Pseudomonas_phage(100.0%)	1	NA	NA
AXX42427.1|3297700_3298129_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	49.3	3.8e-31
>prophage 195
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3309920	3311021	4119128		Bacillus_phage(100.0%)	1	NA	NA
AXX42442.1|3309920_3311021_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.4	1.8e-13
>prophage 196
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3321554	3322889	4119128		Archaeal_BJ1_virus(50.0%)	2	NA	NA
AXX42447.1|3321554_3322451_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	28.8	6.7e-22
AXX42448.1|3322451_3322889_+	thioredoxin TrxC	NA	A0A1V0SD63	Indivirus	39.0	9.9e-11
>prophage 197
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3330855	3336661	4119128	tRNA	uncultured_Mediterranean_phage(66.67%)	5	NA	NA
AXX42460.1|3330855_3332109_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	3.8e-39
AXX42461.1|3332172_3333138_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.1	1.7e-31
AXX42462.1|3333146_3335048_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AXX42463.1|3335099_3335429_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AXX42464.1|3335527_3336661_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.5	1.3e-94
>prophage 198
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3358018	3364105	4119128	tRNA,transposase	Faecalibacterium_phage(33.33%)	5	NA	NA
AXX42483.1|3358018_3359044_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
AXX42484.1|3359655_3360777_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	43.2	1.5e-79
AXX42485.1|3360827_3361043_-	hypothetical protein	NA	NA	NA	NA	NA
AXX43383.1|3361266_3362274_+	glycosyl transferase	NA	NA	NA	NA	NA
AXX42486.1|3362326_3364105_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	21.9	6.2e-19
>prophage 199
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3376847	3380326	4119128		Bacillus_phage(33.33%)	3	NA	NA
AXX42496.1|3376847_3377534_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.8	2.5e-29
AXX42497.1|3377597_3379040_-	selenoprotein O and cysteine-containing protein	NA	A0A075BSJ0	Microcystis_phage	31.6	4.5e-44
AXX42498.1|3379153_3380326_-	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	32.3	2.5e-32
>prophage 200
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3418077	3418431	4119128		Acinetobacter_phage(100.0%)	1	NA	NA
AXX42529.1|3418077_3418431_+	quaternary ammonium transporter	NA	I3WVW1	Acinetobacter_phage	59.8	1.0e-26
>prophage 201
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3422581	3435225	4119128		Bordetella_phage(20.0%)	11	NA	NA
AXX42535.1|3422581_3423787_-	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	58.4	6.1e-127
AXX42536.1|3424063_3425524_-	lysine transporter	NA	NA	NA	NA	NA
AXX42537.1|3425545_3426559_-	16S rRNA methyltransferase	NA	NA	NA	NA	NA
AXX42538.1|3426621_3427980_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	50.0	2.2e-24
AXX42539.1|3428158_3429994_+	translational GTPase TypA	NA	A0A2K9L2P9	Tupanvirus	39.4	2.3e-21
AXX42540.1|3430249_3430681_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
AXX43388.1|3430822_3431176_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AXX42541.1|3431186_3431477_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXX42542.1|3431496_3432321_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	29.7	3.2e-26
AXX42543.1|3432396_3432963_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AXX43389.1|3433137_3435225_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	49.3	3.8e-92
>prophage 202
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3443933	3457305	4119128		Leptospira_phage(20.0%)	8	NA	NA
AXX42554.1|3443933_3447032_-	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	27.5	1.1e-95
AXX42555.1|3447047_3448166_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXX43390.1|3448225_3448825_-	hypothetical protein	NA	NA	NA	NA	NA
AXX42556.1|3449146_3449530_+	response regulator	NA	Q8QKV4	Ectocarpus_siliculosus_virus	27.9	5.4e-05
AXX42557.1|3449553_3449916_+	response regulator	NA	A0A220YL79	Alteromonas_virus	31.3	8.7e-13
AXX42558.1|3449976_3450513_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXX42559.1|3450559_3452638_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.0	1.6e-18
AXX42560.1|3452784_3457305_+	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	39.5	1.1e-16
>prophage 203
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3469021	3470236	4119128		Salmonella_phage(100.0%)	1	NA	NA
AXX42571.1|3469021_3470236_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	27.9	1.0e-28
>prophage 204
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3473748	3474720	4119128		Klosneuvirus(100.0%)	1	NA	NA
AXX42575.1|3473748_3474720_+	alpha/beta hydrolase	NA	A0A1V0SKV5	Klosneuvirus	29.4	1.6e-08
>prophage 205
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3477852	3479901	4119128		Klosneuvirus(100.0%)	1	NA	NA
AXX42578.1|3477852_3479901_+	peptidase M13	NA	A0A1V0SHG2	Klosneuvirus	29.5	7.5e-93
>prophage 206
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3507406	3512593	4119128	transposase	Dishui_lake_phycodnavirus(33.33%)	7	NA	NA
AXX42604.1|3507406_3508507_-	AAA family ATPase	NA	A0A2K9R7H3	Dishui_lake_phycodnavirus	27.1	2.2e-14
AXX42605.1|3508610_3508904_-	hypothetical protein	NA	NA	NA	NA	NA
AXX42606.1|3508912_3509101_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXX42607.1|3509876_3510179_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42608.1|3510190_3510643_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42609.1|3510687_3511713_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
AXX42610.1|3511813_3512593_+	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	34.3	5.8e-30
>prophage 207
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3515714	3516284	4119128		Pseudomonas_phage(100.0%)	1	NA	NA
AXX42613.1|3515714_3516284_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.0	3.3e-75
>prophage 208
