The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032167	Klebsiella pneumoniae strain AR_0076 chromosome, complete genome	5147572	808950	895327	5147572	tail,head,terminase,transposase,capsid,portal,tRNA,plate,protease	Enterobacteria_phage(20.0%)	100	NA	NA
AXZ12021.1|808950_810036_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AXZ12022.1|810093_810783_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
AXZ12023.1|811095_811479_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
AXZ12024.1|811524_812856_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
AXZ12025.1|812987_813725_+|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AXZ12026.1|813709_815329_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AXZ12027.1|815749_816325_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
AXZ12028.1|816357_817008_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AXZ12029.1|817007_817964_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AXZ12030.1|817960_818440_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
AXZ12031.1|818625_820425_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
AXZ12032.1|820440_821415_+	signal peptidase I	NA	NA	NA	NA	NA
AXZ12033.1|821664_822345_+	ribonuclease 3	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
AXZ12034.1|822341_823247_+	GTPase Era	NA	NA	NA	NA	NA
AXZ12035.1|823258_823996_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AXZ12036.1|824007_824739_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AXZ12037.1|824738_825119_+	holo-ACP synthase	NA	NA	NA	NA	NA
AXZ12038.1|825131_825392_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
AXZ15959.1|825606_827010_+	recombinase	NA	NA	NA	NA	NA
AXZ12039.1|827367_827580_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ12040.1|827576_827909_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	52.9	9.4e-14
AXZ12041.1|827932_828208_-	hypothetical protein	NA	Q333I1	Escherichia_virus	48.7	2.0e-09
AXZ15960.1|828200_828500_-	hypothetical protein	NA	E5AGF1	Erwinia_phage	67.0	1.4e-29
AXZ12042.1|828728_829652_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXZ12043.1|829676_829898_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ12044.1|830182_830425_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ12045.1|830417_830819_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ12046.1|830821_831580_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	37.2	6.0e-40
AXZ15961.1|831591_832122_-	hypothetical protein	NA	A0A1B5FPB4	Escherichia_phage	57.4	3.8e-41
AXZ12047.1|832184_832409_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	57.7	4.0e-16
AXZ12048.1|832405_832750_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ12049.1|832746_832944_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ12050.1|832927_833155_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ12051.1|833258_833462_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ12052.1|834024_834756_-	phage repressor protein C	NA	A0A2H4FNG6	Salmonella_phage	59.1	4.9e-79
AXZ15962.1|834890_835109_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ12053.1|835089_835281_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AXZ12054.1|835277_836153_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	60.2	4.5e-63
AXZ12055.1|836149_837031_+	hypothetical protein	NA	K7PLU3	Enterobacteria_phage	46.1	1.5e-61
AXZ12056.1|837027_838401_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	55.2	5.3e-135
AXZ12057.1|838400_838805_+	antitermination protein	NA	S5M7R9	Escherichia_phage	47.2	1.8e-27
AXZ12058.1|839175_839574_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ12059.1|839557_839863_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ12060.1|839859_840333_+	lysozyme	NA	H9C148	Vibrio_phage	39.7	4.0e-26
AXZ12061.1|840332_840587_+	hypothetical protein	NA	S4TWQ5	Salmonella_phage	53.7	3.4e-11
AXZ15963.1|840598_840877_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	42.9	1.8e-05
AXZ12062.1|841179_841452_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	52.7	2.0e-17
AXZ12063.1|841578_841773_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ12064.1|841952_842312_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ12065.1|842313_842652_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	71.3	2.2e-42
AXZ12066.1|842824_843292_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	6.5e-45
AXZ12067.1|843245_844991_+|terminase	phage terminase small subunit P27 family	terminase	M4QNU0	Tetraselmis_viridis_virus	43.6	3.9e-135
AXZ12068.1|844990_846295_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	75.1	4.5e-192
AXZ12069.1|846306_847155_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	70.9	6.4e-107
AXZ12070.1|847164_848382_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	81.7	9.3e-184
AXZ12071.1|848520_848724_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ12072.1|848722_849052_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	51.0	1.4e-22
