The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032201	Escherichia coli strain AR_0086 chromosome, complete genome	5107215	23798	103910	5107215	portal,tRNA,capsid,integrase,tail,terminase,holin,head	Enterobacteria_phage(50.0%)	95	68505:68519	105729:105743
AXZ00279.1|23798_24485_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AXZ00280.1|24884_25025_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ00281.1|25120_25837_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXZ00282.1|25896_27249_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
AXZ00283.1|27306_28731_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	3.2e-10
AXZ00284.1|28730_29420_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
AXZ00285.1|29432_29906_-	protein CreA	NA	NA	NA	NA	NA
AXZ00286.1|30116_30986_+	right origin-binding protein	NA	NA	NA	NA	NA
AXZ00287.1|30982_31630_-	phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
AXZ05036.1|31681_32209_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
AXZ00288.1|32287_32614_-	trp operon repressor	NA	NA	NA	NA	NA
AXZ00289.1|32703_34641_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
AXZ00290.1|34847_36515_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
AXZ00291.1|36635_37868_-	trifunctional NAD biosynthesis/regulator protein NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
AXZ00292.1|37888_39271_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AXZ00293.1|39319_40288_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
AXZ00294.1|40393_41038_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
AXZ00295.1|41065_42082_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
AXZ00296.1|43573_44293_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
AXZ00297.1|44349_45573_-	phosphopentomutase	NA	NA	NA	NA	NA
AXZ00298.1|45624_46947_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.5	1.5e-78
AXZ00299.1|47024_47804_-	2-deoxyribose-5-phosphate aldolase	NA	NA	NA	NA	NA
AXZ00300.1|48061_49612_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
AXZ00301.1|49583_50447_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
AXZ00302.1|50962_51745_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AXZ00303.1|51741_52815_-	patatin family protein	NA	NA	NA	NA	NA
AXZ00304.1|52936_53116_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
AXZ00305.1|53224_53830_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AXZ00306.1|54222_55809_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
AXZ00307.1|56028_56289_+	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	95.1	2.4e-36
AXZ00308.1|56646_58251_+	TIR domain-containing protein	NA	NA	NA	NA	NA
AXZ00309.1|58695_58965_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	81.0	1.4e-20
AXZ05037.1|59063_59690_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXZ00310.1|59634_59772_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AXZ00311.1|59744_59843_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
AXZ00312.1|59882_60176_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ00313.1|60185_60464_-	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	46.2	3.0e-21
AXZ00314.1|60460_62524_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	62.3	9.1e-147
AXZ00315.1|62675_63275_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.0	7.5e-102
AXZ00316.1|63342_67035_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.7	0.0e+00
AXZ00317.1|67233_67419_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ00318.1|67372_68053_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.2	1.5e-111
AXZ00319.1|67950_68694_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	1.2e-146
68505:68519	attL	CAATCTCCCCCTGCA	NA	NA	NA	NA
AXZ00320.1|68704_69403_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	94.8	3.0e-126
AXZ00321.1|69402_69732_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AXZ00322.1|69728_72308_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.1	0.0e+00
AXZ00323.1|72288_72702_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AXZ00324.1|72728_73160_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
AXZ00325.1|73173_73926_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
AXZ00326.1|73933_74329_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AXZ00327.1|74325_74859_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.5e-56
AXZ00328.1|74874_75228_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
AXZ00329.1|75220_75604_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
AXZ00330.1|75655_76684_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
AXZ00331.1|76741_77089_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	1.2e-22
AXZ00332.1|77125_78631_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.2e-100
AXZ00333.1|78620_80213_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	8.4e-185
AXZ00334.1|80209_80416_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	6.0e-11
AXZ00335.1|80399_82328_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	7.9e-262
AXZ00336.1|82299_82809_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AXZ00337.1|83084_83405_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ00338.1|83292_83646_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ00339.1|83768_84149_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AXZ00340.1|84575_84869_+	increased serum survival lipoprotein Iss	NA	C6ZCX3	Enterobacteria_phage	91.8	1.6e-44
AXZ00341.1|84959_85142_-	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
AXZ00342.1|85358_85892_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	95.5	1.1e-99
AXZ00343.1|85997_86270_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ00344.1|86235_86580_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	90.5	3.5e-35
AXZ05038.1|86584_86800_-|holin	holin	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
AXZ00345.1|87341_87536_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ00346.1|87893_88955_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.3	7.1e-204
AXZ00347.1|89105_89309_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
AXZ00348.1|89562_90315_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
AXZ00349.1|90328_91318_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	5.6e-195
AXZ00350.1|91325_92135_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
AXZ00351.1|92154_92544_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
AXZ00352.1|92540_92867_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	7.8e-53
AXZ00353.1|92863_93517_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