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3536033	3538070	4119128		Ralstonia_phage(100.0%)	1	NA	NA
AXX42628.1|3536033_3538070_+	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	38.3	4.6e-119
>prophage 209
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3543794	3549251	4119128		Klosneuvirus(33.33%)	6	NA	NA
AXX42632.1|3543794_3545075_+	adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA	NA	A0A1V0SKB7	Klosneuvirus	25.4	2.2e-18
AXX42633.1|3545076_3546234_+	8-amino-7-oxononanoate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	25.5	3.5e-31
AXX42634.1|3546230_3546980_+	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
AXX42635.1|3546980_3547625_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AXX42636.1|3547689_3548613_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
AXX42637.1|3548654_3549251_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.2	4.2e-20
>prophage 210
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3553689	3557719	4119128		Trichoplusia_ni_ascovirus(33.33%)	6	NA	NA
AXX42644.1|3553689_3554424_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.0	2.2e-18
AXX42645.1|3554508_3554745_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	1.1e-11
AXX42646.1|3554934_3555408_+	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
AXX42647.1|3555454_3556222_-	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AXX42648.1|3556319_3556994_+	hydrolase	NA	NA	NA	NA	NA
AXX42649.1|3557059_3557719_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.9	1.6e-41
>prophage 211
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3562043	3562994	4119128		Tupanvirus(100.0%)	1	NA	NA
AXX42655.1|3562043_3562994_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.9	3.3e-43
>prophage 212
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3567980	3569846	4119128		Caulobacter_phage(100.0%)	1	NA	NA
AXX42659.1|3567980_3569846_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.1	7.1e-58
>prophage 213
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3573847	3625241	4119128	terminase,transposase,capsid,integrase,head,tail	Acinetobacter_phage(84.85%)	83	3601822:3601838	3627902:3627918
AXX42664.1|3573847_3574321_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.3	4.2e-23
AXX42665.1|3574422_3574623_-	transcriptional regulator	NA	NA	NA	NA	NA
AXX42666.1|3574623_3574893_-	hypothetical protein	NA	A0A172Q0P4	Acinetobacter_phage	56.1	9.6e-17
AXX42667.1|3574929_3575307_-	hypothetical protein	NA	NA	NA	NA	NA
AXX42668.1|3575303_3575528_-	hypothetical protein	NA	I2GUB4	Acinetobacter_phage	94.5	3.1e-37
AXX42669.1|3575514_3575895_-	hypothetical protein	NA	A0A0D4DBH6	Acinetobacter_phage	91.2	5.5e-42
AXX42670.1|3575904_3576804_-	hypothetical protein	NA	NA	NA	NA	NA
AXX42671.1|3576806_3577658_-	nuclease	NA	G8CLD3	Synechococcus_phage	31.6	7.3e-34
AXX42672.1|3577667_3577898_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
AXX42673.1|3577897_3578278_-	hypothetical protein	NA	NA	NA	NA	NA
AXX42674.1|3578342_3579140_-	hypothetical protein	NA	I2GUJ1	Acinetobacter_phage	48.9	1.1e-52
AXX42675.1|3579132_3579360_-	hypothetical protein	NA	NA	NA	NA	NA
AXX42676.1|3579359_3579551_-	hypothetical protein	NA	A0A1B1P9G9	Acinetobacter_phage	66.7	1.9e-14
AXX42677.1|3579754_3580498_-	alkaline phosphatase	NA	A0A1B1P9J5	Acinetobacter_phage	61.5	5.3e-81
AXX42678.1|3580597_3580783_+	hypothetical protein	NA	J7HXD2	Acinetobacter_phage	59.3	2.1e-10
AXX42679.1|3580793_3581060_+	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	74.1	8.3e-29
AXX42680.1|3581115_3581298_+	hypothetical protein	NA	A0A1B1P9H5	Acinetobacter_phage	75.0	1.7e-09
AXX42681.1|3581430_3582174_+	replication protein	NA	A0A0P0HSN8	Acinetobacter_phage	89.5	3.2e-46
AXX42682.1|3582173_3583499_+	DNA helicase	NA	A0A0P0IVX0	Acinetobacter_phage	99.1	4.0e-249
AXX42683.1|3583495_3583684_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42684.1|3583680_3583869_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42685.1|3583865_3584207_+	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	72.6	4.3e-38
AXX42686.1|3584368_3584641_+	hypothetical protein	NA	E2GLW0	Acinetobacter_phage	53.8	4.1e-15
AXX42687.1|3584791_3585100_+	hypothetical protein	NA	A0A068CBJ8	Acinetobacter_phage	36.6	4.4e-05
AXX42688.1|3585096_3585399_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42689.1|3585395_3585848_+	hypothetical protein	NA	A0A0P0HSP6	Acinetobacter_phage	97.3	1.8e-76
AXX42690.1|3585847_3586141_+	hypothetical protein	NA	A0A0D4DBT8	Acinetobacter_phage	97.9	4.7e-49
AXX42691.1|3586151_3586421_+	hypothetical protein	NA	A0A0D4DC03	Acinetobacter_phage	97.8	2.7e-43
AXX42692.1|3586431_3586893_+	hypothetical protein	NA	A0A2H4J353	uncultured_Caudovirales_phage	75.8	2.6e-62
AXX42693.1|3587295_3587571_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42694.1|3587633_3587879_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42695.1|3587881_3588085_+	hypothetical protein	NA	A0A1B1P9J1	Acinetobacter_phage	98.5	8.3e-29
AXX42696.1|3588035_3588311_+	hypothetical protein	NA	A0A1B1P9J2	Acinetobacter_phage	67.0	2.1e-27
AXX42697.1|3588312_3588795_+	hypothetical protein	NA	A0A0D4DC11	Acinetobacter_phage	72.5	8.5e-64
AXX42698.1|3588851_3589055_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42699.1|3589096_3589744_+|transposase	transposase	transposase	A0A0N7IRF1	Acinetobacter_phage	96.7	6.8e-125
AXX42700.1|3589791_3590271_+	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	96.5	1.1e-71
AXX42701.1|3590260_3591688_+|terminase	terminase	terminase	J7I460	Acinetobacter_phage	99.3	2.9e-269
AXX42702.1|3591684_3593136_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	99.4	3.2e-284
AXX42703.1|3593137_3594241_+|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	95.4	1.2e-198
AXX42704.1|3594249_3594678_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	99.3	3.4e-72
AXX42705.1|3594776_3595019_+	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	97.5	6.2e-39