AXZ12073.1|849053_849443_+|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	59.7	6.7e-35
AXZ12074.1|849435_849942_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	78.9	1.5e-71
AXZ12075.1|849938_850499_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	62.4	3.7e-63
AXZ12076.1|850502_850691_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	71.1	5.5e-11
AXZ12077.1|850690_852187_+|tail	phage tail protein	tail	A0A192Y7L1	Salmonella_phage	67.2	1.0e-187
AXZ12078.1|852186_852543_+|tail	phage tail protein	tail	U5P076	Shigella_phage	84.7	2.5e-52
AXZ12079.1|852539_852863_+|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	63.2	6.6e-28
AXZ12080.1|852947_854786_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	58.3	5.5e-188
AXZ15964.1|855106_855295_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ12081.1|855350_856679_+	DNA circularization protein	NA	S5FUX4	Shigella_phage	54.5	7.6e-131
AXZ12082.1|856675_857749_+|plate	baseplate protein	plate	M1FN92	Enterobacteria_phage	67.1	5.8e-137
AXZ12083.1|857748_858306_+|plate	baseplate assembly protein	plate	Q8W617	Enterobacteria_phage	65.9	6.6e-60
AXZ12084.1|858302_858716_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	59.1	6.6e-41
AXZ12085.1|858708_859776_+|plate	phage baseplate protein	plate	M1FQW3	Enterobacteria_phage	61.1	7.3e-124
AXZ12086.1|859766_860348_+	hypothetical protein	NA	O22003	Shigella_phage	64.9	1.6e-69
AXZ12087.1|860350_861229_+	hypothetical protein	NA	U5P0I1	Shigella_phage	63.0	1.8e-19
AXZ12088.1|861230_861635_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	55.2	4.2e-32
AXZ12089.1|863304_864306_-	glycosyltransferase	NA	U5P087	Shigella_phage	40.6	4.7e-48
AXZ12090.1|864302_864683_-	GtrA family protein	NA	NA	NA	NA	NA
AXZ12091.1|865159_865492_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ12092.1|865739_866588_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ12093.1|866801_867437_+	acid phosphatase AphA	NA	NA	NA	NA	NA
AXZ12094.1|867466_868009_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
AXZ12095.1|868005_869622_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
AXZ12096.1|869797_873685_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
AXZ12097.1|874274_875696_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
AXZ12098.1|875704_876412_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AXZ12099.1|876398_877736_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
AXZ12100.1|877801_878140_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AXZ12101.1|878214_879405_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AXZ12102.1|879445_879712_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ12103.1|879730_880984_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
AXZ15965.1|881039_881462_-	DoxX family protein	NA	NA	NA	NA	NA
AXZ12104.1|881535_882732_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AXZ12105.1|886189_887626_+	MFS transporter	NA	NA	NA	NA	NA
AXZ12106.1|887625_888459_+	aldose 1-epimerase	NA	NA	NA	NA	NA
AXZ12107.1|888541_889678_+	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
AXZ12108.1|889674_890952_-	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
AXZ12109.1|891076_891715_+	DUF1007 family protein	NA	NA	NA	NA	NA
AXZ12110.1|891705_892686_+	nickel transporter	NA	NA	NA	NA	NA
AXZ12111.1|892785_893622_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ12112.1|893668_894472_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
AXZ12113.1|894592_895327_+|tRNA	tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
>prophage 2
CP032167	Klebsiella pneumoniae strain AR_0076 chromosome, complete genome	5147572	1284773	1291678	5147572		Planktothrix_phage(33.33%)	6	NA	NA
AXZ15981.1|1284773_1285637_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AXZ12442.1|1285647_1286421_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AXZ15982.1|1286661_1287555_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AXZ12443.1|1287800_1289162_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AXZ12444.1|1289480_1290203_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AXZ12445.1|1290199_1291678_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
CP032167	Klebsiella pneumoniae strain AR_0076 chromosome, complete genome	5147572	1485401	1534335	5147572	tRNA,terminase,lysis,head	Escherichia_phage(18.0%)	71	NA	NA
AXZ12614.1|1485401_1487135_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	2.3e-87
AXZ12615.1|1487370_1487940_+	VOC family protein	NA	NA	NA	NA	NA
AXZ12616.1|1488016_1488760_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AXZ12617.1|1488841_1489846_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AXZ12618.1|1489842_1490586_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
AXZ12619.1|1490625_1491021_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ12620.1|1491073_1491853_-	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
AXZ12621.1|1491849_1493109_-	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	90.4	1.2e-223
