The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024771	Bacillus thuringiensis LM1212 chromosome, complete genome	5705934	34562	105500	5705934	tail,portal,protease,integrase,capsid,tRNA,head,transposase,terminase	Bacillus_phage(79.63%)	92	26751:26767	99975:99991
26751:26767	attL	TTCTTTACGAATAATTC	NA	NA	NA	NA
AXY05450.1|34562_37328_-|tRNA	isoleucine--tRNA ligase 1	tRNA	A0A2K9L9X8	Tupanvirus	26.8	2.0e-85
AXY05451.1|37677_38184_-	septum formation initiator	NA	NA	NA	NA	NA
AXY05452.1|38273_39041_-	RNA-binding protein	NA	NA	NA	NA	NA
AXY05453.1|39056_39320_-	YggT family protein	NA	NA	NA	NA	NA
AXY05454.1|39326_39797_-	cell division protein SepF	NA	NA	NA	NA	NA
AXY05455.1|39816_40491_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AXY05456.1|40487_41306_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AXY05457.1|41424_41709_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
AXY05458.1|41855_42635_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.5	5.8e-46
AXY05459.1|42792_43512_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	3.3e-19
AXY05460.1|43531_44458_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
AXY05461.1|44763_45918_-	cell division protein FtsZ	NA	NA	NA	NA	NA
AXY05462.1|45957_47265_-	cell division protein FtsA	NA	NA	NA	NA	NA
AXY05463.1|47665_48436_-	cell division protein FtsQ	NA	NA	NA	NA	NA
AXY05464.1|48534_49440_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AXY05465.1|49501_50596_-	undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AXY05466.1|50701_51793_-	stage V sporulation protein E	NA	NA	NA	NA	NA
AXY05467.1|51883_53236_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AXY05468.1|53236_54211_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AXY05469.1|54233_55709_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AXY05470.1|55913_57830_-	stage V sporulation protein D	NA	NA	NA	NA	NA
AXY05471.1|57911_60062_-	dihydropteridine reductase	NA	NA	NA	NA	NA
AXY05472.1|60083_60446_-	cell division protein FtsL	NA	NA	NA	NA	NA
AXY05473.1|60461_61394_-	ribosomal RNA small subunit methyltransferase H	NA	NA	NA	NA	NA
AXY05474.1|61763_63380_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
AXY05475.1|63459_64350_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AXY05476.1|64644_65118_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXY05477.1|65151_65658_-	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	34.7	5.1e-11
AXY05478.1|65787_65961_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AXY05479.1|66022_66523_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
AXY10934.1|66796_67378_-	hypothetical protein	NA	A0A288WG23	Bacillus_phage	78.4	2.4e-81
AXY05480.1|67355_68540_-	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	60.9	2.6e-138
AXY05481.1|68658_68841_-	hypothetical protein	NA	A0A288WGN6	Bacillus_phage	78.3	3.1e-19
AXY05482.1|68837_69134_-	hypothetical protein	NA	A0A288WG38	Bacillus_phage	52.6	1.2e-23
AXY05483.1|69318_69531_+	XRE family transcriptional regulator	NA	Q2I8E4	Bacillus_phage	100.0	2.7e-30
AXY05484.1|69523_70015_+	hypothetical protein	NA	Q3HL01	Bacillus_phage	98.2	1.2e-76
AXY05485.1|70071_70869_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	69.8	1.8e-111
AXY10935.1|70868_71012_-	hypothetical protein	NA	D2XR32	Bacillus_phage	85.1	2.3e-17
AXY05486.1|71083_71323_-	peptidase	NA	A0A1B1P7E0	Bacillus_phage	86.1	8.0e-31
AXY05487.1|71413_71746_-	hypothetical protein	NA	A0A1B2APY3	Phage_Wrath	60.7	8.8e-28
AXY05488.1|71809_73300_-	hypothetical protein	NA	A0A0S2SXW1	Bacillus_phage	41.0	1.6e-31
AXY05489.1|73358_74978_-	hypothetical protein	NA	A0A0K1LLF9	Bacillus_phage	38.3	3.6e-98
AXY05490.1|74993_75857_-|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	56.0	1.7e-75
AXY05491.1|75861_80376_-	hypothetical protein	NA	A6XMK6	Bacillus_virus	52.9	1.6e-111
AXY05492.1|80554_81016_-	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	61.8	2.5e-49
AXY05493.1|81083_81671_-|tail	phage tail protein	tail	A0A1B1P778	Bacillus_phage	85.1	3.6e-93
AXY05494.1|81672_82101_-	hypothetical protein	NA	A0A1B1P769	Bacillus_phage	85.1	1.3e-63
AXY10936.1|82087_82465_-	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	76.8	2.1e-46
AXY10937.1|82481_82838_-|head,tail	phage head-tail adapter protein	head,tail	A0A1B1P760	Bacillus_phage	86.4	2.2e-53
AXY10938.1|82818_83118_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	84.5	6.2e-41
AXY05495.1|83127_83367_-	hypothetical protein	NA	NA	NA	NA	NA
AXY05496.1|83381_84533_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	93.5	1.5e-204
AXY10939.1|84561_85287_-|protease	Clp protease ClpP	protease	A0A1B1P753	Bacillus_phage	82.6	7.9e-106
AXY05497.1|85288_86455_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	92.0	1.6e-204
AXY05498.1|86469_88152_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	94.4	1.2e-311
AXY05499.1|88135_88456_-	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	85.8	1.7e-44
AXY05500.1|88563_88872_-	hypothetical protein	NA	A0A1B1P767	Bacillus_phage	90.4	5.6e-45
AXY10940.1|88874_89069_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	95.3	1.4e-30
AXY05501.1|89182_89434_-	hypothetical protein	NA	A0A1B1P743	Bacillus_phage	52.4	9.3e-14
AXY05502.1|89438_89735_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	50.0	1.2e-07
AXY05503.1|89741_89966_-	hypothetical protein	NA	A0A1B1P745	Bacillus_phage	85.1	6.1e-25
AXY05504.1|90499_91054_-	hypothetical protein	NA	NA	NA	NA	NA
AXY05505.1|91444_91987_-|integrase	site-specific integrase	integrase	A0A1B1P746	Bacillus_phage	91.1	2.3e-89
AXY05506.1|91983_92454_-	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	63.2	7.5e-49
AXY05507.1|92474_92645_-	hypothetical protein	NA	NA	NA	NA	NA
AXY05508.1|92940_94134_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	4.3e-24
AXY05509.1|94319_94502_-	hypothetical protein	NA	NA	NA	NA	NA
AXY05510.1|94521_94644_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
AXY05511.1|94693_95119_-	hypothetical protein	NA	NA	NA	NA	NA
AXY10941.1|95154_95463_-	hypothetical protein	NA	NA	NA	NA	NA
AXY05512.1|95831_96080_-	XRE family transcriptional regulator	NA	A0A0U3J7D7	Bacillus_phage	89.0	4.2e-35
AXY05513.1|96196_96406_-	hypothetical protein	NA	A0A1B1P8C8	Bacillus_phage	68.8	6.8e-18
AXY05514.1|96431_96611_-	hypothetical protein	NA	A0A1B1P7M8	Bacillus_phage	94.5	9.2e-24
AXY05515.1|96610_96808_-	hypothetical protein	NA	A0A097BYE4	Leuconostoc_phage	38.7	6.2e-05
AXY05516.1|96845_97139_-	hypothetical protein	NA	NA	NA	NA	NA
AXY05517.1|97976_98168_-	hypothetical protein	NA	NA	NA	NA	NA
AXY05518.1|98209_98692_-	nucleotide pyrophosphohydrolase	NA	A0A0U4IBD0	Bacillus_phage	49.5	1.5e-20
AXY05519.1|98711_98963_-	helix-turn-helix domain containing protein	NA	A0A0K2CNP4	Brevibacillus_phage	42.2	4.9e-07
AXY05520.1|98988_99156_-	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.4e-13
AXY05521.1|99174_99534_-	cell division protein SepF	NA	A0A1B1P7A1	Bacillus_phage	53.3	1.1e-31
AXY05522.1|99526_99805_-	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	64.4	3.5e-14
AXY05523.1|99821_100016_-	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	81.2	1.9e-22
99975:99991	attR	TTCTTTACGAATAATTC	NA	NA	NA	NA
AXY05524.1|100018_100882_-	hypothetical protein	NA	A0A1B0T6C3	Bacillus_phage	71.1	1.3e-102
AXY05525.1|100823_101699_-	replication protein	NA	V5UQV4	Oenococcus_phage	38.3	4.2e-37
AXY05526.1|101704_101881_-	hypothetical protein	NA	A0A1B1P7U0	Bacillus_phage	82.8	6.5e-22
AXY05527.1|101910_102075_-	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	85.2	1.1e-18
AXY05528.1|102131_102332_-	DNA-binding protein	NA	A0A0U4IIS1	Bacillus_phage	48.0	3.9e-07
AXY05529.1|102384_102609_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXY05530.1|102827_103196_+	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	39.6	4.1e-10
AXY05531.1|103459_103609_-	hypothetical protein	NA	NA	NA	NA	NA
AXY05532.1|103621_104719_-	hypothetical protein	NA	NA	NA	NA	NA
AXY05533.1|105155_105500_+	XRE family transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	36.6	6.1e-16
>prophage 2
CP024771	Bacillus thuringiensis LM1212 chromosome, complete genome	5705934	656001	663680	5705934		Staphylococcus_phage(16.67%)	10	NA	NA
AXY06132.1|656001_656925_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	47.8	2.4e-46
AXY06133.1|657050_657986_-	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	25.9	4.3e-11
AXY06134.1|657987_658680_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.7	4.8e-36
AXY06135.1|658848_659022_+	hypothetical protein	NA	NA	NA	NA	NA
AXY06136.1|659022_659217_+	hypothetical protein	NA	NA	NA	NA	NA
AXY06137.1|659256_660456_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	6.1e-71
AXY06138.1|660751_661075_+	heme-degrading monooxygenase	NA	NA	NA	NA	NA
AXY06139.1|661140_661905_-	SrtB family sortase	NA	NA	NA	NA	NA
AXY06140.1|661936_662707_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.4	1.7e-05
AXY06141.1|662696_663680_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	7.1e-17
>prophage 3
CP024771	Bacillus thuringiensis LM1212 chromosome, complete genome	5705934	1031678	1109953	5705934	tail,portal,protease,integrase,coat,capsid,tRNA,holin,head,transposase,terminase	Bacillus_phage(44.68%)	86	1053480:1053497	1113523:1113540
AXY06510.1|1031678_1033055_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	28.1	2.6e-49
AXY06511.1|1033094_1033478_-	esterase	NA	NA	NA	NA	NA
AXY06512.1|1033573_1034317_+	DUF3298/DUF4163 domain-containing protein	NA	NA	NA	NA	NA
AXY06513.1|1034367_1034949_+	BioY family transporter	NA	NA	NA	NA	NA
AXY06514.1|1034990_1035878_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	52.7	7.7e-79
AXY06515.1|1035986_1037711_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.4	5.2e-180
AXY06516.1|1037854_1038460_+	hypothetical protein	NA	NA	NA	NA	NA
AXY06517.1|1038543_1040028_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	8.7e-59
AXY06518.1|1040172_1040832_-	hypothetical protein	NA	A0A0H3UZG2	Geobacillus_virus	43.9	1.0e-14
AXY06519.1|1040885_1041203_-	hypothetical protein	NA	NA	NA	NA	NA
AXY06520.1|1041199_1041706_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AXY06521.1|1041828_1043040_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXY06522.1|1043493_1044489_+	Ferredoxin--NADP reductase 2	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
AXY06523.1|1044615_1045092_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXY06524.1|1045423_1046671_+	MFS transporter	NA	NA	NA	NA	NA
AXY06525.1|1046681_1047569_-	decarboxylase	NA	NA	NA	NA	NA
AXY06526.1|1047649_1048111_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AXY06527.1|1048433_1049498_+	cytosolic protein	NA	A0A0S2MVF4	Bacillus_phage	48.8	9.2e-10