AXX42706.1|3595236_3595428_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
AXX42707.1|3595541_3596309_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
AXX42708.1|3596336_3597293_+|capsid	phage capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	99.7	6.0e-178
AXX42709.1|3597359_3598025_+	stress-responsive nuclear envelope protein	NA	A0A0D4DBW4	Acinetobacter_phage	69.7	1.4e-72
AXX42710.1|3598029_3598419_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	100.0	6.6e-67
AXX42711.1|3598420_3598789_+	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	98.4	6.5e-64
AXX42712.1|3598826_3599501_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42713.1|3599716_3600124_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.1	9.1e-51
AXX43396.1|3600095_3600464_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	83.6	1.6e-54
AXX42714.1|3600465_3600864_+	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	86.4	1.6e-60
AXX42715.1|3601023_3601554_+	Rha family transcriptional regulator	NA	A0A1B1P9D9	Acinetobacter_phage	63.6	1.2e-55
AXX42716.1|3601550_3601748_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42717.1|3601814_3602015_+	hypothetical protein	NA	NA	NA	NA	NA
3601822:3601838	attL	CAAGAATATTTGAAACT	NA	NA	NA	NA
AXX42718.1|3602122_3602476_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	99.1	3.5e-59
AXX42719.1|3602475_3603627_+|tail	phage tail protein	tail	A0A0N7IRE5	Acinetobacter_phage	45.6	9.7e-74
AXX42720.1|3603723_3604641_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	97.7	1.0e-166
AXX42721.1|3604710_3605226_+	hypothetical protein	NA	A0A0D4DBX8	Acinetobacter_phage	97.9	1.4e-77
AXX42722.1|3605153_3605471_+	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	59.8	1.2e-26
AXX42723.1|3605772_3606039_-	Arc family DNA-binding protein	NA	A0A0P0IVR2	Acinetobacter_phage	100.0	6.8e-39
AXX42724.1|3606098_3606323_+	Arc family DNA-binding protein	NA	A0A0P0I460	Acinetobacter_phage	100.0	1.4e-32
AXX42725.1|3606402_3606789_+	hypothetical protein	NA	A0A0P0IKU3	Acinetobacter_phage	100.0	8.9e-64
AXX42726.1|3606785_3607325_+	phage antirepressor Ant	NA	A0A0A7RVQ9	Clostridium_phage	53.1	2.4e-27
AXX42727.1|3607421_3607931_+	hypothetical protein	NA	A0A0S0N7I7	Pseudomonas_phage	35.4	6.7e-19
AXX42728.1|3608001_3612309_+|tail	phage tail tape measure protein	tail	A0A0D4DC37	Acinetobacter_phage	97.6	0.0e+00
AXX42729.1|3612937_3613336_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.0	1.2e-71
AXX42730.1|3613335_3613842_+	hypothetical protein	NA	J7HXQ5	Acinetobacter_phage	97.6	1.5e-90
AXX42731.1|3613838_3614201_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	6.2e-51
AXX42732.1|3614193_3617619_+	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	93.3	0.0e+00
AXX42733.1|3617687_3618077_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	98.4	5.6e-66
AXX42734.1|3618276_3618453_+	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	59.6	8.2e-09
AXX42735.1|3618461_3618785_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AXX42736.1|3618818_3619637_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42737.1|3619659_3619944_-	hypothetical protein	NA	A0A0P0IKW9	Acinetobacter_phage	100.0	2.3e-45
AXX42738.1|3620085_3621033_+	alpha/beta hydrolase	NA	A0A0P0J0J7	Acinetobacter_phage	99.4	3.1e-174
AXX42739.1|3621371_3621917_+	hypothetical protein	NA	A0A0N7IRF5	Acinetobacter_phage	94.4	3.3e-96
AXX42740.1|3622051_3622234_-	hypothetical protein	NA	A0A2H4J316	uncultured_Caudovirales_phage	62.7	5.3e-11
AXX42741.1|3622233_3622650_-	hypothetical protein	NA	A0A2H4J321	uncultured_Caudovirales_phage	87.7	1.7e-65
AXX42742.1|3622760_3622952_+	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	93.5	1.1e-27
AXX42743.1|3622948_3624163_-|integrase	integrase	integrase	A0A0P0IRB7	Acinetobacter_phage	55.9	7.7e-122
AXX42744.1|3624484_3624976_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.3	3.7e-30
AXX42745.1|3624977_3625241_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.0	2.4e-20
3627902:3627918	attR	CAAGAATATTTGAAACT	NA	NA	NA	NA
>prophage 214
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3629366	3632005	4119128		Vibrio_phage(50.0%)	2	NA	NA
AXX42749.1|3629366_3631019_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	23.4	1.6e-08
AXX42750.1|3631030_3632005_+	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	30.7	7.3e-30
>prophage 215
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3636981	3638607	4119128		Agrobacterium_phage(100.0%)	1	NA	NA
AXX42755.1|3636981_3638607_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	35.9	6.6e-92
>prophage 216
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3645379	3648803	4119128		Streptococcus_phage(50.0%)	2	NA	NA
AXX42762.1|3645379_3647518_+	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	25.1	4.8e-50
AXX42763.1|3647612_3648803_+	elongation factor Tu	NA	A0A1M7XUR5	Cedratvirus	31.3	8.1e-15
>prophage 217
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3653293	3657543	4119128		Orpheovirus(50.0%)	2	NA	NA
AXX42769.1|3653293_3654241_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	3.2e-62
AXX42770.1|3654510_3657543_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	45.0	8.5e-77
>prophage 218
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3663808	3671869	4119128	transposase	Bacillus_phage(50.0%)	7	NA	NA
AXX42779.1|3663808_3665848_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.7	3.2e-112
AXX42780.1|3665872_3666325_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	57.5	2.0e-46
AXX42781.1|3666524_3667943_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.4	7.8e-41
AXX42782.1|3667957_3668866_+	acetylglutamate kinase	NA	NA	NA	NA	NA
AXX42783.1|3668986_3669769_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXX42784.1|3669877_3670726_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AXX42785.1|3670843_3671869_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
>prophage 219