AXZ12622.1|1493156_1493399_-	excisionase	NA	A0A286S2A4	Klebsiella_phage	81.3	2.0e-29
AXZ12623.1|1493402_1493621_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	51.9	8.6e-08
AXZ12624.1|1493617_1494103_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	61.9	2.1e-30
AXZ12625.1|1494099_1494324_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	7.0e-21
AXZ12626.1|1494320_1494542_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ12627.1|1494538_1495309_-	dcm methylase	NA	D5LH17	Escherichia_phage	51.0	1.9e-65
AXZ12628.1|1495305_1495824_-	HNH endonuclease	NA	A5H1J6	Xanthomonas_virus	47.6	1.7e-33
AXZ12629.1|1495956_1496385_-	regulator	NA	M9NYX4	Enterobacteria_phage	81.0	3.4e-64
AXZ12630.1|1496381_1497062_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	92.9	7.9e-124
AXZ12631.1|1497058_1497904_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	2.6e-68
AXZ12632.1|1497919_1498204_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	63.8	4.7e-30
AXZ12633.1|1498292_1498487_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ15995.1|1498722_1498998_-	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	65.9	2.1e-27
AXZ12634.1|1499847_1500252_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ12635.1|1500435_1501146_-	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	71.0	1.1e-91
AXZ12636.1|1501250_1501442_+	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	57.1	1.4e-09
AXZ12637.1|1501522_1501744_+	transcriptional regulator	NA	NA	NA	NA	NA
AXZ12638.1|1501872_1502220_+	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	36.2	1.3e-10
AXZ12639.1|1502216_1502942_+	helix-turn-helix domain-containing protein	NA	A0A077KB11	Edwardsiella_phage	72.6	2.7e-37
AXZ12640.1|1502938_1503715_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	65.0	8.8e-95
AXZ12641.1|1503714_1504017_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ15996.1|1504019_1504463_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	52.4	2.3e-23
AXZ12642.1|1504459_1504885_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ12643.1|1504881_1505457_+	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	64.4	5.0e-55
AXZ12644.1|1505457_1505796_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ15997.1|1506500_1506797_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	39.2	2.5e-05
AXZ12645.1|1506796_1507657_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ12646.1|1508049_1508517_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	4.9e-32
AXZ12647.1|1508497_1508668_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
AXZ12648.1|1508660_1509242_+	recombination protein NinG	NA	E7C9S3	Salmonella_phage	46.3	5.5e-41
AXZ12649.1|1509238_1509469_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ12650.1|1509465_1509606_+	YlcG family protein	NA	NA	NA	NA	NA
AXZ12651.1|1509602_1510412_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	75.1	1.3e-117
AXZ12652.1|1510917_1511166_+|lysis	lysis protein	lysis	NA	NA	NA	NA
AXZ12653.1|1511168_1511699_+	lysozyme	NA	G9L6J6	Escherichia_phage	79.7	4.2e-80
AXZ12654.1|1511695_1512085_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	3.1e-24
AXZ12655.1|1512364_1512961_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ12656.1|1513289_1513925_+	hypothetical protein	NA	I6S676	Salmonella_phage	81.1	2.3e-101
AXZ12657.1|1513956_1514442_+	hypothetical protein	NA	H9C190	Pectobacterium_phage	80.1	2.2e-67
AXZ12658.1|1514443_1516120_+|terminase	terminase	terminase	H9C191	Pectobacterium_phage	74.4	2.3e-249
AXZ12659.1|1516120_1517641_+	hypothetical protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.4	4.0e-107
AXZ12660.1|1517693_1518392_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.9	4.8e-60
AXZ12661.1|1518395_1519565_+	DNA primase	NA	A0A219YCD3	Aeromonas_phage	37.5	4.5e-58
AXZ12662.1|1519566_1520049_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.6	2.7e-33
AXZ12663.1|1520048_1521086_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.0	1.9e-84
AXZ12664.1|1521087_1521414_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	42.5	8.1e-10
AXZ12665.1|1521413_1521857_+	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	40.5	4.3e-14
AXZ12666.1|1521859_1522423_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	32.9	3.7e-18
AXZ15998.1|1522419_1522788_+	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	2.1e-06
AXZ12667.1|1522769_1523321_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ12668.1|1523324_1524806_+	hypothetical protein	NA	Q2NPD0	Xanthomonas_phage	34.8	4.6e-60
AXZ12669.1|1524805_1525249_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ12670.1|1525428_1525959_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	93.7	1.2e-87
AXZ12671.1|1526020_1526497_+	hypothetical protein	NA	A0A077KC08	Edwardsiella_phage	28.5	4.7e-06
AXZ12672.1|1526701_1528627_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	53.8	7.6e-39
AXZ12673.1|1528630_1529473_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	32.1	1.0e-27