AXY06528.1|1049646_1049838_+	hypothetical protein	NA	NA	NA	NA	NA
AXY06529.1|1049851_1050118_+	hypothetical protein	NA	NA	NA	NA	NA
AXY06530.1|1050510_1051686_-	D-alanyl-D-alanine carboxypeptidase	NA	R4JG75	Mycobacterium_phage	28.5	1.2e-26
1053480:1053497	attL	GATGATGCAGCAACTACA	NA	NA	NA	NA
AXY06531.1|1053828_1054896_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	91.8	4.3e-193
AXY06532.1|1054892_1055132_-|holin	holin	holin	A0A2H4J378	uncultured_Caudovirales_phage	97.5	1.5e-32
AXY06533.1|1055131_1055368_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	97.4	1.2e-18
AXY06534.1|1055777_1059773_-	peptidase S74	NA	Q2LIB7	Bacillus_phage	85.3	0.0e+00
AXY06535.1|1059769_1061260_-|tail	phage tail protein	tail	Q2LIB8	Bacillus_phage	93.8	3.3e-276
AXY06536.1|1061265_1065126_-|tail	phage tail tape measure protein	tail	Q2I8F0	Bacillus_phage	91.1	0.0e+00
AXY06537.1|1065346_1065664_-	hypothetical protein	NA	A0A288WFU2	Bacillus_phage	100.0	1.2e-53
AXY06538.1|1065713_1066322_-|tail	phage tail protein	tail	A0A288WG55	Bacillus_phage	98.5	1.1e-103
AXY06539.1|1066322_1066682_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	95.0	2.7e-59
AXY06540.1|1066678_1067116_-	hypothetical protein	NA	A0A288WGM7	Bacillus_phage	99.3	1.0e-76
AXY06541.1|1067108_1067432_-|head,tail	head-tail adaptor protein	head,tail	H0USW8	Bacillus_phage	92.5	7.0e-54
AXY06542.1|1067428_1067707_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	94.6	5.8e-41
AXY06543.1|1067727_1068900_-|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	88.5	3.0e-195
AXY06544.1|1068937_1069648_-|protease	Clp protease ClpP	protease	A0A0S2GLD5	Bacillus_phage	96.2	1.3e-124
AXY06545.1|1069634_1070888_-|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	97.4	1.7e-236
AXY06546.1|1071076_1072771_-|terminase	terminase large subunit	terminase	A0A2H4JB98	uncultured_Caudovirales_phage	99.6	0.0e+00
AXY06547.1|1072772_1073276_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4J8E3	uncultured_Caudovirales_phage	99.4	6.7e-88
AXY06548.1|1073384_1073759_-	HNH endonuclease	NA	H0USW1	Bacillus_phage	88.5	2.0e-60
AXY06549.1|1073748_1074003_-	hypothetical protein	NA	A0A0S2GLL6	Bacillus_phage	88.1	3.8e-39
AXY06550.1|1074003_1074258_-	hypothetical protein	NA	A0A1B1P7X2	Bacillus_phage	59.3	2.8e-18
AXY06551.1|1074280_1074502_-	hypothetical protein	NA	NA	NA	NA	NA
AXY10983.1|1074716_1075106_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	57.4	3.5e-36
AXY06552.1|1075763_1076030_-	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	51.2	1.3e-13
AXY06553.1|1076073_1076232_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
AXY06554.1|1076245_1076785_-	nuclease	NA	A0A0S2SXQ1	Bacillus_phage	54.2	3.5e-50
AXY06555.1|1076787_1077216_-	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	69.5	1.5e-56
AXY06556.1|1077203_1077443_-	hypothetical protein	NA	NA	NA	NA	NA
AXY06557.1|1077768_1080111_-	DNA primase	NA	A0A2H4J990	uncultured_Caudovirales_phage	84.7	0.0e+00
AXY06558.1|1080182_1080659_-	DUF669 domain-containing protein	NA	A0A1B2AQ07	Phage_Wrath	46.9	3.0e-29
AXY06559.1|1080658_1081360_-	DNA-binding protein	NA	A0A2H4JHI2	uncultured_Caudovirales_phage	58.1	1.6e-71
AXY06560.1|1081360_1081555_-	hypothetical protein	NA	NA	NA	NA	NA
AXY06561.1|1081705_1081942_-	hypothetical protein	NA	NA	NA	NA	NA
AXY06562.1|1082215_1082416_-	hypothetical protein	NA	A0A1B1P7L2	Bacillus_phage	56.5	7.7e-11
AXY06563.1|1082678_1083467_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY06564.1|1083464_1084076_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	68.0	2.7e-75
AXY06565.1|1084096_1084285_-	transcriptional regulator	NA	A0A1B2APY7	Phage_Wrath	75.8	9.4e-19
AXY06566.1|1084296_1084494_-	hypothetical protein	NA	NA	NA	NA	NA
AXY06567.1|1084689_1085010_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXY06568.1|1085188_1085527_+	XRE family transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	35.2	1.4e-09
AXY06569.1|1085677_1087129_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY06570.1|1087250_1087427_-	hypothetical protein	NA	NA	NA	NA	NA
AXY10984.1|1087714_1088854_-	hypothetical protein	NA	H0UST6	Bacillus_phage	65.3	1.0e-139
AXY06571.1|1090373_1091435_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.6	2.1e-171
AXY06572.1|1091522_1091876_-	DUF1093 domain-containing protein	NA	A0A0K2CYS5	Paenibacillus_phage	39.5	3.2e-12
AXY10985.1|1091982_1092120_-	methyltransferase	NA	NA	NA	NA	NA
AXY06573.1|1092600_1093164_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXY06574.1|1093270_1093624_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.3	6.3e-16
AXY06575.1|1093665_1094532_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
AXY06576.1|1094777_1095017_-	hypothetical protein	NA	NA	NA	NA	NA
AXY06577.1|1095369_1096440_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXY06578.1|1096671_1096845_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
AXY06579.1|1096899_1097559_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	1.2e-23
AXY06580.1|1097542_1098340_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AXY06581.1|1098480_1098822_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
AXY06582.1|1099358_1100036_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXY06583.1|1100134_1101013_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AXY06584.1|1100981_1101290_-	DUF1462 domain-containing protein	NA	NA	NA	NA	NA
AXY06585.1|1101496_1101733_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
AXY06586.1|1101927_1102143_+	carbonic anhydrase	NA	NA	NA	NA	NA
AXY06587.1|1102204_1103206_-|coat	spore coat protein YutH	coat	NA	NA	NA	NA
AXY06588.1|1103326_1103818_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
AXY06589.1|1103838_1104318_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXY06590.1|1104820_1107397_-	permease	NA	NA	NA	NA	NA
AXY06591.1|1107377_1108166_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	1.1e-33
AXY06592.1|1108540_1109953_-|transposase	transposase	transposase	NA	NA	NA	NA
1113523:1113540	attR	GATGATGCAGCAACTACA	NA	NA	NA	NA
>prophage 4
CP024771	Bacillus thuringiensis LM1212 chromosome, complete genome	5705934	1953713	1962086	5705934		Synechococcus_phage(50.0%)	8	NA	NA
AXY07358.1|1953713_1955021_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
AXY07359.1|1955109_1955829_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	5.2e-49
AXY07360.1|1955821_1956076_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AXY07361.1|1956072_1956756_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AXY07362.1|1956739_1958959_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.0	1.3e-162
AXY07363.1|1958943_1960359_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.0	3.3e-55
AXY07364.1|1960461_1961502_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.6	9.4e-68
AXY07365.1|1961498_1962086_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.8	1.7e-26
>prophage 5
CP024771	Bacillus thuringiensis LM1212 chromosome, complete genome	5705934	1980787	2070790	5705934	tail,integrase,protease,coat,capsid,head,tRNA,holin,portal,transposase,terminase	Bacillus_phage(67.31%)	104	2003933:2003963	2043729:2043759
AXY07385.1|1980787_1982200_-|transposase	transposase	transposase	NA	NA	NA	NA
AXY11015.1|1982428_1982635_-	DUF3926 domain-containing protein	NA	NA	NA	NA	NA
AXY07386.1|1982612_1983794_-	arsenic-transporting ATPase	NA	NA	NA	NA	NA
AXY07387.1|1983871_1984354_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXY07388.1|1984585_1984822_+	hypothetical protein	NA	NA	NA	NA	NA
AXY07389.1|1984963_1985254_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit C	tRNA	NA	NA	NA	NA
AXY07390.1|1985269_1986727_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A	tRNA	NA	NA	NA	NA
AXY07391.1|1986741_1988169_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit B	tRNA	NA	NA	NA	NA
AXY07392.1|1988639_1989545_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.8	3.1e-27
AXY07393.1|1989684_1990431_+	HAD family hydrolase	NA	NA	NA	NA	NA
AXY07394.1|1990585_1991950_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
AXY07395.1|1992066_1993434_+	RNA polymerase subunit sigma-54	NA	NA	NA	NA	NA
AXY07396.1|1993426_1994878_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXY07397.1|1994925_1995249_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AXY07398.1|1995289_1996519_-	aminopeptidase	NA	NA	NA	NA	NA
AXY07399.1|1997001_1997475_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AXY07400.1|1997464_1998571_+	hypothetical protein	NA	NA	NA	NA	NA
AXY07401.1|1999597_2000701_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AXY07402.1|2000977_2002174_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AXY07403.1|2002599_2003979_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.5	5.0e-117
2003933:2003963	attL	ATACGACTCATGTGGAGTGTGTGGCTTGGCT	NA	NA	NA	NA
AXY07404.1|2004037_2005162_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	98.7	9.7e-212
AXY07405.1|2005206_2005425_+	hypothetical protein	NA	NA	NA	NA	NA
AXY07406.1|2005437_2005782_-	XRE family transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	61.3	1.2e-32
AXY07407.1|2006272_2007424_+	hypothetical protein	NA	D2XQ10	Bacillus_virus	43.3	7.0e-72
AXY07408.1|2007930_2008290_-	XRE family transcriptional regulator	NA	A0A0A7AR52	Bacillus_phage	41.2	4.3e-20
AXY07409.1|2008460_2008664_+	XRE family transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	59.7	3.4e-14
AXY07410.1|2008730_2009462_+	Rha family transcriptional regulator	NA	A0A1B1P7T7	Bacillus_phage	89.3	2.1e-122
AXY07411.1|2009505_2009856_+	DNA-binding protein	NA	A0A1B0T6C2	Bacillus_phage	81.0	4.6e-51
AXY11016.1|2009855_2010020_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	88.9	3.3e-20
AXY07412.1|2010049_2010226_+	hypothetical protein	NA	A0A0U3SQC4	Bacillus_phage	86.2	1.2e-23
AXY07413.1|2010230_2011118_+	chromosomal replication initiator DnaA	NA	A0A0U3TZZ4	Bacillus_phage	66.4	5.5e-93
AXY07414.1|2011132_2012047_+	AAA family ATPase	NA	A0A0U3U1U1	Bacillus_phage	98.7	2.9e-169
AXY07415.1|2012059_2012254_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	87.5	8.2e-26
AXY07416.1|2012270_2012549_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.3	7.4e-12
AXY07417.1|2012541_2012901_+	cell division protein SepF	NA	A0A1B1P7A1	Bacillus_phage	53.3	1.1e-31
AXY07418.1|2012919_2013087_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.4e-13
AXY07419.1|2013112_2013364_+	helix-turn-helix domain containing protein	NA	A0A1B1P7W1	Bacillus_phage	48.7	1.3e-15
AXY07420.1|2013383_2013866_+	nucleotide pyrophosphohydrolase	NA	A0A0U4IBD0	Bacillus_phage	49.5	1.5e-20
AXY07421.1|2013904_2014144_+	hypothetical protein	NA	NA	NA	NA	NA