AXZ00354.1|93516_94005_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	95.1	2.2e-83
AXZ00355.1|94001_94826_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	89.5	3.5e-126
AXZ00356.1|94822_95047_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	1.3e-38
AXZ00357.1|95043_96195_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	99.0	2.8e-214
AXZ00358.1|96191_96743_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
AXZ00359.1|96735_96996_-	XRE family transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
AXZ00360.1|96967_97120_-	amino acid permease	NA	NA	NA	NA	NA
AXZ00361.1|97093_97786_+	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
AXZ00362.1|97841_98120_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	89.7	5.7e-12
AXZ00363.1|98508_98871_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AXZ00364.1|98935_99760_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AXZ00365.1|99887_100424_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
AXZ00366.1|100414_100777_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.4	9.8e-65
AXZ00367.1|100776_101388_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	74.8	5.5e-84
AXZ00368.1|101387_101582_+	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	92.2	1.9e-30
AXZ00369.1|101717_102533_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ00370.1|102686_103910_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.5	1.4e-235
105729:105743	attR	CAATCTCCCCCTGCA	NA	NA	NA	NA
>prophage 2
CP032201	Escherichia coli strain AR_0086 chromosome, complete genome	5107215	165865	222060	5107215	transposase,holin	Stx2-converting_phage(18.75%)	56	NA	NA
AXZ00433.1|165865_167086_+|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
AXZ00434.1|167574_167970_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ00435.1|168251_168401_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ00436.1|168767_169484_+	N-acetylneuraminic acid outer membrane channel protein NanC	NA	NA	NA	NA	NA
AXZ00437.1|169503_170610_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
AXZ00438.1|170673_171654_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	57.2	4.7e-101
AXZ05042.1|172236_173367_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ00439.1|173405_174552_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
AXZ00440.1|175287_176574_+	restriction endonuclease	NA	NA	NA	NA	NA
AXZ00441.1|176683_178423_+	Alw26I/Eco31I/Esp3I family type II restriction endonuclease	NA	NA	NA	NA	NA
AXZ00442.1|178435_179626_-	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	31.0	7.3e-16
AXZ00443.1|179618_181259_-	Alw26I/Eco31I/Esp3I family type II restriction adenine-specific DNA-methyltransferase	NA	NA	NA	NA	NA
AXZ00444.1|182829_183006_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AXZ00445.1|183022_183511_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ00446.1|183507_183885_-	toxin	NA	NA	NA	NA	NA
AXZ00447.1|183974_184343_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AXZ00448.1|184505_184727_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AXZ05043.1|184789_185236_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AXZ00449.1|185281_185755_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
AXZ00450.1|186095_186824_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	6.2e-42
AXZ00451.1|186918_187665_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AXZ00452.1|187679_189221_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AXZ00453.1|189520_189655_-	cytoplasmic protein	NA	NA	NA	NA	NA
AXZ00454.1|189654_189849_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AXZ00455.1|189883_192730_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
AXZ00456.1|193102_193975_-	GTPase family protein	NA	NA	NA	NA	NA
AXZ00457.1|194059_194977_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ00458.1|195109_195325_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ00459.1|195808_196006_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ05044.1|196074_196272_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ00460.1|196177_196795_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ00461.1|196875_197136_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXZ00462.1|197078_197285_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ00463.1|197855_198005_+	hemolysin activation protein	NA	NA	NA	NA	NA
AXZ00464.1|198024_198225_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ00465.1|198337_198535_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ00466.1|198698_199304_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AXZ00467.1|199557_199965_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ00468.1|199865_200387_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ00469.1|200386_200623_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ05045.1|200741_201122_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AXZ00470.1|201118_201466_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AXZ00471.1|201515_202901_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
AXZ00472.1|203139_204513_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
AXZ00473.1|206059_206581_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AXZ00474.1|206577_207531_+	protein FecR	NA	NA	NA	NA	NA
AXZ00475.1|207617_209942_+	fe(3+) dicitrate transporter fecA	NA	NA	NA	NA	NA
AXZ00476.1|209986_210889_+	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AXZ00477.1|210885_211884_+	Fe3+ dicitrate ABC transporter permease	NA	NA	NA	NA	NA
AXZ00478.1|211880_212837_+	iron-dicitrate ABC transporter permease FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AXZ00479.1|212837_213605_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AXZ00480.1|214161_214575_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ00481.1|216323_217199_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
AXZ00482.1|217448_218711_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AXZ00483.1|219953_221957_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
AXZ00484.1|221901_222060_+|holin	choline transporter	holin	NA	NA	NA	NA
>prophage 3
CP032201	Escherichia coli strain AR_0086 chromosome, complete genome	5107215	1737244	1785407	5107215	transposase,protease	Stx2-converting_phage(31.25%)	48	NA	NA
AXZ01864.1|1737244_1737889_-	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	32.6	1.2e-25
AXZ01865.1|1737907_1738129_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
AXZ05110.1|1738191_1738638_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AXZ01866.1|1738683_1739169_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