AXZ12674.1|1529474_1529780_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	46.5	6.2e-20
AXZ12675.1|1529776_1530631_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	29.8	2.4e-29
AXZ12676.1|1530632_1531220_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	23.2	9.8e-06
AXZ12677.1|1531286_1531736_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ12678.1|1531902_1532253_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ12679.1|1532738_1533095_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ12680.1|1533102_1534335_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.7	3.0e-105
>prophage 4
CP032167	Klebsiella pneumoniae strain AR_0076 chromosome, complete genome	5147572	2303120	2314007	5147572		Escherichia_phage(87.5%)	9	NA	NA
AXZ13401.1|2303120_2306228_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AXZ13402.1|2306282_2307548_+	MFS transporter	NA	NA	NA	NA	NA
AXZ13403.1|2307578_2308667_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AXZ13404.1|2308753_2309014_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AXZ13405.1|2309311_2310172_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AXZ13406.1|2310192_2310954_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXZ13407.1|2311214_2312117_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AXZ13408.1|2312128_2313394_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.0	2.5e-232
AXZ13409.1|2313386_2314007_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
CP032167	Klebsiella pneumoniae strain AR_0076 chromosome, complete genome	5147572	2495880	2590734	5147572	terminase,transposase,plate,holin,integrase,protease	Salmonella_phage(18.0%)	98	2509872:2509890	2599174:2599192
AXZ13574.1|2495880_2496804_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXZ16042.1|2496977_2497253_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ13575.1|2497923_2498847_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	2.4e-176
AXZ13576.1|2499656_2502176_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	1.4e-19
AXZ13577.1|2502168_2504823_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.7	3.8e-97
AXZ13578.1|2505087_2505579_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AXZ13579.1|2505583_2507290_-	OmpA family protein	NA	NA	NA	NA	NA
AXZ13580.1|2507286_2507976_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AXZ16043.1|2507972_2509313_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXZ13581.1|2509325_2510870_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
2509872:2509890	attL	ATCTTTCACCGCGCCGCCG	NA	NA	NA	NA
AXZ13582.1|2510912_2511404_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AXZ13583.1|2512044_2512611_+|protease	protease	protease	NA	NA	NA	NA
AXZ13584.1|2512809_2514342_-	phosphohydrolase	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	5.2e-22
AXZ13585.1|2514558_2515320_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	4.1e-20
AXZ13586.1|2515428_2516343_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ13587.1|2516643_2516832_+	cold-shock protein	NA	NA	NA	NA	NA
AXZ13588.1|2516902_2517211_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
AXZ13589.1|2517378_2518248_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	7.4e-50
AXZ13590.1|2518326_2519529_-	MFS transporter	NA	NA	NA	NA	NA
AXZ13591.1|2519601_2520738_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXZ13592.1|2520910_2521795_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ13593.1|2521919_2522753_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ13594.1|2522983_2523370_+	VOC family protein	NA	NA	NA	NA	NA
AXZ13595.1|2523537_2525154_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ13596.1|2525339_2526047_+	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
AXZ13597.1|2526043_2527009_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
AXZ13598.1|2527111_2527618_+	thiol peroxidase	NA	NA	NA	NA	NA
AXZ16044.1|2527688_2528711_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AXZ13599.1|2528842_2530384_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
AXZ13600.1|2530556_2531870_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AXZ13601.1|2531983_2532883_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ13602.1|2532972_2534034_-	TIGR01620 family protein	NA	NA	NA	NA	NA
AXZ13603.1|2534030_2535428_-	YcjX family protein	NA	NA	NA	NA	NA
AXZ13604.1|2535530_2535749_-	phage shock protein PspD	NA	NA	NA	NA	NA
AXZ13605.1|2535777_2536137_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
AXZ13606.1|2536136_2536361_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
AXZ13607.1|2536419_2537085_-	phage shock protein PspA	NA	NA	NA	NA	NA
AXZ16045.1|2537252_2538227_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
AXZ13608.1|2538217_2539609_-	MFS transporter	NA	NA	NA	NA	NA
AXZ13609.1|2539634_2540804_-	amidohydrolase	NA	NA	NA	NA	NA
AXZ13610.1|2540975_2543285_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXZ13611.1|2543263_2544094_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXZ13612.1|2544204_2545110_+	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AXZ13613.1|2545443_2547087_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