AXY07422.1|2014364_2014697_+	hypothetical protein	NA	NA	NA	NA	NA
AXY07423.1|2014724_2015420_+	hypothetical protein	NA	A0A1I9S6E4	Bacillus_phage	81.0	8.4e-113
AXY07424.1|2015637_2015817_+	hypothetical protein	NA	NA	NA	NA	NA
AXY07425.1|2015855_2016038_+	hypothetical protein	NA	A0A0A7AR63	Bacillus_phage	54.4	2.2e-12
AXY07426.1|2016074_2016311_+	hypothetical protein	NA	NA	NA	NA	NA
AXY07427.1|2016570_2016753_+	hypothetical protein	NA	G9J254	Bacillus_phage	70.4	3.9e-14
AXY11017.1|2016781_2016964_+	hypothetical protein	NA	G9J1S8	Bacillus_phage	51.7	1.9e-08
AXY07428.1|2016974_2017097_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
AXY07429.1|2017117_2017300_+	hypothetical protein	NA	NA	NA	NA	NA
AXY07430.1|2017404_2017575_+	hypothetical protein	NA	NA	NA	NA	NA
AXY07431.1|2017595_2018072_+	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	61.0	9.3e-47
AXY07432.1|2018068_2018611_+|integrase	site-specific integrase	integrase	A0A1B1P746	Bacillus_phage	88.3	3.6e-87
AXY07433.1|2019214_2019427_+	cell division protein FtsK	NA	A0A1B1P7C1	Bacillus_phage	39.1	2.2e-08
AXY11018.1|2019628_2019862_+	hypothetical protein	NA	NA	NA	NA	NA
AXY07434.1|2019875_2020193_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	55.1	2.3e-09
AXY07435.1|2020194_2020536_+	hypothetical protein	NA	A0A1B1P7D2	Bacillus_phage	35.2	9.7e-06
AXY07436.1|2020546_2020858_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	68.0	3.8e-33
AXY07437.1|2020861_2021161_+	hypothetical protein	NA	NA	NA	NA	NA
AXY07438.1|2021267_2021591_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	87.6	5.5e-43
AXY07439.1|2021571_2023245_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	89.7	7.8e-290
AXY07440.1|2023261_2024425_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	59.4	2.3e-131
AXY07441.1|2024521_2025640_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXY07442.1|2025990_2026734_+|protease	Clp protease ClpP	protease	Q8W605	Listeria_phage	65.4	1.4e-60
AXY07443.1|2026771_2027914_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	57.8	2.5e-122
AXY07444.1|2028075_2028381_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	54.1	1.2e-18
AXY07445.1|2028364_2028712_+|head,tail	head-tail adaptor protein	head,tail	A0A1B1P760	Bacillus_phage	62.7	1.8e-31
AXY07446.1|2028701_2029088_+	hypothetical protein	NA	NA	NA	NA	NA
AXY07447.1|2029077_2029500_+	hypothetical protein	NA	R4IBU7	Listeria_phage	39.7	2.3e-20
AXY07448.1|2029506_2030100_+|tail	phage tail protein	tail	A0A1B1P778	Bacillus_phage	55.3	5.0e-58
AXY07449.1|2030118_2030571_+	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	36.3	2.1e-19
AXY07450.1|2030753_2032364_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	71.4	8.2e-103
AXY11019.1|2033976_2034999_+	hypothetical protein	NA	A0A2I7SCT8	Paenibacillus_phage	62.4	1.3e-24
AXY07451.1|2034991_2035678_+|tail	phage tail protein	tail	A0A2H4J851	uncultured_Caudovirales_phage	61.4	4.9e-81
AXY07452.1|2035674_2038290_+	hypothetical protein	NA	A0A2H4JFY7	uncultured_Caudovirales_phage	52.1	4.1e-277
AXY07453.1|2038279_2040004_+	hypothetical protein	NA	A0A2H4J855	uncultured_Caudovirales_phage	54.0	5.2e-39
AXY07454.1|2040091_2040514_+|holin	holin	holin	D2XPZ9	Bacillus_virus	97.1	1.4e-67
AXY07455.1|2040596_2041790_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	4.3e-24
AXY07456.1|2042086_2042884_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	72.1	1.3e-112
AXY07457.1|2043112_2043466_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	34.7	1.4e-10
AXY07458.1|2043868_2044858_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
2043729:2043759	attR	ATACGACTCATGTGGAGTGTGTGGCTTGGCT	NA	NA	NA	NA
AXY07459.1|2044982_2045180_+	hypothetical protein	NA	NA	NA	NA	NA
AXY07460.1|2045173_2047192_+	ATPase	NA	NA	NA	NA	NA
AXY07461.1|2047269_2047788_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	37.7	1.0e-22
AXY07462.1|2048163_2049900_-	hypothetical protein	NA	NA	NA	NA	NA
AXY07463.1|2050247_2050955_+	M48 family peptidase	NA	NA	NA	NA	NA
AXY07464.1|2051015_2051711_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXY07465.1|2051725_2052835_-	dipeptide epimerase	NA	Q6A202	Oenococcus_phage	25.5	8.6e-19
AXY07466.1|2052927_2054199_+	transcriptional regulator	NA	NA	NA	NA	NA
AXY07467.1|2054187_2055609_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
AXY07468.1|2055903_2057019_+	amidohydrolase	NA	NA	NA	NA	NA
AXY07469.1|2057151_2057760_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXY07470.1|2057763_2058510_+	hypothetical protein	NA	NA	NA	NA	NA
AXY07471.1|2058562_2060089_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	30.8	9.1e-19
AXY07472.1|2060103_2060667_-	peroxiredoxin	NA	NA	NA	NA	NA
AXY07473.1|2061257_2062487_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
AXY07474.1|2062496_2063540_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
AXY07475.1|2063595_2064237_+	fuculose phosphate aldolase	NA	NA	NA	NA	NA
AXY07476.1|2064277_2065285_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AXY07477.1|2065281_2066298_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AXY07478.1|2066370_2067288_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXY07479.1|2067620_2068583_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.2	2.7e-13
AXY07480.1|2068778_2069147_-	hypothetical protein	NA	NA	NA	NA	NA
AXY07481.1|2069328_2069568_+	hypothetical protein	NA	NA	NA	NA	NA
AXY07482.1|2069804_2070320_+|coat	spore coat protein	coat	NA	NA	NA	NA
AXY07483.1|2070340_2070790_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 6
CP024771	Bacillus thuringiensis LM1212 chromosome, complete genome	5705934	2961331	3000230	5705934	coat,bacteriocin,transposase	Acinetobacter_phage(30.0%)	42	NA	NA
AXY08296.1|2961331_2962069_+|coat	spore coat protein	coat	I7I009	Enterobacteria_phage	44.9	8.7e-52
AXY08297.1|2962077_2962623_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	44.1	3.9e-33
AXY08298.1|2962638_2963610_+	dTDP-glucose 4,6-dehydratase	NA	M1IBX1	Acanthocystis_turfacea_Chlorella_virus	44.6	5.3e-73
AXY08299.1|2963621_2964476_+	dTDP-4-dehydrorhamnose reductase	NA	H9NCE8	Sphingomonas_phage	26.6	8.1e-09
AXY08300.1|2964584_2965355_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AXY08301.1|2965496_2966045_+	hypothetical protein	NA	NA	NA	NA	NA
AXY08302.1|2966105_2966564_-|coat	spore coat protein	coat	NA	NA	NA	NA
AXY08303.1|2966689_2967049_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
AXY08304.1|2967152_2967338_+	cytochrome C oxidase subunit III	NA	NA	NA	NA	NA
AXY08305.1|2967414_2967918_-	hypothetical protein	NA	NA	NA	NA	NA
AXY08306.1|2968085_2968556_-|coat	spore coat protein	coat	NA	NA	NA	NA
AXY08307.1|2968698_2970765_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	31.8	1.8e-78
AXY08308.1|2970864_2971287_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXY08309.1|2971288_2971807_-	hypothetical protein	NA	NA	NA	NA	NA
AXY08310.1|2971899_2972631_-	esterase family protein	NA	NA	NA	NA	NA
AXY08311.1|2972834_2973746_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AXY08312.1|2974241_2974640_-	hypothetical protein	NA	NA	NA	NA	NA
AXY08313.1|2974803_2976282_-	sodium/proline symporter PutP	NA	A0A219Y9P9	Aeromonas_phage	24.6	2.6e-10
AXY08314.1|2976587_2976761_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11050.1|2977155_2978583_+	anthranilate synthase component I	NA	NA	NA	NA	NA
AXY08315.1|2978579_2979167_+	type 1 glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	47.4	3.9e-47
AXY08316.1|2979163_2980189_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.5	6.0e-51
AXY08317.1|2980190_2980952_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	41.0	1.4e-36
AXY08318.1|2980948_2981563_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AXY08319.1|2981559_2982753_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AXY08320.1|2982756_2983533_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AXY08321.1|2983607_2983967_+	hypothetical protein	NA	NA	NA	NA	NA
AXY08322.1|2984082_2985582_+	L-lactate permease	NA	NA	NA	NA	NA
AXY08323.1|2985672_2986356_+	DUF2278 domain-containing protein	NA	NA	NA	NA	NA
AXY08324.1|2986370_2987204_-	hypothetical protein	NA	NA	NA	NA	NA
AXY08325.1|2987364_2988477_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	47.5	5.5e-82
AXY08326.1|2988906_2989692_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AXY08327.1|2989711_2990947_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AXY08328.1|2990985_2991414_-	hypothetical protein	NA	NA	NA	NA	NA
AXY08329.1|2991516_2991612_+	hypothetical protein	NA	NA	NA	NA	NA
AXY08330.1|2991613_2992948_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
AXY08331.1|2993048_2993537_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXY08332.1|2993683_2994094_+	DUF3908 domain-containing protein	NA	NA	NA	NA	NA
AXY08333.1|2994124_2994715_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXY08334.1|2994807_2996349_-	NADH oxidase	NA	NA	NA	NA	NA
AXY08335.1|2996364_2998314_-|bacteriocin	bacteriocin biosynthesis protein SagD	bacteriocin	NA	NA	NA	NA
AXY08336.1|2998310_3000230_-|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
>prophage 7
CP024771	Bacillus thuringiensis LM1212 chromosome, complete genome	5705934	3145325	3224661	5705934	tail,integrase,protease,bacteriocin,capsid,head,portal,transposase,terminase	Bacillus_phage(74.0%)	69	3162561:3162578	3190206:3190223
AXY08500.1|3145325_3147212_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	34.3	1.9e-87
AXY08501.1|3147418_3148528_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	76.2	2.1e-142
AXY08502.1|3148953_3149298_-	XRE family transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	42.9	7.7e-19
AXY08503.1|3149822_3150962_+	hypothetical protein	NA	H0UST6	Bacillus_phage	37.1	8.4e-62
AXY08504.1|3151411_3151759_-	XRE family transcriptional regulator	NA	A0A0A7AR52	Bacillus_phage	91.3	4.2e-49
AXY08505.1|3151934_3152153_+	XRE family transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	90.3	4.7e-30
AXY08506.1|3152211_3152886_+	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	52.2	4.0e-59
AXY08507.1|3152923_3153199_+	DNA-binding protein	NA	A0A0U3ULL9	Bacillus_phage	86.5	2.1e-35
AXY08508.1|3153234_3153399_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	70.4	7.2e-15
AXY08509.1|3153428_3153605_+	hypothetical protein	NA	A0A0U3SQC4	Bacillus_phage	79.3	2.7e-20
AXY08510.1|3153609_3154359_+	DnaD domain protein	NA	A0A1B0T6C0	Bacillus_phage	77.9	3.8e-71
AXY08511.1|3154297_3155173_+	hypothetical protein	NA	Q2I8C8	Bacillus_phage	45.5	2.6e-63
AXY08512.1|3155188_3155383_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	78.1	1.8e-20
AXY08513.1|3155408_3155582_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	91.2	2.6e-23