AXZ01867.1|1739223_1740042_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
AXZ01868.1|1740142_1740376_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AXZ01869.1|1740888_1741314_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AXZ01870.1|1741310_1741661_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AXZ01871.1|1741691_1743305_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AXZ01872.1|1743525_1744686_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ01873.1|1744747_1747870_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
AXZ01874.1|1748203_1749076_-	GTPase family protein	NA	NA	NA	NA	NA
AXZ01875.1|1749991_1750213_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ01876.1|1750389_1751898_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AXZ01877.1|1752018_1752618_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ01878.1|1752676_1752937_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AXZ01879.1|1752879_1753086_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ01880.1|1753830_1753980_+	hemolysin activation protein	NA	NA	NA	NA	NA
AXZ01881.1|1753999_1754200_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ05111.1|1754312_1754510_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ01882.1|1754672_1755278_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AXZ01883.1|1755444_1755828_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ01884.1|1756048_1757587_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
AXZ01885.1|1758714_1759065_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
AXZ01886.1|1759061_1759487_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
AXZ01887.1|1759514_1759718_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ05112.1|1759858_1759996_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ01888.1|1760147_1761065_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AXZ01889.1|1761098_1761974_+	ROK family protein	NA	NA	NA	NA	NA
AXZ01890.1|1761986_1763495_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.3e-06
AXZ01891.1|1763498_1764329_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXZ01892.1|1764374_1765085_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
AXZ01893.1|1765088_1766207_+	YjhT family mutarotase	NA	NA	NA	NA	NA
AXZ01894.1|1766256_1767192_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXZ01895.1|1767227_1767962_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
AXZ01896.1|1768058_1769048_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
AXZ01897.1|1769199_1770427_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
AXZ01898.1|1770585_1770771_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ01899.1|1770927_1773018_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
AXZ01900.1|1773801_1774122_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ01901.1|1774209_1774401_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ01902.1|1774397_1774772_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ01903.1|1774775_1774991_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ01904.1|1774987_1775260_+	neurotensin receptor R8	NA	NA	NA	NA	NA
AXZ01905.1|1778401_1778857_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ01906.1|1779771_1780923_-|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AXZ01907.1|1780879_1781248_-|transposase	transposase	transposase	NA	NA	NA	NA
AXZ01908.1|1781519_1785407_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
>prophage 4
CP032201	Escherichia coli strain AR_0086 chromosome, complete genome	5107215	2091130	2098270	5107215		Escherichia_phage(83.33%)	6	NA	NA
AXZ02173.1|2091130_2091769_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
AXZ02174.1|2091765_2093028_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
AXZ02175.1|2093024_2093933_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
AXZ02176.1|2094128_2094896_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
AXZ02177.1|2094946_2095603_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
AXZ02178.1|2095708_2098270_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 5
CP032201	Escherichia coli strain AR_0086 chromosome, complete genome	5107215	2272314	2337385	5107215	tRNA,integrase,tail,terminase,holin	Escherichia_phage(49.02%)	66	2297286:2297302	2335542:2335558
AXZ02340.1|2272314_2273469_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
AXZ02341.1|2273753_2274761_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
AXZ02342.1|2274787_2275906_+	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin)	NA	NA	NA	NA	NA
AXZ02343.1|2276016_2277291_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AXZ02344.1|2277308_2277929_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ02345.1|2277939_2279118_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AXZ02346.1|2279235_2280708_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AXZ02347.1|2280770_2280986_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ02348.1|2281191_2283366_+	intimin-like inverse autotransporter SinH	NA	NA	NA	NA	NA
AXZ02349.1|2283421_2284414_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ02350.1|2284523_2292605_+	RatA-like protein	NA	NA	NA	NA	NA
AXZ02351.1|2292658_2294026_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	41.2	2.3e-45
AXZ02352.1|2294187_2295654_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
AXZ02353.1|2295722_2297300_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
2297286:2297302	attL	ATTGAGTGGGAATGATT	NA	NA	NA	NA
AXZ02354.1|2297492_2298743_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.5	7.2e-240
AXZ02355.1|2298746_2298941_-	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	98.4	5.7e-27
AXZ02356.1|2298937_2299588_-	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	99.1	1.9e-127
AXZ05128.1|2299580_2299832_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	97.6	2.6e-40
AXZ02357.1|2299989_2300238_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AXZ02358.1|2300287_2301229_-	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	99.7	2.9e-177
AXZ02359.1|2301225_2302047_-	exodeoxyribonuclease VIII	NA	A0A2R9YJH7	Escherichia_phage	98.5	1.5e-161
AXZ02360.1|2302043_2302343_-	hypothetical protein	NA	G9L6A4	Escherichia_phage	99.0	5.8e-47
AXZ02361.1|2302651_2303236_-	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
AXZ02362.1|2303390_2303621_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
AXZ02363.1|2303771_2303972_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
AXZ02364.1|2303987_2304803_+	primosomal protein	NA	Q286X4	Escherichia_phage	95.6	2.9e-117