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3678342	3681939	4119128		Lactobacillus_virus(100.0%)	1	NA	NA
AXX42795.1|3678342_3681939_-	ATP-dependent dsDNA exonuclease	NA	Q5ULP4	Lactobacillus_virus	27.4	5.8e-08
>prophage 220
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3702929	3709042	4119128		Acinetobacter_phage(50.0%)	3	NA	NA
AXX42815.1|3702929_3704411_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	31.2	4.2e-37
AXX42816.1|3704407_3705568_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AXX42817.1|3705598_3709042_+	restriction endonuclease subunit R	NA	Q6NDX2	Leptospira_phage	24.1	1.3e-09
>prophage 221
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3732253	3740168	4119128	holin	Vibrio_phage(66.67%)	5	NA	NA
AXX42833.1|3732253_3733912_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	1.0e-55
AXX42834.1|3734007_3735480_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AXX42835.1|3735472_3736108_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
AXX42836.1|3736361_3737984_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.6	1.8e-20
AXX42837.1|3738101_3740168_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.1	2.0e-16
>prophage 222
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3750972	3751554	4119128		Raoultella_phage(100.0%)	1	NA	NA
AXX42848.1|3750972_3751554_+	nicotinamide riboside transporter PnuC	NA	A0A2H4YHF9	Raoultella_phage	29.1	8.0e-08
>prophage 223
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3759503	3768532	4119128		Mycobacterium_phage(25.0%)	8	NA	NA
AXX42859.1|3759503_3760328_+	alpha/beta hydrolase	NA	A0A249XPN5	Mycobacterium_phage	31.7	2.8e-14
AXX42860.1|3760343_3761138_+	short chain dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	8.6e-13
AXX42861.1|3761153_3761945_+	L-aspartate dehydrogenase	NA	NA	NA	NA	NA
AXX42862.1|3761958_3763425_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AXX42863.1|3763463_3765104_+	hypothetical protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.5	1.6e-24
AXX43403.1|3765279_3766455_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42864.1|3766516_3767815_-	MFS transporter	NA	NA	NA	NA	NA
AXX42865.1|3768049_3768532_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.4	2.2e-19
>prophage 224
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3779123	3782810	4119128		Dickeya_phage(100.0%)	1	NA	NA
AXX42874.1|3779123_3782810_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	60.0	3.3e-14
>prophage 225
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3796559	3799877	4119128		Mycobacterium_phage(50.0%)	4	NA	NA
AXX42884.1|3796559_3797585_-	alpha/beta hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	31.0	6.5e-05
AXX42885.1|3797869_3798484_+	carbonic anhydrase	NA	NA	NA	NA	NA
AXX42886.1|3798516_3799140_-	arylesterase	NA	NA	NA	NA	NA
AXX42887.1|3799184_3799877_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	4.2e-32
>prophage 226
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3811994	3818089	4119128	tRNA	Catovirus(50.0%)	5	NA	NA
AXX42899.1|3811994_3813524_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	5.4e-88
AXX42900.1|3813713_3815156_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
AXX42901.1|3815412_3815544_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42902.1|3815536_3816445_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
AXX42903.1|3816475_3818089_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.2	2.6e-40
>prophage 227
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3845336	3955569	4119128	terminase,transposase,capsid,integrase,head,protease,tail	Acinetobacter_phage(76.92%)	114	3848136:3848195	3953435:3954416
AXX42929.1|3845336_3847766_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	62.7	8.4e-277
3848136:3848195	attL	ATAATAACCTGGATCCTGCTTAAGCCGATGATTCCTTAATTTGAATTGTTGGCTTATTTT	NA	NA	NA	NA
AXX42930.1|3848154_3849024_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AXX42931.1|3849526_3855643_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42932.1|3855700_3856480_+	outer membrane assembly protein BamE	NA	NA	NA	NA	NA
AXX43411.1|3856590_3857157_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AXX42933.1|3857416_3857758_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42934.1|3857865_3857979_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42935.1|3858051_3858369_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42936.1|3858790_3859054_-	DNA-binding protein	NA	NA	NA	NA	NA
AXX42937.1|3859054_3859777_-	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	85.5	7.0e-54
AXX42938.1|3859773_3860187_-	hypothetical protein	NA	NA	NA	NA	NA
AXX42939.1|3860183_3860516_-	hypothetical protein	NA	NA	NA	NA	NA
AXX42940.1|3860516_3860768_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.7	3.2e-38
AXX42941.1|3860769_3861732_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	85.9	5.7e-152
AXX42942.1|3861728_3862799_-	AAA family ATPase	NA	A0A1B1P9H8	Acinetobacter_phage	51.0	1.0e-48
AXX42943.1|3862810_3863134_-	hypothetical protein	NA	A0A0P0IRC4	Acinetobacter_phage	98.1	7.4e-56
AXX42944.1|3863126_3863417_-	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	88.5	9.0e-45
AXX42945.1|3863416_3863860_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	95.2	2.7e-72
AXX42946.1|3864046_3864289_+	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	98.8	8.9e-38
AXX42947.1|3864295_3864499_-	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
AXX42948.1|3864732_3865476_-	3-deoxy-D-manno-octulosonic acid transferase	NA	A0A1W6JTE9	Pseudomonas_phage	42.7	2.2e-47
AXX42949.1|3865512_3865740_-	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	90.0	3.3e-26
AXX42950.1|3865754_3866519_-	phage repressor protein	NA	J7I4M9	Acinetobacter_phage	98.0	2.3e-140
AXX42951.1|3866596_3866782_+	hypothetical protein	NA	J7HXD2	Acinetobacter_phage	98.4	1.4e-27
AXX42952.1|3866791_3867148_+	transcriptional regulator	NA	J7I452	Acinetobacter_phage	98.3	8.8e-58