AXY08514.1|3155596_3155851_+	hypothetical protein	NA	A0A1B0T6B9	Bacillus_phage	85.7	1.1e-35
AXY08515.1|3156341_3156542_+	glyoxalase	NA	A0A1B0T6B5	Bacillus_phage	92.1	6.5e-26
AXY08516.1|3156600_3156819_+	hypothetical protein	NA	NA	NA	NA	NA
AXY08517.1|3156995_3158225_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.8	5.0e-84
AXY08518.1|3158595_3159171_+	hypothetical protein	NA	A0A219UQR9	Bacillus_phage	34.7	3.7e-13
AXY08519.1|3159215_3159461_+	hypothetical protein	NA	A0A0S2MVC7	Bacillus_phage	58.0	1.6e-18
AXY08520.1|3159511_3159703_+	hypothetical protein	NA	NA	NA	NA	NA
AXY08521.1|3159744_3160047_+	hypothetical protein	NA	Q3HKX6	Bacillus_phage	73.0	2.2e-33
AXY11058.1|3160110_3160209_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
AXY08522.1|3160229_3160412_+	hypothetical protein	NA	NA	NA	NA	NA
AXY08523.1|3160597_3161791_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	4.3e-24
AXY08524.1|3162086_3162257_+	hypothetical protein	NA	NA	NA	NA	NA
AXY08525.1|3162280_3162751_+	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	67.7	4.6e-54
3162561:3162578	attL	AAAGAAAAATTGTAATTA	NA	NA	NA	NA
AXY08526.1|3162747_3163290_+|integrase	site-specific integrase	integrase	A0A1B1P746	Bacillus_phage	99.4	4.2e-96
AXY08527.1|3163893_3164106_+	cell division protein FtsK	NA	A0A1B1P7C1	Bacillus_phage	39.1	2.2e-08
AXY11059.1|3164307_3164541_+	hypothetical protein	NA	NA	NA	NA	NA
AXY08528.1|3164554_3164872_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	55.1	2.3e-09
AXY08529.1|3164873_3165215_+	hypothetical protein	NA	A0A1B1P7D2	Bacillus_phage	35.2	9.7e-06
AXY08530.1|3165225_3165537_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	68.0	3.8e-33
AXY08531.1|3165540_3165840_+	hypothetical protein	NA	NA	NA	NA	NA
AXY08532.1|3165946_3166267_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	85.8	4.2e-43
AXY08533.1|3166250_3167933_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	94.3	9.3e-312
AXY08534.1|3167947_3169105_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	93.4	3.3e-207
AXY08535.1|3169201_3170320_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXY08536.1|3170670_3171390_+|protease	Clp protease ClpP	protease	A0A2H4JC91	uncultured_Caudovirales_phage	49.4	7.7e-53
AXY08537.1|3171431_3172595_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	44.1	2.3e-86
AXY08538.1|3172609_3172834_+	hypothetical protein	NA	NA	NA	NA	NA
AXY08539.1|3172843_3173143_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	87.6	2.1e-41
AXY08540.1|3173123_3173522_+|head,tail	phage head-tail adapter protein	head,tail	A0A1B1P760	Bacillus_phage	77.1	3.9e-46
AXY08541.1|3173496_3173874_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	72.8	2.8e-46
AXY08542.1|3173860_3174289_+	hypothetical protein	NA	A0A1B1P769	Bacillus_phage	97.9	2.3e-73
AXY08543.1|3174289_3174877_+|tail	phage tail protein	tail	A0A1B1P778	Bacillus_phage	86.6	1.3e-95
AXY08544.1|3174950_3175412_+	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	94.1	2.1e-75
AXY08545.1|3175590_3177423_+	hypothetical protein	NA	A0A1B1P775	Bacillus_phage	98.9	6.0e-134
AXY08546.1|3178997_3180401_-|transposase	transposase	transposase	NA	NA	NA	NA
AXY08547.1|3181903_3183781_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	24.2	1.2e-20
AXY08548.1|3183912_3185547_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	33.6	3.8e-63
AXY11060.1|3186134_3186857_+	hypothetical protein	NA	NA	NA	NA	NA
AXY08549.1|3187162_3187348_-	Spo0E family sporulation regulatory protein-aspartic acid phosphatase	NA	NA	NA	NA	NA
AXY08550.1|3187469_3187751_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	67.2	4.0e-13
AXY08551.1|3187772_3188006_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
AXY08552.1|3188058_3188337_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	57.3	1.9e-20
AXY08553.1|3188696_3190112_-|transposase	transposase	transposase	NA	NA	NA	NA
AXY08554.1|3190630_3208750_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.8	4.8e-159
3190206:3190223	attR	TAATTACAATTTTTCTTT	NA	NA	NA	NA
AXY08555.1|3209011_3209821_+	hypothetical protein	NA	NA	NA	NA	NA
AXY08556.1|3209981_3211109_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AXY08557.1|3212051_3212783_+	phosphopantetheine-protein transferase	NA	NA	NA	NA	NA
AXY08558.1|3212993_3213278_-	hypothetical protein	NA	A0A1V0SCG6	Indivirus	34.6	8.9e-05
AXY11061.1|3213634_3214375_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	41.2	2.5e-38
AXY11062.1|3214467_3215661_-|transposase	transposase	transposase	NA	NA	NA	NA
AXY11063.1|3216068_3217262_-|transposase	transposase	transposase	NA	NA	NA	NA
AXY08559.1|3219272_3219959_+|tail	phage tail protein	tail	A0A2H4J851	uncultured_Caudovirales_phage	62.3	2.0e-82
AXY08560.1|3219955_3222571_+	hypothetical protein	NA	A0A2H4JFY7	uncultured_Caudovirales_phage	52.2	5.3e-277
AXY08561.1|3222560_3224285_+	DUF2479 domain-containing protein	NA	A0A2H4J855	uncultured_Caudovirales_phage	54.0	2.0e-38
AXY08562.1|3224430_3224661_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	93.4	5.3e-32
>prophage 8
CP024771	Bacillus thuringiensis LM1212 chromosome, complete genome	5705934	3662951	3697158	5705934	transposase	Staphylococcus_phage(33.33%)	40	NA	NA
AXY08988.1|3662951_3663740_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY08989.1|3664201_3664399_-	hypothetical protein	NA	NA	NA	NA	NA
AXY08990.1|3665353_3665677_-	transcriptional regulator	NA	NA	NA	NA	NA
AXY08991.1|3665796_3666333_+	flavodoxin family protein	NA	NA	NA	NA	NA
AXY11082.1|3666476_3667970_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.0	5.2e-35
AXY08992.1|3668135_3668681_+	N-acetyltransferase	NA	G9BWD5	Planktothrix_phage	31.8	2.1e-10
AXY08993.1|3668826_3669390_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXY08994.1|3669386_3670091_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AXY08995.1|3670084_3670864_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXY08996.1|3670875_3671775_+	isomerase	NA	NA	NA	NA	NA
AXY08997.1|3671807_3672017_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11083.1|3672192_3672996_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
AXY08998.1|3673059_3673617_+	hypothetical protein	NA	NA	NA	NA	NA
AXY08999.1|3673642_3674470_+	hypothetical protein	NA	NA	NA	NA	NA
AXY09000.1|3674486_3675053_+	esterase	NA	A0A0N9RRL9	Staphylococcus_phage	27.0	3.6e-05
AXY09001.1|3675097_3675514_-	SRPBCC family protein	NA	NA	NA	NA	NA
AXY09002.1|3675594_3676605_-	aldo/keto reductase	NA	NA	NA	NA	NA
AXY09003.1|3677007_3677352_+	HxlR family transcriptional regulator	NA	NA	NA	NA	NA
AXY09004.1|3677544_3677871_+	transcriptional regulator	NA	NA	NA	NA	NA
AXY09005.1|3678180_3679371_+	class I SAM-dependent methyltransferase	NA	A0A2K9L0U7	Tupanvirus	40.2	5.9e-50
AXY09006.1|3679587_3680649_+	oxidoreductase	NA	NA	NA	NA	NA
AXY09007.1|3680681_3681419_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXY09008.1|3681485_3681827_-	transcriptional regulator	NA	NA	NA	NA	NA
AXY09009.1|3681839_3682019_+	hypothetical protein	NA	NA	NA	NA	NA
AXY09010.1|3682409_3682805_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AXY09011.1|3682852_3682987_+	hypothetical protein	NA	NA	NA	NA	NA
AXY09012.1|3683096_3683231_+	hypothetical protein	NA	NA	NA	NA	NA
AXY09013.1|3683394_3683808_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AXY09014.1|3683935_3684271_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
AXY09015.1|3684540_3685330_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY09016.1|3685405_3686599_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	24.8	9.6e-24
AXY09017.1|3686894_3687596_+	hypothetical protein	NA	NA	NA	NA	NA
AXY09018.1|3687700_3688489_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY09019.1|3688752_3688965_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11084.1|3689458_3690775_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09020.1|3691053_3692142_-	glycosyl transferase	NA	S5WBE2	Pseudomonas_phage	22.2	4.6e-09
AXY11085.1|3692344_3693637_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09021.1|3693838_3694111_+	hypothetical protein	NA	NA	NA	NA	NA
AXY09022.1|3694276_3695395_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXY09023.1|3695745_3697158_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
CP024771	Bacillus thuringiensis LM1212 chromosome, complete genome	5705934	4254000	4261504	5705934		Geobacillus_phage(28.57%)	10	NA	NA
AXY09555.1|4254000_4254807_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	68.5	4.7e-107
AXY09556.1|4254871_4255084_-	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	52.9	9.6e-12
AXY09557.1|4255086_4256472_-	S-layer protein	NA	Q0H255	Geobacillus_phage	59.5	2.7e-78
AXY09558.1|4256918_4257323_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXY09559.1|4257338_4257692_+	cytoplasmic protein	NA	NA	NA	NA	NA
AXY09560.1|4257713_4258421_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	27.0	1.1e-16
AXY09561.1|4258486_4258873_+	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
AXY09562.1|4258894_4259398_+	topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	45.5	3.6e-41
AXY09563.1|4259544_4260225_+	cytoplasmic protein	NA	A0A075BUR2	Microcystis_phage	38.7	7.8e-31
AXY09564.1|4260310_4261504_+	glycosyl transferase family 1	NA	B0LUM8	Spodoptera_litura_multicapsid_nucleopolyhedrovirus	27.2	9.9e-13
>prophage 10
CP024771	Bacillus thuringiensis LM1212 chromosome, complete genome	5705934	4642973	4667465	5705934	tail,transposase,holin	Bacillus_phage(88.24%)	29	NA	NA
AXY09912.1|4642973_4644167_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	4.3e-24
AXY09913.1|4644463_4645246_+	arginase	NA	NA	NA	NA	NA
AXY09914.1|4645920_4647393_-	recombinase family protein	NA	Q2XVV3	Bacillus_phage	54.4	5.7e-143
AXY09915.1|4647727_4647955_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09916.1|4648006_4648240_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09917.1|4648236_4648860_-	hypothetical protein	NA	H0USY2	Bacillus_phage	79.6	1.4e-95
AXY09918.1|4648801_4649992_-	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	64.9	9.8e-146
AXY09919.1|4650107_4650290_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	1.5e-21
AXY09920.1|4650286_4650589_-	hypothetical protein	NA	A0A288WG38	Bacillus_phage	54.1	3.4e-26
AXY09921.1|4650588_4650855_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09922.1|4651040_4651241_+	XRE family transcriptional regulator	NA	Q2I8E4	Bacillus_phage	53.0	2.4e-12
AXY09923.1|4651996_4652347_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09924.1|4652526_4652766_+	XRE family transcriptional regulator	NA	A0A288WFZ7	Bacillus_phage	67.1	2.0e-21
AXY09925.1|4652842_4653175_+	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	43.5	7.0e-17