AXZ05129.1|2304799_2305585_+	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
AXZ02365.1|2305702_2306050_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	98.3	3.1e-60
AXZ02366.1|2306111_2306648_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	98.7	1.4e-35
AXZ02367.1|2306644_2307196_+	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	55.6	1.6e-50
AXZ02368.1|2307197_2307461_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
AXZ02369.1|2307471_2308068_+	DUF551 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	54.3	6.6e-50
AXZ02370.1|2308347_2308686_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	8.3e-58
AXZ02371.1|2308726_2309401_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
AXZ02372.1|2309397_2310873_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	99.4	9.9e-297
AXZ02373.1|2310963_2311320_-	hypothetical protein	NA	Q716B1	Shigella_phage	75.4	2.7e-43
AXZ02374.1|2312022_2312229_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
AXZ02375.1|2312243_2313923_+|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.3	8.0e-303
AXZ02376.1|2313919_2314216_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
AXZ02377.1|2314218_2314914_+	peptidase	NA	G9L6C4	Escherichia_phage	98.7	4.3e-93
AXZ02378.1|2314928_2315915_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
AXZ02379.1|2315966_2316404_+	hypothetical protein	NA	G9L6C6	Escherichia_phage	95.2	5.0e-71
AXZ02380.1|2316414_2316750_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	5.0e-55
AXZ02381.1|2316800_2317124_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
AXZ02382.1|2317123_2317729_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	6.2e-112
AXZ02383.1|2317728_2320200_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
AXZ02384.1|2320199_2320664_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
AXZ02385.1|2320663_2321203_+	hypothetical protein	NA	A0A193GYJ4	Enterobacter_phage	83.0	6.6e-49
AXZ02386.1|2321215_2323729_+	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	95.0	0.0e+00
AXZ02387.1|2323725_2325528_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.5	0.0e+00
AXZ02388.1|2325533_2328008_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.3	0.0e+00
AXZ02389.1|2328191_2328608_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ02390.1|2328639_2328801_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
AXZ02391.1|2328899_2329532_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02392.1|2329678_2330335_-	phage antirepressor Ant	NA	A0A0P0ZDY7	Stx2-converting_phage	81.0	7.5e-55
AXZ02393.1|2330652_2330910_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	98.8	4.9e-42
AXZ02394.1|2331106_2333569_+|tail	phage tail protein	tail	O09496	Escherichia_virus	48.6	7.4e-164
AXZ02395.1|2333641_2334046_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	95.5	3.9e-62
AXZ02396.1|2334032_2334341_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	94.1	4.6e-47
AXZ02397.1|2334330_2334960_+	glycoside hydrolase family 19 protein	NA	A0A0F6R8M1	Escherichia_coli_O157_typing_phage	97.6	1.7e-112
AXZ02398.1|2334956_2335454_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	66.5	1.0e-48
AXZ02399.1|2335648_2336188_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
2335542:2335558	attR	ATTGAGTGGGAATGATT	NA	NA	NA	NA
AXZ02400.1|2336203_2336722_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
AXZ02401.1|2336824_2336962_-	succinate dehydrogenase	NA	NA	NA	NA	NA
AXZ02402.1|2337023_2337215_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AXZ02403.1|2337232_2337385_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	90.0	7.1e-17
>prophage 6
CP032201	Escherichia coli strain AR_0086 chromosome, complete genome	5107215	2713115	2722560	5107215		Enterobacteria_phage(85.71%)	10	NA	NA
AXZ02739.1|2713115_2714042_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
AXZ02740.1|2714046_2714778_+	ABC transporter permease	NA	NA	NA	NA	NA
AXZ02741.1|2714758_2714866_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02742.1|2714925_2715657_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
AXZ02743.1|2715878_2717564_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AXZ02744.1|2717560_2718280_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXZ02745.1|2718326_2718797_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AXZ02746.1|2718837_2719299_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AXZ02747.1|2719423_2721427_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AXZ02748.1|2721423_2722560_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
>prophage 7
CP032201	Escherichia coli strain AR_0086 chromosome, complete genome	5107215	2816736	2823039	5107215		Enterobacteria_phage(66.67%)	6	NA	NA
AXZ02818.1|2816736_2818131_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
AXZ02819.1|2818305_2819199_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
AXZ05143.1|2819571_2820657_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
AXZ02820.1|2820656_2821556_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
AXZ02821.1|2821613_2822492_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
AXZ02822.1|2822496_2823039_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 8
CP032201	Escherichia coli strain AR_0086 chromosome, complete genome	5107215	2846135	2882374	5107215	transposase	Stx2-converting_phage(16.67%)	43	NA	NA
AXZ02846.1|2846135_2846645_+|transposase	IS200/IS605-like element IS200C family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.8e-11
AXZ02847.1|2846755_2848183_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AXZ02848.1|2848391_2849558_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
AXZ02849.1|2849676_2850150_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
AXZ02850.1|2850347_2851406_+	FUSC family protein	NA	NA	NA	NA	NA
AXZ02851.1|2851577_2851907_+	DUF496 family protein	NA	NA	NA	NA	NA
AXZ05146.1|2852007_2852190_-	ethanolamine utilization protein	NA	NA	NA	NA	NA
AXZ05148.1|2852678_2852792_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AXZ05149.1|2852804_2852996_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02852.1|2852995_2853370_-	toxin	NA	NA	NA	NA	NA
AXZ02853.1|2853458_2853827_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AXZ02854.1|2853842_2854487_-	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
AXZ02855.1|2854505_2854727_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AXZ05147.1|2854789_2855236_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AXZ02856.1|2855281_2855755_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