AXX43412.1|3867203_3867479_+	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	97.8	8.3e-40
AXX43413.1|3867550_3867775_+	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	98.6	6.5e-35
AXX42953.1|3867767_3868649_+	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	93.5	3.4e-135
AXX42954.1|3869447_3869855_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42955.1|3869851_3870253_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.4	1.7e-25
AXX42956.1|3870245_3870461_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	42.3	2.1e-06
AXX42957.1|3870460_3870862_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.9	5.2e-67
AXX42958.1|3870858_3871335_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
AXX42959.1|3871306_3871561_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42960.1|3872023_3872368_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42961.1|3872576_3872813_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42962.1|3873474_3873930_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	98.0	1.7e-82
AXX42963.1|3873991_3874426_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	97.9	8.4e-79
AXX42964.1|3874394_3875036_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	98.6	3.9e-125
AXX42965.1|3875094_3875565_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
AXX42966.1|3875554_3876982_+|terminase	terminase	terminase	J7I460	Acinetobacter_phage	98.9	1.4e-268
AXX42967.1|3876978_3878430_+	hypothetical protein	NA	A0A0D4DCP1	Acinetobacter_phage	99.4	3.2e-284
AXX42968.1|3878431_3879535_+|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	98.4	4.8e-203
AXX42969.1|3879543_3879972_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	99.3	3.4e-72
AXX42970.1|3880070_3880313_+	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	97.5	6.2e-39
AXX42971.1|3880530_3880722_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
AXX42972.1|3880835_3881603_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
AXX42973.1|3881630_3882587_+|capsid	phage capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	99.7	6.0e-178
AXX42974.1|3882653_3883319_+	stress-responsive nuclear envelope protein	NA	A0A0D4DBW4	Acinetobacter_phage	69.7	1.4e-72
AXX42975.1|3883323_3883713_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	100.0	6.6e-67
AXX42976.1|3883714_3884083_+	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	98.4	6.5e-64
AXX42977.1|3884120_3884795_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42978.1|3885010_3885418_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.1	9.1e-51
AXX43414.1|3885389_3885758_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	93.4	5.1e-61
AXX42979.1|3885759_3886158_+	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	95.5	4.2e-69
AXX42980.1|3886226_3886580_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	99.1	3.5e-59
AXX42981.1|3886579_3887722_+|tail	phage tail protein	tail	A0A0D4DCQ4	Acinetobacter_phage	79.2	3.5e-148
AXX42982.1|3887818_3888736_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	97.4	1.1e-165
AXX43415.1|3888806_3889316_+	hypothetical protein	NA	A0A0D4DBX8	Acinetobacter_phage	83.6	1.9e-66
AXX42983.1|3889243_3889573_+	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	68.1	9.3e-30
AXX42984.1|3889875_3890733_+	DUF4760 domain-containing protein	NA	A0A1B1P9E5	Acinetobacter_phage	32.1	1.5e-26
AXX42985.1|3890817_3891759_+	hypothetical protein	NA	A0A0N7IRE6	Acinetobacter_phage	95.8	4.0e-166
AXX42986.1|3891820_3896563_+|tail	phage tail tape measure protein	tail	A0A0D4DC37	Acinetobacter_phage	67.0	0.0e+00
AXX42987.1|3896611_3897010_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	96.2	6.5e-70
AXX42988.1|3897009_3897516_+	DUF1833 domain-containing protein	NA	A0A0P0IKN4	Acinetobacter_phage	97.6	1.0e-91
AXX42989.1|3897512_3897875_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	98.3	3.7e-64
AXX42990.1|3897867_3901314_+	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	96.0	0.0e+00
AXX42991.1|3901382_3901772_+	hypothetical protein	NA	J7I481	Acinetobacter_phage	100.0	2.5e-66
AXX42992.1|3902135_3902318_+	hypothetical protein	NA	NA	NA	NA	NA
AXX42993.1|3902416_3902962_+	hypothetical protein	NA	A0A0B5L5G7	Acinetobacter_phage	92.8	2.5e-96
AXX42994.1|3903450_3905769_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXX42995.1|3906050_3907697_+	lipid A phosphoethanolamine transferase	NA	NA	NA	NA	NA
AXX42996.1|3908116_3909049_+|transposase	IS5 family transposase ISAba40	transposase	Q1MVF0	Enterobacteria_phage	40.8	2.5e-56
AXX42997.1|3910380_3910665_-	cell division protein ZapA	NA	NA	NA	NA	NA
AXX42998.1|3910661_3911222_-	hypothetical protein	NA	NA	NA	NA	NA
AXX42999.1|3911286_3911919_+	YecA family protein	NA	NA	NA	NA	NA
AXX43000.1|3911986_3913309_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AXX43001.1|3913340_3914549_+	ubiquinone biosynthesis protein UbiH	NA	NA	NA	NA	NA
AXX43002.1|3914545_3915778_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
AXX43003.1|3915987_3916239_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43004.1|3916293_3916695_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AXX43005.1|3916760_3917402_+	cation transporter	NA	NA	NA	NA	NA
AXX43416.1|3917459_3918062_-	amino acid transporter	NA	NA	NA	NA	NA
AXX43006.1|3918169_3919060_+	transcriptional regulator ArgP	NA	NA	NA	NA	NA
AXX43007.1|3919062_3919449_-	hemin receptor	NA	NA	NA	NA	NA
AXX43008.1|3919543_3920380_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.9	5.3e-45
AXX43417.1|3920573_3920975_+	YraN family protein	NA	NA	NA	NA	NA
AXX43009.1|3921055_3921763_+	BON domain-containing protein	NA	NA	NA	NA	NA
AXX43010.1|3921766_3922630_+	DUF1749 domain-containing protein	NA	NA	NA	NA	NA
AXX43011.1|3922652_3923396_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
AXX43012.1|3923395_3925039_-	chemotaxis protein	NA	NA	NA	NA	NA
AXX43013.1|3925167_3926445_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.6	3.6e-85