AXY09926.1|4653196_4653478_+	hypothetical protein	NA	NA	NA	NA	NA
AXY09927.1|4653544_4654300_-	N-acetylmuramoyl-L-alanine amidase	NA	S5M842	Bacillus_phage	75.3	8.5e-103
AXY09928.1|4654316_4654547_-|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	75.0	2.2e-25
AXY09929.1|4654561_4654846_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09930.1|4655046_4655604_-	hypothetical protein	NA	D2XPZ8	Bacillus_virus	70.1	8.3e-71
AXY09931.1|4655618_4657028_-	hypothetical protein	NA	A0A1B1P836	Bacillus_phage	34.7	8.9e-45
AXY09932.1|4656985_4657775_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY09933.1|4657813_4658047_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09934.1|4658069_4658327_-	hypothetical protein	NA	A0A1B1P7E8	Bacillus_phage	76.5	1.2e-32
AXY09935.1|4658353_4660732_-	hypothetical protein	NA	A0A1B1P7E6	Bacillus_phage	35.1	1.9e-180
AXY09936.1|4660728_4662240_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	58.0	1.1e-160
AXY11123.1|4662252_4665900_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	41.3	3.7e-42
AXY09937.1|4666185_4666479_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09938.1|4666529_4666907_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09939.1|4666967_4667465_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
>prophage 11
CP024771	Bacillus thuringiensis LM1212 chromosome, complete genome	5705934	4671269	4686258	5705934	portal,transposase	Bacillus_phage(41.67%)	22	NA	NA
AXY09946.1|4671269_4672043_-	scaffolding protein	NA	Q4ZC70	Staphylococcus_virus	40.9	7.3e-09
AXY09947.1|4672110_4673628_-|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	30.0	4.0e-67
AXY09948.1|4673644_4675360_-	hypothetical protein	NA	A0A142F1L6	Bacillus_phage	53.9	1.3e-154
AXY09949.1|4675376_4675844_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	51.1	1.7e-32
AXY09950.1|4675999_4676563_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	46.0	1.3e-34
AXY09951.1|4676962_4677352_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09952.1|4677610_4677937_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09953.1|4678084_4678264_-	hypothetical protein	NA	A0A1B1P7M4	Bacillus_phage	64.0	3.3e-13
AXY09954.1|4678260_4678788_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09955.1|4678765_4679224_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11125.1|4679226_4679394_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09956.1|4679420_4679618_-	hypothetical protein	NA	A0A1L2JY50	Aeribacillus_phage	49.1	8.6e-07
AXY09957.1|4679622_4679901_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	5.1e-13
AXY09958.1|4679925_4680120_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09959.1|4680238_4680385_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09960.1|4680387_4681365_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09961.1|4681381_4681699_-	transglycosylase	NA	NA	NA	NA	NA
AXY09962.1|4681714_4682362_-	hypothetical protein	NA	NA	NA	NA	NA
AXY09963.1|4682358_4682769_-	hypothetical protein	NA	S5MUC4	Brevibacillus_phage	59.3	1.3e-12
AXY09964.1|4682811_4684353_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	38.4	4.3e-117
AXY09965.1|4684383_4684581_-	hypothetical protein	NA	A0A1B1P7W9	Bacillus_phage	76.9	1.9e-22
AXY09966.1|4685064_4686258_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	24.8	9.6e-24
>prophage 12
CP024771	Bacillus thuringiensis LM1212 chromosome, complete genome	5705934	5131179	5140498	5705934		Bacillus_phage(71.43%)	9	NA	NA
AXY10393.1|5131179_5132052_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	45.1	1.1e-66
AXY10394.1|5132185_5132857_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	92.7	3.7e-65
AXY10395.1|5133004_5133733_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	6.0e-61
AXY10396.1|5133913_5134507_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
AXY11150.1|5134530_5135586_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	90.3	9.3e-172
AXY10397.1|5135600_5136365_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	94.0	1.1e-121
AXY10398.1|5136366_5138127_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	96.9	1.1e-270
AXY10399.1|5138367_5139132_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXY10400.1|5139229_5140498_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	7.6e-11
>prophage 13
CP024771	Bacillus thuringiensis LM1212 chromosome, complete genome	5705934	5285621	5396224	5705934	tail,integrase,protease,portal,capsid,holin,head,transposase,terminase	Bacillus_phage(80.0%)	113	5325324:5325383	5396216:5397065
AXY10533.1|5285621_5286411_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY10534.1|5287050_5287962_-	hypothetical protein	NA	NA	NA	NA	NA
AXY10535.1|5288247_5288667_+	hypothetical protein	NA	NA	NA	NA	NA
AXY10536.1|5288783_5289875_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11160.1|5290188_5290500_-	hypothetical protein	NA	NA	NA	NA	NA
AXY10537.1|5290714_5290924_+	hypothetical protein	NA	NA	NA	NA	NA
AXY10538.1|5291131_5291977_-	exonuclease	NA	G3MBN3	Bacillus_virus	28.0	3.7e-14
AXY10539.1|5292167_5292368_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	5.0e-18
AXY10540.1|5292584_5293484_-	hypothetical protein	NA	NA	NA	NA	NA
AXY10541.1|5293500_5293944_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	32.3	1.1e-09
AXY10542.1|5294083_5294704_-	transcriptional regulator	NA	NA	NA	NA	NA
AXY10543.1|5294790_5295186_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AXY10544.1|5295182_5295524_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
AXY10545.1|5295634_5296192_+	antibiotic acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	51.4	2.2e-39
AXY10546.1|5296238_5303711_-	hypothetical protein	NA	NA	NA	NA	NA
AXY10547.1|5303827_5304577_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AXY10548.1|5304612_5305446_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXY10549.1|5305512_5307021_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AXY10550.1|5307122_5308232_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AXY10551.1|5308349_5309282_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AXY10552.1|5309399_5310839_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AXY10553.1|5310842_5311121_-	DUF997 domain-containing protein	NA	NA	NA	NA	NA
AXY10554.1|5311394_5312879_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AXY10555.1|5312929_5313670_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.2	9.8e-19
AXY10556.1|5314174_5316028_-	squalene--hopene cyclase	NA	NA	NA	NA	NA
AXY10557.1|5316127_5316553_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
AXY10558.1|5316632_5317574_-	EamA family transporter RarD	NA	NA	NA	NA	NA
AXY10559.1|5317666_5317915_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AXY10560.1|5318073_5318472_-	hypothetical protein	NA	NA	NA	NA	NA
AXY10561.1|5318514_5318739_-	group-specific protein	NA	NA	NA	NA	NA
AXY10562.1|5318752_5319802_-	MRP family ATP-binding protein	NA	NA	NA	NA	NA
AXY10563.1|5320020_5320257_-	molybdopterin converting factor subunit 1	NA	NA	NA	NA	NA
AXY10564.1|5320261_5320726_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
AXY10565.1|5320706_5322014_-	molybdopterin molybdenumtransferase	NA	NA	NA	NA	NA
AXY10566.1|5322032_5323049_-	thiamine biosynthesis protein MoeB	NA	NA	NA	NA	NA
AXY10567.1|5323073_5323853_-	formate/nitrite transporter	NA	NA	NA	NA	NA
AXY10568.1|5323839_5323947_-	hypothetical protein	NA	NA	NA	NA	NA
AXY10569.1|5324053_5325070_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
5325324:5325383	attL	AGAACCTGTCTAAAATCTATGGTATACTCTGTGTAAAAAAGGATGATTTCCATGATACAC	NA	NA	NA	NA
AXY10570.1|5325374_5326163_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY10571.1|5326731_5327076_-	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
AXY10572.1|5327191_5327674_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AXY10573.1|5330309_5331134_+	cytosolic protein	NA	A0A2H4J969	uncultured_Caudovirales_phage	75.0	3.2e-111
AXY10574.1|5331143_5331764_-	hypothetical protein	NA	H0USY2	Bacillus_phage	84.0	8.0e-99
AXY10575.1|5331705_5332887_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	82.7	1.4e-189
AXY10576.1|5333002_5333185_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.0e-22
AXY10577.1|5333181_5333499_-	hypothetical protein	NA	H0USY0	Bacillus_phage	95.2	3.5e-50
AXY10578.1|5333702_5333906_+	XRE family transcriptional regulator	NA	Q2I8E4	Bacillus_phage	51.5	2.4e-12
AXY10579.1|5333910_5334489_+	hypothetical protein	NA	A0A288WFT6	Bacillus_phage	72.6	1.0e-79
AXY10580.1|5334555_5335308_-	N-acetylmuramoyl-L-alanine amidase	NA	S5M842	Bacillus_phage	74.0	5.2e-100
AXY10581.1|5335324_5335555_-|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	92.1	5.3e-32
AXY10582.1|5335597_5335837_-	peptidase	NA	A0A1B1P7E0	Bacillus_phage	100.0	7.4e-37
AXY10583.1|5335852_5336821_-|integrase	integrase	integrase	D2XR30	Bacillus_phage	94.7	2.6e-176
AXY10584.1|5336969_5338694_-	DUF2479 domain-containing protein	NA	A0A2H4J855	uncultured_Caudovirales_phage	54.0	2.0e-38
AXY10585.1|5338683_5341299_-	hypothetical protein	NA	A0A2H4JFY7	uncultured_Caudovirales_phage	52.2	5.3e-277
AXY10586.1|5341295_5341982_-|tail	phage tail protein	tail	A0A2H4J851	uncultured_Caudovirales_phage	62.3	2.0e-82
AXY11161.1|5341974_5344824_-	hypothetical protein	NA	A0A1B1P764	Bacillus_phage	85.1	1.8e-209
AXY10587.1|5345047_5346880_-	hypothetical protein	NA	A0A1B1P775	Bacillus_phage	98.9	6.0e-134
AXY10588.1|5347058_5347520_-	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	94.1	2.1e-75
AXY10589.1|5347593_5348181_-|tail	phage tail protein	tail	A0A1B1P778	Bacillus_phage	86.6	1.3e-95
AXY10590.1|5348181_5348610_-	hypothetical protein	NA	A0A1B1P769	Bacillus_phage	97.9	2.3e-73
AXY10591.1|5348596_5348974_-	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	72.8	2.8e-46
AXY10592.1|5348948_5349347_-|head,tail	phage head-tail adapter protein	head,tail	A0A1B1P760	Bacillus_phage	77.1	3.9e-46
AXY10593.1|5349327_5349627_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	87.6	2.1e-41
AXY10594.1|5349636_5349861_-	hypothetical protein	NA	NA	NA	NA	NA
AXY10595.1|5349875_5351039_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	44.1	2.3e-86
AXY10596.1|5351080_5351800_-|protease	Clp protease ClpP	protease	A0A2H4JC91	uncultured_Caudovirales_phage	49.4	1.0e-52
AXY10597.1|5351786_5352953_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	93.8	5.6e-210
AXY10598.1|5352967_5354650_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	94.3	9.3e-312
AXY10599.1|5354633_5354954_-	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	85.8	4.2e-43
AXY10600.1|5355060_5355360_-	hypothetical protein	NA	NA	NA	NA	NA
AXY10601.1|5355363_5355675_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	68.0	3.8e-33