AXZ02857.1|2855848_2856094_-	antirestriction protein	NA	NA	NA	NA	NA
AXZ02858.1|2856093_2856912_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
AXZ02859.1|2857132_2857543_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02860.1|2857991_2858738_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AXZ02861.1|2858752_2860294_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AXZ02862.1|2860408_2860822_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02863.1|2860957_2862028_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
AXZ02864.1|2862024_2862930_-	chemotaxis protein	NA	NA	NA	NA	NA
AXZ02865.1|2862926_2865311_-	dGTPase	NA	NA	NA	NA	NA
AXZ02866.1|2865528_2865963_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02867.1|2866391_2868557_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXZ02868.1|2868567_2869557_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ02869.1|2869575_2870634_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AXZ02870.1|2870630_2871398_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
AXZ02871.1|2871451_2871709_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ05150.1|2872239_2873385_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02872.1|2873794_2874055_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ05151.1|2873981_2874359_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ02873.1|2874584_2874764_-|transposase	transposase	transposase	NA	NA	NA	NA
AXZ02874.1|2874909_2875932_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AXZ02875.1|2875928_2876624_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	2.3e-118
AXZ02876.1|2876960_2877176_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02877.1|2877649_2878267_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02878.1|2878345_2878699_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXZ02879.1|2878747_2879944_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
AXZ02880.1|2880175_2880409_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ02881.1|2880376_2880700_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02882.1|2880760_2882374_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 9
CP032201	Escherichia coli strain AR_0086 chromosome, complete genome	5107215	2938429	2993057	5107215	transposase,head,integrase,tail,plate	Burkholderia_virus(40.0%)	65	2922455:2922477	2979913:2979935
2922455:2922477	attL	TGCTACCCGAAACGGGTTTATTT	NA	NA	NA	NA
AXZ02922.1|2938429_2938819_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	5.8e-31
AXZ02923.1|2938790_2939243_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.9	1.6e-24
AXZ02924.1|2939232_2939448_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02925.1|2939437_2939668_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02926.1|2939664_2940348_-	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	36.2	1.4e-24
AXZ02927.1|2940344_2940560_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02928.1|2940574_2940871_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02929.1|2940880_2941153_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02930.1|2941209_2941431_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ02931.1|2941441_2941972_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
AXZ02932.1|2942000_2942270_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02933.1|2942272_2943439_-	hypothetical protein	NA	A4JWN1	Burkholderia_virus	59.4	2.8e-121
AXZ02934.1|2943449_2945219_-|integrase	integrase	integrase	Q6QIE0	Burkholderia_phage	68.5	6.2e-229
AXZ02935.1|2945222_2946134_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	53.7	1.9e-72
AXZ02936.1|2946144_2946453_-	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	54.9	6.1e-23
AXZ02937.1|2946449_2946674_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02938.1|2946762_2947179_+	phage repressor protein	NA	NA	NA	NA	NA
AXZ02939.1|2947301_2948195_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ02940.1|2948154_2948592_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ02941.1|2948644_2949412_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.7	4.5e-99
AXZ02942.1|2949602_2949818_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02943.1|2949816_2950221_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ02944.1|2950196_2950925_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02945.1|2951055_2951406_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
AXZ02946.1|2951408_2952149_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
AXZ02947.1|2952132_2952783_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AXZ02948.1|2952779_2953106_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AXZ02949.1|2953105_2953417_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AXZ02950.1|2953416_2953962_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AXZ02951.1|2955552_2957049_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.2	4.8e-166
AXZ02952.1|2957029_2957851_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	1.2e-97
AXZ02953.1|2957853_2958312_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AXZ02954.1|2958526_2959642_+	peptidase	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
AXZ02955.1|2959656_2960610_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
AXZ02956.1|2960619_2960958_+	DUF2190 family protein	NA	NA	NA	NA	NA
AXZ02957.1|2960959_2961406_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AXZ02958.1|2961405_2961870_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AXZ02959.1|2961866_2962121_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ02960.1|2962110_2963538_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
AXZ02961.1|2963537_2964059_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
AXZ02962.1|2964061_2964343_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ02963.1|2964440_2964776_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AXZ02964.1|2964699_2964858_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AXZ02965.1|2964933_2967885_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.5	1.2e-83
AXZ02966.1|2967884_2968769_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.9	5.2e-51
AXZ02967.1|2968765_2968981_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
AXZ02968.1|2968968_2970123_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	47.6	3.2e-85
AXZ02969.1|2970119_2970716_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
AXZ02970.1|2970770_2971118_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
AXZ02971.1|2971108_2972212_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.5	2.2e-107