AXX43014.1|3926457_3927492_-	permease	NA	NA	NA	NA	NA
AXX43015.1|3927603_3927918_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXX43418.1|3928164_3929544_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.6	7.9e-38
AXX43016.1|3929776_3932992_+	lytic transglycosylase	NA	A0A0A7NU10	Lactobacillus_phage	37.7	2.8e-25
AXX43419.1|3933130_3934843_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXX43420.1|3934905_3935925_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AXX43017.1|3935924_3936935_+	ABC transporter permease	NA	NA	NA	NA	NA
AXX43018.1|3936912_3938502_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	3.2e-19
AXX43019.1|3938687_3939932_+	NADH oxidase	NA	NA	NA	NA	NA
AXX43020.1|3939990_3942105_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AXX43021.1|3942382_3943045_-	ribonuclease T	NA	L0N5X9	Acaryochloris_phage	35.4	2.0e-07
AXX43022.1|3943029_3944064_-	dihydroorotase	NA	NA	NA	NA	NA
AXX43023.1|3944213_3944408_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43024.1|3944498_3945476_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.6	2.2e-18
AXX43025.1|3945535_3946879_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	81.0	2.0e-54
AXX43026.1|3947159_3949190_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
AXX43027.1|3949534_3950749_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	36.8	2.0e-61
AXX43028.1|3950782_3951049_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXX43029.1|3951045_3952074_-	hypothetical protein	NA	NA	NA	NA	NA
AXX43030.1|3952070_3953294_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AXX43031.1|3953453_3954323_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AXX43032.1|3954636_3955569_+|transposase	IS5 family transposase ISAba13	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
3953435:3954416	attR	ATAATAACCTGGATCCTGCTTAAGCCGATGATTCCTTAATTTGAATTGTTGGCTTATTTTGATGGGTTAATTGATATGCACATAGTGAGGCGTAAATTCCACTCAGAAATCCATGAAGACTACGTGCTTTACTCGTCACTAAATTGTATTGCCCCTTCAATAAACTGAATAATGTTTCTATCTTATTGCGTTGTCTTAGGTGATATTCATCTGATGCACAGAATTGAATAGCCTGCATATTCTTTCGATGATAAGTAATTAAATCAATACCTTGATCTTTCAATCTGATTTTTAATTCTTGGCTGATGTAACCTCGATCCCCGTAAAGTTTTGCTTCTATACCAGCAACCAATTGCTCAACCATTTTTATGTCAGCAACATGTCCATTTGATAAAGCAGAACAGGCAATTTCACCAAATTGATTCATCGCAATATGTAATTTACAGCCATAAAACCAGCCCATTGAGCTTCTACCACGTGATGCAATTTGGACTAATGATTTATGACGCTGAATACGTTGATTTTTACAAACTGGCAGAGTTGTTGAATCAATCCATAAATATTGTGTAGCTTGGTCTTTCATCAGCGCCACATGTAAAGCGTGTAGGGCCAATTGGTGCATATTGATCAGATGAATCATCCTTTGATAGCAAGGCAAGTACTTAAATAAATGGCTTTTATCTTCTTTTAACCAGGTGAAAAAGGCTTTGAAATTATTGAAATGAGAGCATTTGTACCAAATGGCAATAAAGCAGATTTCTGAAATTGTGAGTTGAGCAGTTCTGATTCTTAAGGAACCACAGTTTTGTTTGAGAAACTCCCAATAAGTTGATTCAAATTTAAGAAAAAAATCATCAATTACGCAGAATAATTCGGTACTATTGAACATCAGGACTAGAGTTGTGAGTTTGGTGTGGTAACTCAACTGATGGCTCTAGTCCTCTTATTTTTCAAGTCAATTTCTTATCCGCGATTCGGGTTA	NA	NA	NA	NA
>prophage 228
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	3983187	4039947	4119128	terminase,transposase,capsid,integrase,head,tail	Acinetobacter_phage(90.91%)	77	3992891:3992905	4038340:4038354
AXX43055.1|3983187_3984507_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	1.7e-58
AXX43056.1|3984618_3985617_+	adenosine deaminase	NA	NA	NA	NA	NA
AXX43057.1|3985660_3986218_-	cytochrome b	NA	NA	NA	NA	NA
AXX43058.1|3986457_3986847_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43059.1|3986912_3987479_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	1.8e-25
AXX43060.1|3987548_3987803_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
AXX43061.1|3988049_3989330_-	aspartate kinase	NA	NA	NA	NA	NA
AXX43062.1|3989539_3989755_-	hypothetical protein	NA	A0A0R6PG25	Moraxella_phage	55.9	3.7e-11
AXX43063.1|3989756_3990014_-	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	90.5	2.2e-42
AXX43064.1|3990017_3990302_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	95.7	7.5e-44
AXX43065.1|3990294_3990705_-	hypothetical protein	NA	A0A0P0I8H3	Acinetobacter_phage	96.9	6.4e-12
AXX43066.1|3990708_3990954_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
AXX43067.1|3990955_3992164_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	51.0	2.1e-95
AXX43068.1|3992160_3993282_-	AAA family ATPase	NA	A0A0N7IRE0	Acinetobacter_phage	100.0	5.2e-213
3992891:3992905	attL	ATCAAAGTATTGATG	NA	NA	NA	NA
AXX43069.1|3993293_3993617_-	hypothetical protein	NA	A0A0P0IKP4	Acinetobacter_phage	99.1	1.5e-56
AXX43070.1|3993609_3993900_-	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	99.0	1.6e-49
AXX43071.1|3993899_3994340_-	hypothetical protein	NA	A0A0D4DBH9	Acinetobacter_phage	100.0	2.3e-76
AXX43072.1|3994548_3995052_-	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	82.6	1.2e-65
AXX43073.1|3995054_3996056_-	hypothetical protein	NA	A0A0P0IRH5	Acinetobacter_phage	100.0	4.2e-182
AXX43074.1|3996106_3996322_-	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	100.0	2.5e-31
AXX43075.1|3996336_3997101_-	phage repressor protein	NA	A0A0P0J076	Acinetobacter_phage	99.2	5.3e-145
AXX43076.1|3997209_3997461_+	hypothetical protein	NA	A0A0N7IRE1	Acinetobacter_phage	95.2	2.4e-38
AXX43077.1|3997471_3997792_+	transcriptional regulator	NA	A0A0P0HSE9	Acinetobacter_phage	88.7	3.2e-43
AXX43078.1|3997854_3998127_+	hypothetical protein	NA	A0A0P0J0B9	Acinetobacter_phage	97.8	1.5e-41
AXX43079.1|3998123_3998420_+	hypothetical protein	NA	A0A0D4DCL5	Acinetobacter_phage	98.0	4.0e-48
AXX43080.1|3998416_3998773_+	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	100.0	1.1e-57
AXX43081.1|3998831_3999725_+	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	99.3	5.8e-159
AXX43082.1|3999721_4000492_+	DNA replication protein	NA	A0A0D4DBZ2	Acinetobacter_phage	99.6	1.2e-147
AXX43083.1|4000598_4001006_+	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	50.9	6.8e-22
AXX43084.1|4001008_4001422_+	antitermination protein	NA	NA	NA	NA	NA