AXY10602.1|5355685_5356027_-	hypothetical protein	NA	A0A1B1P7D2	Bacillus_phage	35.2	9.7e-06
AXY10603.1|5356028_5356346_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	55.1	2.3e-09
AXY11162.1|5356359_5356593_-	hypothetical protein	NA	NA	NA	NA	NA
AXY10604.1|5356794_5357007_-	cell division protein FtsK	NA	A0A1B1P7C1	Bacillus_phage	39.1	2.2e-08
AXY10605.1|5357611_5358154_-|integrase	site-specific integrase	integrase	A0A1B1P746	Bacillus_phage	91.1	2.3e-89
AXY10606.1|5358150_5358621_-	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	63.2	7.5e-49
AXY10607.1|5358641_5358812_-	hypothetical protein	NA	NA	NA	NA	NA
AXY10608.1|5359107_5360301_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	4.3e-24
AXY10609.1|5360486_5360669_-	hypothetical protein	NA	NA	NA	NA	NA
AXY10610.1|5360688_5360811_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
AXY10611.1|5360860_5361286_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11163.1|5361321_5361630_-	hypothetical protein	NA	NA	NA	NA	NA
AXY10612.1|5362408_5362573_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	98.1	2.9e-24
AXY10613.1|5362623_5362890_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	85.2	4.1e-36
AXY10614.1|5362886_5363189_-	helix-turn-helix domain containing protein	NA	A0A1B1P7W1	Bacillus_phage	51.6	2.0e-18
AXY10615.1|5363192_5363999_-	hypothetical protein	NA	D2XQ17	Bacillus_virus	81.6	1.8e-122
AXY10616.1|5365116_5365764_-	sigma-70 family RNA polymerase sigma factor	NA	H0USU1	Bacillus_phage	84.7	2.6e-100
AXY10617.1|5366019_5366352_-	hypothetical protein	NA	W8CYU1	Bacillus_phage	88.9	1.5e-43
AXY10618.1|5366514_5367309_-	phage regulatory protein	NA	A0A0S2GLP8	Bacillus_phage	93.6	4.9e-133
AXY10619.1|5367521_5367710_-	XRE family transcriptional regulator	NA	W8CYN7	Bacillus_phage	93.5	6.7e-25
AXY10620.1|5367777_5367984_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXY10621.1|5368153_5368498_+	XRE family transcriptional regulator	NA	H0UST7	Bacillus_phage	41.5	6.1e-16
AXY10622.1|5368898_5370119_-	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	49.5	2.2e-108
AXY10623.1|5370859_5371951_+|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	79.3	1.8e-162
AXY10624.1|5371924_5372650_-	formate dehydrogenase	NA	NA	NA	NA	NA
AXY10625.1|5373064_5374603_+	spore germination protein	NA	NA	NA	NA	NA
AXY10626.1|5374599_5375697_+	spore gernimation protein	NA	NA	NA	NA	NA
AXY10627.1|5375697_5376834_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
AXY10628.1|5376912_5377047_-	phosphonate ABC transporter permease	NA	NA	NA	NA	NA
AXY10629.1|5377104_5380467_-	phosphonate ABC transporter permease	NA	NA	NA	NA	NA
AXY10630.1|5380545_5382645_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AXY10631.1|5382902_5383241_-	VOC family protein	NA	NA	NA	NA	NA
AXY10632.1|5383311_5383647_-	hypothetical protein	NA	NA	NA	NA	NA
AXY10633.1|5383781_5384177_+	hypothetical protein	NA	NA	NA	NA	NA
AXY10634.1|5384218_5384938_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXY10635.1|5385051_5386758_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXY10636.1|5387038_5388745_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXY11164.1|5389121_5390819_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXY10637.1|5392649_5393687_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AXY10638.1|5393704_5394733_-	anti-sigma factor	NA	NA	NA	NA	NA
AXY10639.1|5394745_5395279_-	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
AXY10640.1|5395434_5396224_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
5396216:5397065	attR	GTGTATCATGGAAATCATCCTTTTTTACACAGAGTATACCATAGATTTTAGACAGGTTCTAAGGAAATATCCATCTGGATCCACGACTTTAAATCCTCTCATCTCCCACGGATAAGTTTGAATTTCTTCTTGTATTGTGCATCGCTTCTCTTTACAACGTTCATATACGTCTTCAATGCGGTCGACAACAATAATTAGTTCAAATCCATTCCCTTTCATTTCTTTTCGATCGTAAAAATTGTGATTTTCACTCAATGTTGAATCATTAGCTAGTAATAGCGAAAACTAATCGTAATTAAAACGCGCTGCGTACATACTTCTTTTATACAGCTTTAAACCAATTACTTCTCCATAGAACAATAATGACTTTTCGATATCATTTACATATAGCTGAACCCGGAACCAATGATTCATCCATTTCCTCCTCATCAAAAAAAGCCCACTTTTCCAGTGGACTTTCTACTTTACAACGGTAAATCCCTCTTCTTAAACACTATAATTGCTACTATGAAAATACAAAGTGCTCCAGCTGTTAAACCTATACTCACTGGCCATATATTATACGTTCCCTCAGCAATTTCTTTCGGACGAAATAGCGTAAATAATGATATATTTCTCATCCACTCTAACTTATCACTTAATTTACCTACCATATCCGTTACGAAAAATAAAATGGTTAAACTTGCTGAGTAGCTAAGTGCCTTTCTTTCGTCATTACATATACAAGAAAAGAAAAATGAATACGCACTAACGACGAAAAATATGAGCCCTCCAACTATATTTATCTTCAGGAATAATTCTTTATTTAAGTTATTATCTTGTAAAAACCATTCCGCACCTACTATGCCCG	NA	NA	NA	NA
>prophage 1
CP024772	Bacillus thuringiensis LM1212 plasmid pLM1, complete sequence	248002	0	1940	248002		Bacillus_phage(100.0%)	1	NA	NA
AXY11173.1|680_1940_+	hypothetical protein	NA	A0A125RQ78	Bacillus_phage	68.3	9.4e-171
>prophage 2
CP024772	Bacillus thuringiensis LM1212 plasmid pLM1, complete sequence	248002	5403	92056	248002	transposase	Streptococcus_phage(64.0%)	55	NA	NA
AXY11175.1|5403_6111_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	9.6e-40
AXY11331.1|6667_7375_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	9.6e-40
AXY11176.1|8904_9612_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.9	1.1e-38
AXY11333.1|10365_10734_+	hypothetical protein	NA	A0A1B1P8B2	Bacillus_phage	90.5	1.6e-54
AXY11332.1|11348_12056_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	2.4e-38
AXY11177.1|14136_15756_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11178.1|15919_18511_+	iota toxin protein Ib	NA	A0A1V0E026	Clostridioides_phage	42.0	7.1e-141
AXY11179.1|18585_19275_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	60.0	9.6e-69
AXY11180.1|19789_21694_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11181.1|21742_24298_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11182.1|24385_24967_-	ABC transporter permease	NA	NA	NA	NA	NA
AXY11183.1|26970_27633_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.5	6.5e-30
AXY11184.1|28293_29001_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	1.1e-38
AXY11185.1|30915_33321_+	PAS domain-containing sensor histidine kinase	NA	A0A2K9L5I4	Tupanvirus	24.7	1.9e-07
AXY11186.1|35472_35742_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11187.1|36051_36841_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY11334.1|37640_37940_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11188.1|38030_40658_+	iota toxin protein Ib	NA	A0A1V0E026	Clostridioides_phage	41.9	4.0e-139
AXY11189.1|41292_42082_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY11190.1|42842_44540_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11191.1|45386_45602_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11192.1|45589_47290_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11193.1|49555_52876_+	Iota toxin protein Ib	NA	A0A1V0E026	Clostridioides_phage	32.9	2.1e-116
AXY11194.1|53334_54042_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.9	6.2e-39
AXY11195.1|54198_55650_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11196.1|58359_58746_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXY11197.1|58807_59719_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.3	1.1e-08
AXY11198.1|60365_61073_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	1.8e-38
AXY11199.1|61550_61763_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11200.1|63838_64628_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY11201.1|65219_66281_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.4	2.0e-12
AXY11202.1|68273_69440_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11203.1|69467_69887_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11204.1|70531_71239_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.0	2.0e-37
AXY11205.1|71426_72104_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11206.1|72482_72671_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11207.1|72892_73231_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11208.1|73320_73527_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11209.1|73532_73697_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11210.1|73862_74090_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11211.1|74926_75634_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	9.6e-40
AXY11212.1|75650_76085_-	hypothetical protein	NA	A0A1X9I6E7	Streptococcus_phage	47.9	2.0e-27
AXY11213.1|76834_78232_+	hypothetical protein	NA	M1I2Z8	Paramecium_bursaria_Chlorella_virus	37.5	4.1e-66
AXY11214.1|78372_79080_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	7.4e-40
AXY11215.1|79773_80703_+	ATPase	NA	NA	NA	NA	NA
AXY11216.1|80955_81663_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	1.4e-38
AXY11217.1|81775_81985_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11218.1|82305_83868_-	toxin	NA	A0A0K2CYN4	Paenibacillus_phage	27.2	2.1e-18
AXY11219.1|84663_85371_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	2.4e-38
AXY11220.1|85691_86516_-	type-1Aa cytolytic delta-endotoxin	NA	NA	NA	NA	NA
AXY11221.1|88023_88731_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	2.1e-39
AXY11222.1|89083_89770_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11223.1|89878_90184_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11224.1|90579_90948_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11225.1|91266_92056_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP024772	Bacillus thuringiensis LM1212 plasmid pLM1, complete sequence	248002	95306	95894	248002		Bacillus_phage(100.0%)	1	NA	NA
AXY11226.1|95306_95894_-	hypothetical protein	NA	A0A1Z1LZN4	Bacillus_phage	36.3	2.3e-10
>prophage 4
CP024772	Bacillus thuringiensis LM1212 plasmid pLM1, complete sequence	248002	102738	167873	248002	bacteriocin,integrase,transposase	Streptococcus_phage(53.33%)	57	91255:91314	118492:119344
91255:91314	attL	CTAAGAATCTGTCTAAAATCTTTTCAATAAAATTGCCACACTTGCCAATAAGCAACTCTG	NA	NA	NA	NA
AXY11230.1|102738_103899_-|integrase	integrase	integrase	NA	NA	NA	NA
AXY11231.1|104416_104614_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11232.1|104880_105210_+	hypothetical protein	NA	A0A1B1P776	Bacillus_phage	36.6	1.1e-09
AXY11233.1|105244_105952_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	1.1e-38
AXY11234.1|106555_106756_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11235.1|106788_107751_+|integrase	integrase	integrase	NA	NA	NA	NA
AXY11236.1|108126_109020_-	ATPase	NA	NA	NA	NA	NA
AXY11237.1|109682_109988_-	transcriptional regulator	NA	NA	NA	NA	NA
AXY11238.1|110081_110789_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	2.4e-38
AXY11239.1|110854_111232_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.0	5.0e-27
AXY11240.1|112324_113554_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.8	5.0e-84