AXZ13614.1|2547083_2548049_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
AXZ13615.1|2548253_2548922_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	5.8e-79
AXZ13616.1|2548933_2549866_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AXZ13617.1|2549908_2551174_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.9	1.8e-209
AXZ13618.1|2551175_2551595_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	8.5e-36
AXZ13619.1|2552143_2552566_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.8e-26
AXZ13620.1|2556379_2556775_-	protein singed	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
AXZ13621.1|2557096_2558050_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
AXZ13622.1|2558060_2558840_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	64.5	1.6e-67
AXZ13623.1|2558924_2560037_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.5	5.6e-111
AXZ13624.1|2560020_2561421_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.7	6.4e-128
AXZ13625.1|2561420_2562728_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.4	8.8e-148
AXZ13626.1|2562705_2563710_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.0	1.3e-37
AXZ13627.1|2564258_2564444_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ13628.1|2564572_2564818_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
AXZ13629.1|2565631_2565826_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
AXZ13630.1|2565776_2566052_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
AXZ13631.1|2566048_2566393_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
AXZ13632.1|2566389_2566929_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
AXZ13633.1|2566925_2567237_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
AXZ13634.1|2567837_2568284_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ13635.1|2568600_2569383_-	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	2.9e-114
AXZ13636.1|2569379_2569748_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	62.9	2.9e-40
AXZ13637.1|2569744_2570041_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	1.2e-36
AXZ13638.1|2570043_2570250_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	72.7	1.1e-23
AXZ13639.1|2570249_2570846_-	hypothetical protein	NA	K7PKS6	Enterobacteria_phage	81.1	4.1e-92
AXZ13640.1|2570880_2571129_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	66.7	1.5e-27
AXZ16046.1|2571233_2571467_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
AXZ13641.1|2572329_2572719_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ13642.1|2573323_2573860_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ13643.1|2574173_2574437_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	82.3	2.2e-29
AXZ13644.1|2574429_2574633_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	89.6	1.3e-29
AXZ13645.1|2574629_2575415_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	2.5e-65
AXZ13646.1|2575407_2575743_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	9.9e-11
AXZ13647.1|2575750_2576500_-	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
AXZ13648.1|2576502_2577423_-	DNA-binding protein	NA	V5URT9	Shigella_phage	53.9	4.5e-90
AXZ13649.1|2577712_2578249_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.4	2.1e-63
AXZ13650.1|2578251_2578485_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
AXZ13651.1|2578589_2578985_+	XRE family transcriptional regulator	NA	K7PM35	Enterobacteria_phage	73.3	2.0e-47
AXZ13652.1|2579545_2579749_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	74.6	2.0e-19
AXZ13653.1|2580032_2580341_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	62.2	1.7e-25
AXZ13654.1|2580432_2580531_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ13655.1|2580637_2580829_+	DUF1482 family protein	NA	NA	NA	NA	NA
AXZ13656.1|2580837_2580993_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	1.5e-14
AXZ13657.1|2581130_2584082_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	54.0	2.4e-278
AXZ13658.1|2584094_2585204_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	85.9	9.4e-183
AXZ16047.1|2585247_2585904_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	62.7	7.7e-68
AXZ13659.1|2585900_2586209_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	7.1e-24
AXZ16048.1|2586216_2586456_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
AXZ13660.1|2586465_2586780_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ13661.1|2586676_2587864_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	4.2e-120
AXZ13662.1|2588040_2588931_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AXZ13663.1|2588930_2589923_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AXZ13664.1|2589924_2590734_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
2599174:2599192	attR	ATCTTTCACCGCGCCGCCG	NA	NA	NA	NA
>prophage 6