AXX43085.1|4001567_4002092_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43086.1|4002182_4003052_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AXX43087.1|4003192_4003423_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43088.1|4003487_4003679_+	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	85.5	9.8e-24
AXX43089.1|4003690_4004119_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	65.5	3.9e-44
AXX43090.1|4004087_4004729_+	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	98.6	1.1e-124
AXX43091.1|4004787_4005258_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
AXX43092.1|4005247_4006675_+|terminase	terminase	terminase	J7I460	Acinetobacter_phage	98.9	7.1e-268
AXX43093.1|4006671_4008117_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	96.3	1.1e-276
AXX43094.1|4008123_4009227_+|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	98.1	4.0e-202
AXX43095.1|4009235_4009664_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	99.3	3.4e-72
AXX43096.1|4009762_4010005_+	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	97.5	6.2e-39
AXX43097.1|4010222_4010414_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
AXX43098.1|4010527_4011295_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
AXX43099.1|4011322_4012279_+|capsid	phage capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	99.7	6.0e-178
AXX43100.1|4012345_4013011_+	stress-responsive nuclear envelope protein	NA	A0A0D4DBW4	Acinetobacter_phage	69.7	1.4e-72
AXX43101.1|4013015_4013405_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	100.0	6.6e-67
AXX43102.1|4013406_4013775_+	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	98.4	6.5e-64
AXX43103.1|4013812_4014487_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43104.1|4014702_4015110_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.1	9.1e-51
AXX43422.1|4015081_4015450_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	93.4	5.1e-61
AXX43105.1|4015451_4015850_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	91.7	6.1e-68
AXX43106.1|4015851_4016070_+	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	94.4	4.3e-31
AXX43107.1|4016165_4016519_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	95.7	6.6e-58
AXX43108.1|4016518_4017667_+|tail	phage tail protein	tail	A0A0D4DCQ4	Acinetobacter_phage	80.7	9.5e-154
AXX43109.1|4017763_4018681_+	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
AXX43110.1|4018750_4019266_+	hypothetical protein	NA	A0A0D4DBX8	Acinetobacter_phage	97.3	4.2e-77
AXX43111.1|4019193_4019523_+	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	58.0	2.8e-26
AXX43112.1|4019591_4019774_+	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
AXX43113.1|4019866_4020271_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
AXX43114.1|4020369_4020546_+	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	57.7	6.3e-09
AXX43115.1|4020554_4020878_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AXX43116.1|4020910_4021294_+	hypothetical protein	NA	A0A0D4DBP2	Acinetobacter_phage	68.5	3.4e-47
AXX43117.1|4021355_4022102_+	hypothetical protein	NA	A0A0N7IRG5	Acinetobacter_phage	85.1	2.5e-115
AXX43118.1|4022368_4027264_+|tail	phage tail protein	tail	J7I4Q7	Acinetobacter_phage	98.6	0.0e+00
AXX43119.1|4027338_4028091_+	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	34.8	8.4e-34
AXX43423.1|4028095_4028488_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43120.1|4028552_4028951_+	hypothetical protein	NA	A0A0P0IY66	Acinetobacter_phage	96.2	3.5e-71
AXX43121.1|4028950_4029457_+	DUF1833 domain-containing protein	NA	A0A0D4DCA4	Acinetobacter_phage	99.4	2.7e-92
AXX43122.1|4029453_4029816_+	hypothetical protein	NA	A0A0D4DCJ1	Acinetobacter_phage	98.3	4.4e-65
AXX43123.1|4029808_4033255_+	hypothetical protein	NA	A0A0D4DBG7	Acinetobacter_phage	96.8	0.0e+00
AXX43124.1|4033323_4033713_+	hypothetical protein	NA	J7I481	Acinetobacter_phage	100.0	2.5e-66
AXX43125.1|4033755_4034298_+	hypothetical protein	NA	A0A0B5L5G7	Acinetobacter_phage	87.2	3.5e-90
AXX43126.1|4034731_4034926_+	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	100.0	3.8e-31
AXX43424.1|4034922_4036119_-|integrase	integrase	integrase	A0A0D4DBR3	Acinetobacter_phage	100.0	2.5e-226
AXX43127.1|4036606_4038409_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	97.3	0.0e+00
4038340:4038354	attR	CATCAATACTTTGAT	NA	NA	NA	NA
AXX43128.1|4038405_4039947_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	99.8	8.8e-288
>prophage 229
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	4048127	4050591	4119128	protease	Pithovirus(50.0%)	2	NA	NA
AXX43137.1|4048127_4049303_+|protease	serine protease	protease	W5SAB9	Pithovirus	29.6	8.0e-07
AXX43138.1|4049352_4050591_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.3	1.6e-90
>prophage 230
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	4054187	4055120	4119128	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
AXX43141.1|4054187_4055120_+|transposase	IS5 family transposase ISAba13	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
>prophage 231
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	4058870	4060253	4119128		Pandoravirus(100.0%)	1	NA	NA
AXX43145.1|4058870_4060253_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	30.6	2.0e-41
>prophage 232
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	4078031	4078649	4119128		Synechococcus_phage(100.0%)	1	NA	NA
AXX43162.1|4078031_4078649_-	septal ring lytic transglycosylase RlpA family lipoprotein	NA	F5B3X9	Synechococcus_phage	45.5	2.1e-22
>prophage 233
CP023020	Acinetobacter baumannii strain 9201 chromosome, complete genome	4119128	4081905	4118306	4119128	terminase,integrase,coat,head,tail	Acinetobacter_phage(82.0%)	66	4075802:4075816	4086053:4086067
4075802:4075816	attL	AAGGCGATGGGTGTT	NA	NA	NA	NA
AXX43166.1|4081905_4082718_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	36.8	4.2e-39
AXX43167.1|4082714_4083488_-	ABC transporter permease	NA	NA	NA	NA	NA
AXX43168.1|4083484_4084420_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	8.3e-23