AXZ02972.1|2972204_2972783_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
AXZ02973.1|2972785_2974621_+	short-chain fatty acid transporter	NA	A0A0K2FIZ6	Escherichia_phage	45.2	1.0e-40
AXZ02974.1|2974620_2975235_+|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
AXZ02975.1|2975241_2975715_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	8.1e-35
AXZ02976.1|2975786_2976359_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
AXZ02977.1|2980032_2980992_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
2979913:2979935	attR	TGCTACCCGAAACGGGTTTATTT	NA	NA	NA	NA
AXZ02978.1|2981158_2982961_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	6.5e-32
AXZ02979.1|2982947_2984750_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
AXZ02980.1|2984742_2986023_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
AXZ02981.1|2986050_2987355_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
AXZ02982.1|2987548_2988811_-	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
AXZ05155.1|2989148_2989946_-	protein MtfA	NA	NA	NA	NA	NA
AXZ02983.1|2990433_2990763_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ02984.1|2990798_2991449_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
AXZ02985.1|2991709_2993057_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
>prophage 10
CP032201	Escherichia coli strain AR_0086 chromosome, complete genome	5107215	3042610	3125119	5107215	portal,plate,tRNA,integrase,capsid,tail,terminase,holin,head	Pectobacterium_phage(23.81%)	98	3042425:3042484	3085036:3085160
3042425:3042484	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
AXZ03043.1|3042610_3043627_-|integrase	integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
AXZ03044.1|3043595_3043859_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
AXZ03045.1|3043794_3044019_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	56.3	7.3e-10
AXZ03046.1|3044068_3044251_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ03047.1|3044250_3044820_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
AXZ03048.1|3044816_3047033_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
AXZ03049.1|3047063_3047384_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ03050.1|3048394_3048808_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
AXZ03051.1|3048906_3049137_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
AXZ03052.1|3049195_3049672_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
AXZ03053.1|3049711_3049936_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
AXZ03054.1|3049932_3050688_+	replication protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
AXZ03055.1|3050677_3052093_+	helicase DnaB	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
AXZ03056.1|3052131_3052542_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ03057.1|3052543_3052780_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ03058.1|3052776_3053088_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
AXZ03059.1|3053084_3053309_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ03060.1|3053496_3053718_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ05159.1|3053990_3054779_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
AXZ03061.1|3054953_3055877_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ03062.1|3057064_3057763_+	lysogenic protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
AXZ03063.1|3058225_3058831_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ03064.1|3058840_3059329_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
AXZ03065.1|3059727_3059961_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ03066.1|3060204_3060846_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ03067.1|3060997_3061177_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ03068.1|3061254_3061851_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
AXZ03069.1|3061847_3062141_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
AXZ03070.1|3062140_3062812_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
AXZ03071.1|3062924_3063308_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ03072.1|3063307_3063580_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
AXZ03073.1|3063579_3064059_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
AXZ03074.1|3064066_3064261_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ05160.1|3064320_3064566_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ03075.1|3064934_3065501_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
AXZ03076.1|3065487_3067350_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
AXZ03077.1|3067349_3067583_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ03078.1|3067579_3069154_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
AXZ03079.1|3069153_3070461_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
AXZ03080.1|3070460_3070790_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
AXZ03081.1|3070848_3071883_+|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
AXZ03082.1|3071917_3072337_+	DNA-packaging protein	NA	NA	NA	NA	NA
AXZ03083.1|3072333_3072714_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ03084.1|3072745_3073426_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ03085.1|3073422_3073959_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ03086.1|3073939_3074842_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
AXZ03087.1|3074844_3075186_+|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
AXZ03088.1|3075182_3076103_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
AXZ03089.1|3076105_3076732_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
AXZ03090.1|3076724_3077909_+	hypothetical protein	NA	J9QDX3	Clostridium_phage	35.2	2.5e-16
AXZ03091.1|3077908_3078298_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
AXZ03092.1|3078294_3079797_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
AXZ03093.1|3079814_3080327_+|tail	phage tail protein	tail	NA	NA	NA	NA
AXZ03094.1|3080339_3080621_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AXZ03095.1|3080729_3082370_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
AXZ05161.1|3082405_3082795_+	hypothetical protein	NA	E5FFG4	Burkholderia_phage	37.9	1.0e-14
AXZ03096.1|3082956_3083181_+|tail	phage tail protein	tail	NA	NA	NA	NA
AXZ03097.1|3084395_3084815_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
AXZ03098.1|3085286_3085952_+	YecA family protein	NA	NA	NA	NA	NA
3085036:3085160	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
AXZ03099.1|3086002_3087214_-	tyrosine transporter	NA	NA	NA	NA	NA