AXY11241.1|114032_114284_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11242.1|115819_116926_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11243.1|116915_117389_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AXY11244.1|117673_117925_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11245.1|118323_118521_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11246.1|118503_119293_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY11247.1|119270_119459_-	hypothetical protein	NA	NA	NA	NA	NA
118492:119344	attR	CTAAGAATCTGTCTAAAATCTTTTCAATAAAATTGCCACACTTGCCAATAAGCAACTCTGTCTACTATTTTCAAGTGTTCGTTCACAATTCTTCCACAGTCTACGGTAATTTTCCAACCAGGCAAAGGTGCGTTCCACAATCCAGCGTTTTGGTAACACGACAAATTTGTGAAGTTCAGAGCGTTTGATGATTTCAACTGAACAATCAATCGTTTCTTTTATTGATTGCGCAAAGGATGGCCCTGTATATCCGCCATCACAAAGTATATTTGTCACTTTTTCCAATGTTTTCTTATGTCTTTCACACATTTGGATGGCGCCCTCTCGGTCTGTTATGTTCGCAGTTGTTACATCAATTGCATGAATGAGACCGTTCGTATCTACAGCAATATGACGTTTGATTCCTGACACTTTCTTTCCAGCATCATAACCCTTTTCACCAGCTATCCATGTGTTTTTCACGCTTTGTGCATCTACGATGCAGAAACTTGTCTGATTCTTACGTCCATCTTGCTCGCGATAGGTTTCAACCAATTTTTTTATGCACTTTTTCGAGAAGACTTATGCCATTCTCGTCTACTTTCCGCCAAATTTGATAGTAAGCATACACGGTTTTCCAGTGTGGAAAGTCACTTGGCAGATTGCGCCATTGGCAGCCTGTTGTGAGCAGATATAAGACGCCACAGAATACTTCATACAAATCGACTGTGCGGGGGCGCGTCTTTTTACGGGCATTTTCTAAATCTTCACGAATCAGTTCAAACTGTTCACGAGTAATATTACTTGTATAATTGTGTATCATGGAAATCATCCTTTTTTACACAGAGTATACCATAGATTTTAGACAGGTTCT	NA	NA	NA	NA
AXY11248.1|119773_120016_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11249.1|120122_120368_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11250.1|120415_120943_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11251.1|121605_123018_-|transposase	transposase	transposase	NA	NA	NA	NA
AXY11252.1|123889_125089_-	macrolide ABC transporter permease	NA	NA	NA	NA	NA
AXY11253.1|125085_125766_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.1	8.1e-36
AXY11254.1|125762_126956_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXY11255.1|127292_127616_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
AXY11256.1|127700_129407_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11257.1|129411_129921_+	stage II sporulation protein M	NA	NA	NA	NA	NA
AXY11258.1|129934_130483_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11259.1|130472_131111_+	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	26.4	5.5e-10
AXY11260.1|131073_131301_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11261.1|131851_132127_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11262.1|132145_132823_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	30.5	6.0e-15
AXY11263.1|133119_133419_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11264.1|133528_133861_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AXY11265.1|134070_134664_+	cell division protein FtsN	NA	NA	NA	NA	NA
AXY11266.1|134797_134989_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11267.1|135214_135448_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AXY11268.1|135469_135751_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	1.1e-10
AXY11269.1|135876_136182_-	transcriptional regulator	NA	NA	NA	NA	NA
AXY11270.1|136297_136882_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11335.1|137601_138309_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	1.4e-38
AXY11271.1|138941_139731_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY11272.1|140467_141142_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11273.1|142692_142881_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11274.1|142838_143628_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY11275.1|144358_145060_-	ADP-ribosyltransferase	NA	Q331X8	Clostridium_botulinum_C_phage	35.3	4.9e-28
AXY11276.1|145253_147854_-	iota toxin protein Ib	NA	A0A1V0E026	Clostridioides_phage	39.3	1.6e-140
AXY11277.1|148050_148242_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11278.1|148261_148498_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11279.1|156261_157050_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY11280.1|157244_157952_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	1.4e-38
AXY11281.1|158405_160397_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11282.1|160985_161693_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.0	2.6e-37
AXY11283.1|162358_163861_-	endoglycoceramidase	NA	NA	NA	NA	NA
AXY11284.1|164460_166791_-	carbohydrate-binding cenc domain protein	NA	NA	NA	NA	NA
AXY11285.1|167165_167873_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	1.8e-38
>prophage 5
CP024772	Bacillus thuringiensis LM1212 plasmid pLM1, complete sequence	248002	170921	171959	248002		Lactococcus_phage(100.0%)	1	NA	NA
AXY11288.1|170921_171959_+	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	34.4	6.6e-37
>prophage 6
CP024772	Bacillus thuringiensis LM1212 plasmid pLM1, complete sequence	248002	181751	182468	248002	transposase	Streptococcus_phage(100.0%)	1	NA	NA
AXY11336.1|181751_182468_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.0	9.1e-38
>prophage 7
CP024772	Bacillus thuringiensis LM1212 plasmid pLM1, complete sequence	248002	191098	191806	248002	transposase	Streptococcus_phage(100.0%)	1	NA	NA
AXY11294.1|191098_191806_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.0	1.5e-37
>prophage 8
CP024772	Bacillus thuringiensis LM1212 plasmid pLM1, complete sequence	248002	202570	203278	248002	transposase	Streptococcus_phage(100.0%)	1	NA	NA
AXY11340.1|202570_203278_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	4.0e-38
>prophage 9
CP024772	Bacillus thuringiensis LM1212 plasmid pLM1, complete sequence	248002	208303	209533	248002	transposase	Streptococcus_phage(100.0%)	1	NA	NA
AXY11304.1|208303_209533_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.8	5.9e-85
>prophage 10
CP024772	Bacillus thuringiensis LM1212 plasmid pLM1, complete sequence	248002	215135	223342	248002	transposase	Streptococcus_phage(60.0%)	7	NA	NA
AXY11307.1|215135_216365_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	3.8e-84
AXY11308.1|216554_218552_-	ABC transporter permease	NA	NA	NA	NA	NA
AXY11309.1|218538_219306_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	2.5e-33
AXY11310.1|219633_220644_-	sensor histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	28.8	3.8e-05
AXY11311.1|220640_221315_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXY11312.1|221398_222106_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	2.1e-39
AXY11341.1|222634_223342_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	1.4e-38
>prophage 11
CP024772	Bacillus thuringiensis LM1212 plasmid pLM1, complete sequence	248002	232029	235915	248002	transposase	Streptococcus_phage(100.0%)	3	NA	NA
AXY11318.1|232029_232737_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	9.6e-40
AXY11319.1|233665_233884_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11320.1|235207_235915_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	2.4e-38
>prophage 12
CP024772	Bacillus thuringiensis LM1212 plasmid pLM1, complete sequence	248002	239404	241480	248002	holin,transposase	uncultured_Caudovirales_phage(66.67%)	3	NA	NA
AXY11323.1|239404_239644_-|holin	holin	holin	A0A2H4J378	uncultured_Caudovirales_phage	97.5	2.2e-33
AXY11324.1|239643_239880_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	100.0	1.2e-18
AXY11325.1|240772_241480_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	1.4e-38
>prophage 13
CP024772	Bacillus thuringiensis LM1212 plasmid pLM1, complete sequence	248002	245915	246788	248002		Aeromonas_phage(100.0%)	1	NA	NA
AXY11329.1|245915_246788_-	DNA invertase	NA	A0A219Y9V9	Aeromonas_phage	48.6	2.5e-37
>prophage 1
CP024773	Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence	157839	3049	60196	157839	transposase	Bacillus_phage(41.18%)	50	NA	NA
AXY11343.1|3049_4486_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXY11344.1|4880_5063_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11345.1|5731_6439_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	2.1e-39
AXY11346.1|7098_7986_-	ATPase	NA	NA	NA	NA	NA
AXY11347.1|9614_10304_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	58.7	7.4e-69
AXY11348.1|10404_10620_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11470.1|10821_12114_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11349.1|12298_13168_+	glycosyl transferase	NA	A0A2K9L5M2	Tupanvirus	24.3	1.3e-09
AXY11350.1|13150_13940_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY11351.1|13938_14256_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11471.1|14534_15851_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11472.1|16304_19298_-|transposase	DDE transposase	transposase	A0A125RQ78	Bacillus_phage	55.5	0.0e+00
AXY11352.1|19457_20330_+	DNA invertase	NA	A0A219Y9V9	Aeromonas_phage	48.6	2.5e-37
AXY11353.1|20729_21647_-	ATPase	NA	NA	NA	NA	NA
AXY11354.1|22085_22394_-	50S ribosomal protein L7ae	NA	NA	NA	NA	NA
AXY11355.1|22463_22754_-	transcriptional regulator	NA	NA	NA	NA	NA
AXY11356.1|22868_23147_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	60.7	7.4e-20
AXY11357.1|23199_23433_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AXY11358.1|23454_23736_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A1B1P791	Bacillus_phage	31.4	8.3e-11
AXY11473.1|24306_24837_-	signal peptidase I	NA	NA	NA	NA	NA
AXY11474.1|26947_27202_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11359.1|27508_28216_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	1.8e-38
AXY11360.1|28537_36145_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.1	9.4e-141
AXY11361.1|36417_37020_+	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	26.1	1.7e-08
AXY11362.1|37493_38906_-|transposase	transposase	transposase	NA	NA	NA	NA
AXY11363.1|38985_39480_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11364.1|39611_40187_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11365.1|40420_40894_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11366.1|40950_42363_+|transposase	transposase	transposase	NA	NA	NA	NA
AXY11367.1|42673_43759_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11368.1|44193_45306_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	49.1	1.4e-80
AXY11369.1|45489_45714_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11370.1|45758_46055_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11475.1|46209_46437_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AXY11371.1|47468_47705_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11372.1|47797_48046_-	DNA-binding protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	46.1	2.7e-13
AXY11373.1|48559_48784_+	XRE family transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	50.6	6.8e-16
AXY11374.1|48785_49400_-	hypothetical protein	NA	H0USY2	Bacillus_phage	45.1	8.1e-43