CP032167	Klebsiella pneumoniae strain AR_0076 chromosome, complete genome	5147572	2977773	2987247	5147572	tRNA,protease	Bacillus_phage(16.67%)	9	NA	NA
AXZ14024.1|2977773_2979495_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.8	6.9e-15
AXZ16065.1|2979539_2980241_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXZ14025.1|2980594_2980813_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXZ14026.1|2980943_2983223_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AXZ14027.1|2983253_2983571_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AXZ14028.1|2983896_2984118_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AXZ14029.1|2984051_2984255_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ14030.1|2984194_2986135_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AXZ14031.1|2986131_2987247_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
CP032168	Klebsiella pneumoniae strain AR_0076 plasmid unnamed1, complete sequence	158987	83935	101590	158987	integrase,transposase	Escherichia_phage(50.0%)	23	89619:89678	101715:101837
AXZ16259.1|83935_84940_-|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
AXZ16260.1|85018_85453_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AXZ16261.1|85524_85875_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AXZ16262.1|85888_86164_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AXZ16352.1|86199_86622_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AXZ16263.1|86673_88368_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AXZ16264.1|88385_88748_+	transcriptional regulator	NA	NA	NA	NA	NA
AXZ16265.1|88744_88981_+	mercury resistance protein	NA	NA	NA	NA	NA
AXZ16266.1|88977_89685_+	EAL domain-containing protein	NA	NA	NA	NA	NA
89619:89678	attL	TGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAG	NA	NA	NA	NA
AXZ16267.1|89723_91028_+|integrase	integrase	integrase	NA	NA	NA	NA
AXZ16268.1|91074_91779_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
AXZ16269.1|91724_91982_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16270.1|91920_92934_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
AXZ16271.1|93100_93901_+	subclass B1 metallo-beta-lactamase VIM-1	NA	NA	NA	NA	NA
AXZ16272.1|93994_94453_+	aminoglycoside N-acetyltransferase AAC(6')-Il	NA	NA	NA	NA	NA
AXZ16273.1|94595_95069_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
AXZ16274.1|95161_95953_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AXZ16275.1|96782_97487_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ16276.1|97608_98514_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AXZ16277.1|98510_99749_+	MFS transporter	NA	NA	NA	NA	NA
AXZ16278.1|99748_100333_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ16279.1|100278_100635_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16280.1|100825_101590_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
101715:101837	attR	CTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACAATCCAGTTAGGGTATAGCTCAACCTGACATAGAAGCAAAAACTCAACCACCTTCTACCAACTC	NA	NA	NA	NA
>prophage 2
CP032168	Klebsiella pneumoniae strain AR_0076 plasmid unnamed1, complete sequence	158987	105852	124846	158987	integrase,transposase	Salmonella_phage(33.33%)	18	122578:122593	127488:127503
AXZ16288.1|105852_107394_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXZ16289.1|107798_108638_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXZ16290.1|108631_108979_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXZ16291.1|109142_109934_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AXZ16292.1|109939_110230_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AXZ16293.1|110341_110839_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AXZ16294.1|110983_111997_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXZ16295.1|111941_112265_+|transposase	transposase	transposase	NA	NA	NA	NA
AXZ16296.1|112302_112860_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AXZ16297.1|112862_115835_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AXZ16298.1|115913_116918_+|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
AXZ16299.1|117533_117935_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16300.1|118048_118774_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16301.1|118748_118952_-	hypothetical protein	NA	NA	NA	NA	NA
122578:122593	attL	TAATTATGATAATTAC	NA	NA	NA	NA
AXZ16302.1|122677_122998_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16303.1|123016_123304_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16304.1|123296_123833_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16305.1|123835_124846_+|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
127488:127503	attR	TAATTATGATAATTAC	NA	NA	NA	NA
>prophage 1
CP032169	Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence	171589	837	47243	171589	integrase,transposase	Macacine_betaherpesvirus(23.81%)	56	9262:9276	29774:29788