AXZ03100.1|3087404_3087644_+	DUF2492 family protein	NA	NA	NA	NA	NA
AXZ03101.1|3087681_3088179_-	non-heme ferritin	NA	NA	NA	NA	NA
AXZ03102.1|3088350_3088674_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ03103.1|3088937_3089024_+	stress response protein AzuC	NA	NA	NA	NA	NA
AXZ03104.1|3089138_3089390_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AXZ03105.1|3089467_3089971_-	non-heme ferritin	NA	NA	NA	NA	NA
AXZ03106.1|3090440_3090680_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ03107.1|3090765_3091755_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ03108.1|3091824_3093339_+	arabinose import ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
AXZ03109.1|3093353_3094340_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
AXZ03110.1|3094506_3095307_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AXZ03111.1|3095281_3096706_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AXZ03112.1|3096712_3097141_-	universal stress protein UspC	NA	NA	NA	NA	NA
AXZ03113.1|3097920_3098271_+	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
AXZ03114.1|3098273_3098852_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
AXZ03115.1|3098978_3099866_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AXZ03116.1|3099862_3100789_+	motility protein MotB	NA	NA	NA	NA	NA
AXZ03117.1|3100793_3102758_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
AXZ03118.1|3102778_3103282_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXZ03119.1|3103426_3105088_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AXZ03120.1|3105378_3106239_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AXZ03121.1|3106241_3107291_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AXZ03122.1|3107305_3107695_+	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AXZ03123.1|3107705_3108350_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
AXZ03124.1|3108538_3109687_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
AXZ03125.1|3109679_3111758_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AXZ03126.1|3111757_3112150_+	flagellar protein FlhE	NA	NA	NA	NA	NA
AXZ03127.1|3112202_3113936_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
AXZ05162.1|3114151_3114718_+	VOC family protein	NA	NA	NA	NA	NA
AXZ03128.1|3114731_3115478_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AXZ03129.1|3115865_3116966_+	cytochrome C	NA	NA	NA	NA	NA
AXZ03130.1|3116990_3119420_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AXZ03131.1|3119455_3120427_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AXZ03132.1|3120423_3121167_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AXZ03133.1|3121207_3121603_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ03134.1|3121655_3122474_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
AXZ03135.1|3122470_3123037_-	hydrolase	NA	NA	NA	NA	NA
AXZ03136.1|3123346_3125119_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 11
CP032201	Escherichia coli strain AR_0086 chromosome, complete genome	5107215	3622802	3692516	5107215	transposase,portal,lysis,protease,capsid,integrase,tail,terminase,holin,head	Enterobacteria_phage(26.32%)	84	3651688:3651702	3693480:3693494
AXZ03602.1|3622802_3623852_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AXZ03603.1|3624071_3624830_+	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
AXZ03604.1|3624826_3625417_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AXZ03605.1|3625473_3625782_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ05187.1|3625791_3626778_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ03606.1|3626983_3627859_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AXZ03607.1|3628071_3629967_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AXZ03608.1|3629994_3630615_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AXZ03609.1|3630611_3631493_-	phosphatase	NA	NA	NA	NA	NA
AXZ05188.1|3631630_3631675_+	trp operon leader peptide	NA	NA	NA	NA	NA
AXZ03610.1|3631766_3633329_+	anthranilate synthase component I	NA	NA	NA	NA	NA
AXZ03611.1|3633328_3634924_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AXZ03612.1|3634927_3636286_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
AXZ03613.1|3636297_3637491_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AXZ03614.1|3637490_3638297_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AXZ03615.1|3638672_3638948_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
AXZ03616.1|3638944_3639502_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
AXZ03617.1|3639913_3640183_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
AXZ05189.1|3640281_3640908_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXZ03618.1|3640852_3640990_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AXZ05190.1|3641106_3641289_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
AXZ03619.1|3641414_3642383_+|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
AXZ03620.1|3642398_3642926_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
AXZ03621.1|3642956_3643490_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
AXZ03622.1|3643491_3646317_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
AXZ03623.1|3646778_3647525_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AXZ03624.1|3647539_3649081_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
3651688:3651702	attL	CGGGTGGCAGCATCA	NA	NA	NA	NA
AXZ03625.1|3653536_3654217_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.8	3.8e-110
AXZ03626.1|3654114_3654858_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
AXZ03627.1|3654868_3655567_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
AXZ03628.1|3655566_3655908_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
AXZ03629.1|3655900_3659143_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
AXZ03630.1|3659190_3659472_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AXZ03631.1|3659495_3659870_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
AXZ03632.1|3659884_3660601_-|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
AXZ03633.1|3660667_3661012_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AXZ03634.1|3661008_3661455_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AXZ03635.1|3661451_3661802_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AXZ03636.1|3661811_3662138_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
AXZ03637.1|3662134_3664720_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
AXZ03638.1|3664665_3664887_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AXZ03639.1|3664931_3666869_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