AXY11375.1|49338_50520_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	56.2	4.0e-123
AXY11376.1|50620_50806_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11377.1|50807_51104_-	hypothetical protein	NA	H0USY0	Bacillus_phage	45.5	2.2e-14
AXY11378.1|51537_52632_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	45.8	3.5e-81
AXY11379.1|52633_52771_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
AXY11380.1|53264_53705_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11381.1|53711_54902_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11382.1|55130_55685_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AXY11383.1|56330_57275_-	Replicase RepFR55	NA	NA	NA	NA	NA
AXY11384.1|57619_58117_-	transcriptional regulator	NA	NA	NA	NA	NA
AXY11385.1|58320_58524_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXY11386.1|59406_60196_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP024773	Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence	157839	68963	132849	157839	transposase,integrase	Bacillus_phage(40.0%)	51	67792:67851	112122:113835
67792:67851	attL	TGGTTCTTACGCATATTTGGTGGAATAGAGTAATCCAATGATTACATGCGGTGCAAAAGT	NA	NA	NA	NA
AXY11397.1|68963_69437_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AXY11398.1|69491_70022_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11399.1|70093_70567_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11400.1|70641_71046_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11401.1|71213_73934_+	ATPase	NA	NA	NA	NA	NA
AXY11402.1|73933_74134_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11403.1|74151_76326_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11404.1|76390_76681_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11405.1|76694_77555_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11406.1|77564_79505_+	type IV secretion system protein VirB4	NA	NA	NA	NA	NA
AXY11407.1|79508_80630_+	hypothetical protein	NA	F8WPZ7	Bacillus_phage	45.0	2.6e-23
AXY11408.1|80666_80969_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11409.1|80980_81580_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AXY11410.1|81951_82824_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11411.1|83081_83339_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11412.1|83335_84544_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11413.1|84540_85008_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11414.1|85026_85332_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11415.1|85362_85644_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11416.1|85636_87475_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AXY11417.1|87568_88711_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11418.1|88796_88985_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11419.1|89134_91789_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	25.8	6.8e-30
AXY11420.1|91999_92605_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11421.1|92656_94069_+|transposase	transposase	transposase	NA	NA	NA	NA
AXY11422.1|95927_96947_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11423.1|97007_98201_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	24.8	9.6e-24
AXY11424.1|98497_99160_+	restriction endonuclease	NA	NA	NA	NA	NA
AXY11425.1|99477_99666_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11426.1|99912_100152_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11427.1|100978_102841_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.2	3.3e-31
AXY11428.1|103572_103815_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11429.1|104192_104471_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	68.9	6.0e-14
AXY11430.1|104532_104805_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	65.6	1.8e-23
AXY11431.1|104917_105340_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11432.1|106389_107271_+	ATPase	NA	NA	NA	NA	NA
AXY11433.1|107521_108475_-|integrase	integrase	integrase	NA	NA	NA	NA
AXY11434.1|108584_109604_-	hypothetical protein	NA	A0A1B1P7Q7	Bacillus_phage	62.2	2.5e-134
AXY11435.1|110535_111009_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AXY11436.1|110998_112105_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11437.1|113312_114431_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
112122:113835	attR	ACTTTTGCACCGCATGTAATCATTGGATTACTCTATTCCACCAAATATGCGTAAGAACCATTTTCTGCTTGCACAAAACACTCCGGTGTACTTGCAGTATGTAACCATTGTGTTTTACCTTCTACCCGCATACCTGTTTCATCAAAATGAACAACCGAAGACTGAAGAATCTTCTCTTTTACTTCTTGTATAAAAAGCTGCAATTGCGAAGCGAAGGCCTGTGTATGTTTGACTAACGTTCCTTCGCTGATAGAATGCCCAAAACAGTCTTGAAAGAATTCTTTTGTTCGTTTCAAAGAAATGCACTGATAATGCGTTAAATAGGGAATCAATCTTTTTATATTTGGTCCGTATTGAACAGGACGAGACACTGTAGAAGGAAACGGTGCTTCTTGGATGGCATGGCAATGAGGGCATTCTTTTTGCTCTACTTTGTGTTCCGTTACTTTTATCTGGATAGGTGGTAAGTCATAGACTTGGCGAATGCGGTACCCTTTTACAAGTTCATGATTTAAGGACGTGTTACAACAAGTACAATGCATAGGAGAATAGGTAATCGTATGGTCTGGAGCCGTTGTCAAACCGAGAGTATGTCCCTTGTGGCCTAACTGGCCACCTGTTTGACGATTAGACGGTTTGCGCAAACTTTTGGTAACAGGCTTACACAAACCATCTGTAGAAGGTGGTTTATGACTATTTGTTGAGTTTTTTTTGAACGATTTTCTAATTCTTCTACACGTCCTTTTAAATCCTGTATTTGATTTTCTAGATGATGAACGAAATCGCAAATAGCCTGAGGCCCCTTTTGATAGACAGCTAGAATTTCTTGTTTTTTCAACACAAATATCACCTGTTATGAAGTGACCTTTGTCAATAGTTTTTCACCCATAATTTTTTAATGGCATACAAAAGCTTCAGAAATAAGATCTATCGACAGTTAACCACTCTGTTATTCGTGGATTGGTTACCTCAGGTTAATGGTCCGTCGTTAGGCTCTTATAATCTCCCTGCGTGGATCACATCTTTTCACATTCTAATAAATAGCTTGTTTATCAGAATTTCAACTGTGCCAGAAGAGGTGAGTCATAGATAGCCAGACCTGGAATTCACTATCTCTGAAGCTCATCTATGCCATCAATTGATACCTTTGGTCTCTAACTATGAATCAATCAACTTCATATCCCTTCTTCTTTATTTTCGGTGAATTTTACCTGTTTCTAATCCCCATATAAAACACCCCAGTTCTCTTGCGATAGCTGTAACGGCTACATTTCTAGGTTTCCCTTGATATATCATTCGATGATATTTTCTTTGTAACCTTTCTACAGCCTGATCCGCATAAACAATCACTTCGCTTCGTTGCCCTTTTTGTCTCGCTTTCACTCGTTTCGATTTTAATCCGATTGTTCCTTTTACCAACGCATTTGCACATTCTACAAGCGTAGACCTAACGGTCGAATTGCCTTGTTTTGTAATCGAATTTCGACTGATTTTCTCTCCACTTGAGCTTTCGCTTGGTGTCAATCCTACATAAGCCATAAATGCTTTAGCCGTGGGAAAACGAGTGAAGTCTGCAATTTCCACATGAACAGTCATTGCCGATGTTGTGTCTATACCTTTTAAGCATCTTAACTTTGCGACTGGTTCTTCATATCTTTCACTATGAGATAATTTTTCTAATCTCAGACTGAATCGCTCAATTTTGTCAACTAGA	NA	NA	NA	NA
AXY11438.1|115736_117047_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11439.1|117372_118461_+	glycosyl transferase	NA	A0A2K9L5M2	Tupanvirus	22.1	6.9e-13
AXY11476.1|118792_120139_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11440.1|120428_120644_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11441.1|121188_122010_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11442.1|122425_123418_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11443.1|123496_124570_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11444.1|125990_126780_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY11445.1|128037_128745_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	2.1e-39
AXY11446.1|132141_132849_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	1.8e-38
>prophage 1
CP024774	Bacillus thuringiensis LM1212 plasmid pLM3, complete sequence	112709	4435	52639	112709	transposase,integrase	Streptococcus_phage(57.14%)	35	3718:3731	55332:55345
3718:3731	attL	ACGTTTCTGAATAT	NA	NA	NA	NA
AXY11480.1|4435_5077_-|integrase	integrase	integrase	A0A1B0VBM1	Salmonella_phage	33.2	2.2e-14
AXY11481.1|5311_5521_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11482.1|5607_5943_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11483.1|6022_6904_-	ATPase	NA	NA	NA	NA	NA
AXY11484.1|9922_13702_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11485.1|15111_16602_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXY11486.1|16823_17030_+	transcriptional regulator	NA	NA	NA	NA	NA
AXY11487.1|17043_17430_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11488.1|20028_20262_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11489.1|20396_22094_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11490.1|22465_23878_+|transposase	transposase	transposase	NA	NA	NA	NA
AXY11491.1|23992_25264_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11492.1|25675_25834_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11493.1|26339_26696_+	hypothetical protein	NA	NA	NA	NA	NA
AXY11494.1|26829_28059_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.8	5.0e-84
AXY11495.1|31034_31742_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	3.1e-38
AXY11496.1|31871_32312_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11497.1|32372_34580_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	36.8	1.6e-69
AXY11498.1|34628_35117_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11499.1|35135_35669_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11500.1|35806_35980_+	ribbon-helix-helix domain-containing protein	NA	B5LPT4	Bacillus_virus	50.9	8.4e-06
AXY11565.1|36337_36757_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11501.1|37442_38231_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXY11502.1|40248_41559_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11503.1|41560_42565_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11504.1|42579_43254_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11505.1|43257_43824_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11506.1|43889_44078_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11507.1|44108_45188_-	hypothetical protein	NA	A0A1S5SEZ8	Streptococcus_phage	34.4	1.6e-41
AXY11508.1|45187_47125_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11509.1|47099_47813_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11510.1|47814_48183_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11511.1|48197_48539_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11512.1|48639_51150_-	cell wall anchor	NA	NA	NA	NA	NA
AXY11513.1|51445_52639_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	24.8	9.6e-24
55332:55345	attR	ATATTCAGAAACGT	NA	NA	NA	NA
>prophage 1
CP024775	Bacillus thuringiensis LM1212 plasmid pLM4, complete sequence	35121	28639	34618	35121	transposase	Bacillus_phage(50.0%)	9	NA	NA
AXY11587.1|28639_29329_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	60.4	1.7e-70
AXY11588.1|29400_29835_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11589.1|30408_30648_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11590.1|30713_31403_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	60.4	6.0e-71
AXY11591.1|31526_32021_-	hypothetical protein	NA	NA	NA	NA	NA
AXY11592.1|32418_32706_+	hypothetical protein	NA	A0A1P8CWP5	Bacillus_phage	37.5	9.0e-05
AXY11593.1|32753_33572_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	2.2e-59
AXY11594.1|34128_34386_+	hypothetical protein	NA	A0A125RQ77	Bacillus_phage	89.4	1.0e-36
AXY11595.1|34354_34618_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A125RQ76	Bacillus_phage	98.9	4.5e-43