AXZ16359.1|837_1842_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXZ16360.1|2170_2875_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ16361.1|4343_5048_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ16362.1|5237_5654_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AXZ16363.1|5650_5881_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXZ16529.1|6201_6429_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16364.1|6480_6699_+	plasmid maintenance protein CcdA	NA	NA	NA	NA	NA
AXZ16365.1|6700_7006_+	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AXZ16366.1|7063_7375_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16367.1|7424_7760_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16368.1|7793_8810_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16369.1|9007_9787_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
9262:9276	attL	TTCGCTGGCGCCGCC	NA	NA	NA	NA
AXZ16370.1|9844_10102_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16371.1|10875_11799_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
AXZ16372.1|12283_13264_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
AXZ16530.1|13302_13389_-	ABC transporter	NA	NA	NA	NA	NA
AXZ16373.1|13876_14617_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AXZ16374.1|15314_16325_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
AXZ16375.1|17075_18242_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
AXZ16376.1|18241_19213_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
AXZ16377.1|20212_20470_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16378.1|20495_20801_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16379.1|20854_21106_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AXZ16380.1|21184_22456_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	8.6e-156
AXZ16381.1|22455_22881_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
AXZ16382.1|23035_23287_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16383.1|23286_24771_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AXZ16384.1|25019_25991_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.4e-73
AXZ16385.1|25993_26665_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AXZ16386.1|26725_26956_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16387.1|27392_28094_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
AXZ16388.1|28093_28315_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16389.1|28324_28744_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AXZ16390.1|28797_29565_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16391.1|30245_30674_+	antirestriction protein	NA	NA	NA	NA	NA
29774:29788	attR	TTCGCTGGCGCCGCC	NA	NA	NA	NA
AXZ16392.1|30716_31223_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.4	4.1e-08
AXZ16393.1|31265_31457_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16394.1|31638_31899_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	6.3e-13
AXZ16395.1|31933_32254_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16396.1|32825_32915_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AXZ16397.1|32933_33161_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16398.1|33252_33483_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16399.1|33534_34890_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AXZ16400.1|34937_35501_+	SAM-dependent methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
AXZ16401.1|35395_35716_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16402.1|36330_36873_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	75.8	1.0e-49
AXZ16403.1|36921_37170_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AXZ16404.1|37239_39297_+	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	2.6e-21
AXZ16405.1|39341_39773_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AXZ16406.1|39769_40498_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AXZ16407.1|40494_40821_+	theronine dehydrogenase	NA	NA	NA	NA	NA
AXZ16408.1|40876_41251_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16409.1|41451_42826_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	1.4e-79
AXZ16410.1|42996_44037_+	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
AXZ16411.1|44185_45847_+	peptidase S8	NA	NA	NA	NA	NA
AXZ16412.1|45902_47243_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP032169	Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence	171589	66147	108749	171589	protease,transposase	Escherichia_phage(35.29%)	36	NA	NA
AXZ16436.1|66147_69135_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.7	3.4e-296
AXZ16437.1|69171_69876_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
AXZ16438.1|69990_70197_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16439.1|70578_72012_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AXZ16440.1|72045_73212_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AXZ16441.1|73270_73975_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ16442.1|74185_75181_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AXZ16443.1|75184_76117_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16444.1|76230_77351_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	3.9e-51