AXX43425.1|4084718_4085705_+|integrase	integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	99.4	1.8e-185
AXX43169.1|4085701_4085971_-	hypothetical protein	NA	A0A1B1P9G0	Acinetobacter_phage	98.9	8.1e-48
AXX43170.1|4085972_4086242_-	hypothetical protein	NA	A0A172Q0P4	Acinetobacter_phage	56.1	1.9e-17
4086053:4086067	attR	AACACCCATCGCCTT	NA	NA	NA	NA
AXX43171.1|4086243_4086435_-	hypothetical protein	NA	A0A0D4DCB1	Acinetobacter_phage	96.8	6.0e-29
AXX43172.1|4086431_4086644_-	hypothetical protein	NA	NA	NA	NA	NA
AXX43173.1|4086640_4086865_-	hypothetical protein	NA	I2GUB4	Acinetobacter_phage	98.6	1.2e-39
AXX43174.1|4086851_4087232_-	hypothetical protein	NA	A0A0D4DBH6	Acinetobacter_phage	90.1	9.4e-42
AXX43175.1|4087228_4087888_-	hypothetical protein	NA	A0A2H4JDC0	uncultured_Caudovirales_phage	59.0	2.2e-78
AXX43176.1|4087884_4088823_-	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	82.3	1.7e-140
AXX43177.1|4088832_4089129_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
AXX43178.1|4089128_4089509_-	hypothetical protein	NA	NA	NA	NA	NA
AXX43179.1|4089508_4089700_-	hypothetical protein	NA	A0A1B1P9G9	Acinetobacter_phage	66.7	1.9e-14
AXX43180.1|4089754_4090102_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43181.1|4090081_4090360_-	hypothetical protein	NA	NA	NA	NA	NA
AXX43182.1|4090477_4090807_-	hypothetical protein	NA	A0A1B1P9G6	Acinetobacter_phage	65.7	8.2e-18
AXX43183.1|4090936_4091140_-	hypothetical protein	NA	A0A1B1P9G7	Acinetobacter_phage	98.5	2.4e-28
AXX43184.1|4091160_4091823_-	LexA family transcriptional regulator	NA	A0A0P0IYD9	Acinetobacter_phage	100.0	2.3e-120
AXX43185.1|4091936_4092137_+	transcriptional regulator	NA	A0A0P0IKT3	Acinetobacter_phage	95.5	1.1e-30
AXX43186.1|4092147_4092522_+	XRE family transcriptional regulator	NA	A0A0N7IRF8	Acinetobacter_phage	61.7	6.0e-33
AXX43187.1|4092771_4093665_+	DNA replication protein DnaD	NA	A0A068C8G6	Acinetobacter_phage	46.8	3.5e-47
AXX43188.1|4093664_4094990_+	DNA helicase	NA	A0A0P0IVX0	Acinetobacter_phage	91.6	5.9e-232
AXX43189.1|4094986_4095175_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43190.1|4095171_4095360_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43191.1|4095356_4095698_+	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	70.2	3.7e-37
AXX43192.1|4095690_4096047_+	hypothetical protein	NA	A0A068CDE4	Acinetobacter_phage	37.1	3.2e-07
AXX43193.1|4096039_4096390_+	hypothetical protein	NA	A0A0D4DBT5	Acinetobacter_phage	37.1	4.8e-08
AXX43194.1|4096540_4096849_+	hypothetical protein	NA	A0A068CBJ8	Acinetobacter_phage	36.6	4.4e-05
AXX43195.1|4096845_4097148_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43196.1|4097144_4097597_+	hypothetical protein	NA	A0A0P0HSP6	Acinetobacter_phage	97.3	1.8e-76
AXX43197.1|4097596_4097890_+	hypothetical protein	NA	A0A0D4DBT8	Acinetobacter_phage	97.9	4.7e-49
AXX43198.1|4097900_4098170_+	hypothetical protein	NA	A0A0D4DC03	Acinetobacter_phage	97.8	2.7e-43
AXX43199.1|4098180_4098642_+	hypothetical protein	NA	A0A2H4J353	uncultured_Caudovirales_phage	75.8	2.6e-62
AXX43200.1|4099044_4099320_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43201.1|4099382_4099628_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43202.1|4099630_4099834_+	hypothetical protein	NA	A0A1B1P9J1	Acinetobacter_phage	98.5	8.3e-29
AXX43203.1|4099784_4100063_+	hypothetical protein	NA	A0A1B1P9J2	Acinetobacter_phage	63.6	3.4e-25
AXX43204.1|4100238_4100721_+	hypothetical protein	NA	A0A0D4DC11	Acinetobacter_phage	73.8	5.9e-65
AXX43205.1|4100909_4101440_+|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	46.2	4.5e-34
AXX43206.1|4101455_4102952_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	67.6	1.5e-196
AXX43207.1|4102959_4104363_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	51.6	8.4e-128
AXX43208.1|4104328_4105414_+|head	phage head morphogenesis protein	head	A0A1B1P9B7	Acinetobacter_phage	93.6	1.2e-190
AXX43209.1|4105410_4105623_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43210.1|4105732_4106539_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	58.1	2.2e-64
AXX43211.1|4106551_4107706_+|coat	P22 coat - protein 5 family protein	coat	W6EBZ8	Rhizobium_phage	54.9	3.3e-98
AXX43212.1|4107745_4108159_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43213.1|4108162_4108555_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43214.1|4108557_4108938_+	glutamate 5-kinase	NA	A0A1B1P9E3	Acinetobacter_phage	80.5	1.5e-52
AXX43215.1|4108934_4109747_-	hypothetical protein	NA	A0A1X9I9I7	Staphylococcus_phage	39.0	2.8e-27
AXX43216.1|4109825_4110248_+	hypothetical protein	NA	A0A1B1P9D5	Acinetobacter_phage	80.0	8.0e-58
AXX43217.1|4110249_4110645_+	hypothetical protein	NA	A0A1B1P9D6	Acinetobacter_phage	93.1	8.8e-67
AXX43218.1|4110804_4111335_+	Rha family transcriptional regulator	NA	A0A1B1P9D9	Acinetobacter_phage	63.6	1.2e-55
AXX43219.1|4111331_4111529_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43220.1|4111595_4111796_+	hypothetical protein	NA	NA	NA	NA	NA
AXX43221.1|4111903_4112257_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	99.1	3.5e-59
AXX43222.1|4112256_4113408_+|tail	phage tail protein	tail	A0A0N7IRE5	Acinetobacter_phage	45.6	9.7e-74
AXX43223.1|4113504_4114422_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	97.7	1.0e-166
AXX43224.1|4114491_4115001_+	hypothetical protein	NA	A0A0D4DBX8	Acinetobacter_phage	83.6	1.9e-66
AXX43426.1|4114928_4115246_+	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	60.9	5.1e-25
AXX43225.1|4115547_4115814_-	Arc family DNA-binding protein	NA	A0A0P0IVR2	Acinetobacter_phage	100.0	6.8e-39
AXX43226.1|4115873_4116098_+	Arc family DNA-binding protein	NA	A0A0P0I460	Acinetobacter_phage	100.0	1.4e-32
AXX43227.1|4116177_4116564_+	hypothetical protein	NA	A0A0P0IKU3	Acinetobacter_phage	100.0	8.9e-64
AXX43228.1|4116560_4117313_+	phage antirepressor protein	NA	A0A0P0IDX3	Acinetobacter_phage	100.0	9.9e-136
AXX43229.1|4117364_4118306_+	hypothetical protein	NA	A0A0N7IRE6	Acinetobacter_phage	100.0	1.8e-174