AXZ16445.1|77448_78153_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
AXZ16446.1|79707_80973_-	glycoside hydrolase family 27 protein	NA	NA	NA	NA	NA
AXZ16447.1|81033_82467_-	melibiose:sodium transporter MelB	NA	NA	NA	NA	NA
AXZ16448.1|82805_83510_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
AXZ16449.1|83589_84201_+	DUF2913 family protein	NA	NA	NA	NA	NA
AXZ16450.1|84385_85342_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16451.1|85722_86427_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ16452.1|86779_87349_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
AXZ16453.1|88105_89575_+	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
AXZ16454.1|90094_90832_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16455.1|90969_91656_-	NYN domain-containing protein	NA	NA	NA	NA	NA
AXZ16456.1|92148_92364_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16457.1|92526_93231_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
AXZ16458.1|93176_93437_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16459.1|93982_94369_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16460.1|94377_94569_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AXZ16461.1|95580_96363_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.9	1.7e-133
AXZ16462.1|96336_99324_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.7	3.4e-296
AXZ16463.1|99491_100133_+	resolvase	NA	NA	NA	NA	NA
AXZ16464.1|100562_101894_+	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	36.3	1.8e-42
AXZ16465.1|101893_102241_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16466.1|102506_102701_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16467.1|103300_103489_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16468.1|104145_104574_-	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
AXZ16469.1|104767_105763_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.3	7.0e-20
AXZ16470.1|106607_107759_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.9	9.5e-21
AXZ16471.1|107783_108749_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
>prophage 3
CP032169	Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence	171589	129022	137692	171589	transposase	Stx2-converting_phage(42.86%)	9	NA	NA
AXZ16488.1|129022_129946_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	92.8	7.8e-167
AXZ16534.1|130608_131517_+	HNH endonuclease	NA	NA	NA	NA	NA
AXZ16489.1|131806_133345_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	6.1e-281
AXZ16490.1|133393_133741_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AXZ16491.1|133737_134142_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
AXZ16492.1|134367_134718_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	1.2e-19
AXZ16493.1|134861_135293_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AXZ16494.1|135543_137019_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	7.9e-28
AXZ16495.1|137011_137692_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
>prophage 1
CP032171	Klebsiella pneumoniae strain AR_0076 plasmid unnamed4, complete sequence	25510	0	23448	25510	transposase,integrase	Escherichia_phage(46.15%)	22	970:985	12755:12770
AXZ16617.1|877_1822_+	hypothetical protein	NA	NA	NA	NA	NA
970:985	attL	GATCCGCCAGGCGCTG	NA	NA	NA	NA
AXZ16638.1|1900_2251_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16618.1|2308_2830_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16619.1|2875_3079_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16620.1|3108_4113_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16621.1|4310_5090_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
AXZ16622.1|5147_5405_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16623.1|6182_7049_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AXZ16624.1|8087_9293_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AXZ16625.1|9289_10267_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.5	1.4e-86
AXZ16626.1|11282_12038_-	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	34.3	3.8e-34
AXZ16627.1|12034_13534_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
12755:12770	attR	CAGCGCCTGGCGGATC	NA	NA	NA	NA
AXZ16628.1|13622_14384_-	hypothetical protein	NA	A0A2K9L727	Tupanvirus	24.1	2.0e-06
AXZ16629.1|14494_15418_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AXZ16630.1|15513_16437_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AXZ16631.1|16492_17827_+	amino acid permease	NA	NA	NA	NA	NA
AXZ16632.1|17871_19143_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AXZ16633.1|19380_21009_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	45.1	1.7e-127
AXZ16634.1|21152_22076_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AXZ16635.1|22162_22591_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	77.5	2.5e-67
AXZ16636.1|22577_23060_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	68.4	2.9e-56
AXZ16637.1|23067_23448_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	54.8	1.2e-36