AXZ03640.1|3666932_3668594_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
AXZ03641.1|3668590_3669154_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
AXZ03642.1|3669444_3669810_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
AXZ03643.1|3669851_3670052_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
AXZ05191.1|3670089_3670254_-	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	77.8	3.3e-12
AXZ03644.1|3670250_3670466_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ03645.1|3670462_3670957_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	87.7	1.7e-72
AXZ05192.1|3670958_3671045_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ03646.1|3671309_3671522_-	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	60.5	2.7e-06
AXZ03647.1|3671599_3672133_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
AXZ03648.1|3672238_3672511_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ03649.1|3672476_3672821_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
AXZ03650.1|3672825_3673041_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AXZ03651.1|3673191_3675045_-	DUF1737 domain-containing protein	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
AXZ03652.1|3675305_3675641_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
AXZ03653.1|3675921_3676053_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
AXZ05193.1|3676088_3676415_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ03654.1|3676854_3677904_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
AXZ03655.1|3678055_3678253_-	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
AXZ03656.1|3678479_3679301_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
AXZ03657.1|3679297_3679678_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
AXZ03658.1|3679678_3680734_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
AXZ03659.1|3680735_3681008_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
AXZ05194.1|3680954_3681134_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ03660.1|3681175_3681388_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
AXZ03661.1|3681568_3682234_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ03662.1|3682408_3682834_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
AXZ03663.1|3682849_3683620_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
AXZ03664.1|3683641_3684388_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
AXZ03665.1|3684394_3685357_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
AXZ03666.1|3685379_3685805_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AXZ03667.1|3685801_3686017_-	transcriptional regulator	NA	NA	NA	NA	NA
AXZ03668.1|3686066_3686783_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
AXZ05195.1|3687055_3687211_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AXZ03669.1|3687170_3687341_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ03670.1|3687370_3687589_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ03671.1|3687637_3687832_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ03672.1|3688154_3688343_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AXZ03673.1|3688339_3688531_+	DUF1482 family protein	NA	NA	NA	NA	NA
AXZ03674.1|3688623_3691095_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
AXZ03675.1|3691159_3691408_+	excisionase	NA	NA	NA	NA	NA
AXZ03676.1|3691385_3692516_+|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
3693480:3693494	attR	TGATGCTGCCACCCG	NA	NA	NA	NA
>prophage 12
CP032201	Escherichia coli strain AR_0086 chromosome, complete genome	5107215	3830477	3877439	5107215	transposase,portal,tRNA,capsid,integrase,tail,terminase,holin,head	Enterobacteria_phage(54.9%)	60	3849261:3849275	3879108:3879122
AXZ03813.1|3830477_3830756_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
AXZ03814.1|3830752_3832774_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
AXZ03815.1|3832832_3836315_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
AXZ03816.1|3836375_3837017_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	2.9e-96
AXZ03817.1|3836914_3837658_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
AXZ03818.1|3837662_3838361_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
AXZ03819.1|3838360_3838690_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
AXZ03820.1|3838686_3841248_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
AXZ03821.1|3841240_3841675_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AXZ03822.1|3841656_3842079_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
AXZ05203.1|3842094_3842835_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
AXZ03823.1|3842842_3843238_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
AXZ03824.1|3843234_3843813_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
AXZ03825.1|3843824_3844178_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
AXZ03826.1|3844189_3844588_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
AXZ03827.1|3844629_3845655_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
AXZ03828.1|3845710_3846043_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AXZ03829.1|3846052_3847372_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
AXZ03830.1|3847352_3848954_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
AXZ03831.1|3848950_3849157_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AXZ03832.1|3849153_3851079_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
3849261:3849275	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
AXZ03833.1|3851053_3851599_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
AXZ03834.1|3851738_3851933_-	DNA-packaging protein	NA	NA	NA	NA	NA
AXZ03835.1|3851867_3852188_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ03836.1|3852075_3852429_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ03837.1|3852551_3852932_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AXZ03838.1|3853358_3853652_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
AXZ03839.1|3853742_3853925_-	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
AXZ03840.1|3854141_3854618_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
AXZ03841.1|3854604_3854922_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.1	3.3e-40
AXZ03842.1|3855231_3855921_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
AXZ03843.1|3855917_3856058_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
AXZ03844.1|3856054_3856417_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
AXZ03845.1|3856413_3856704_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
AXZ03846.1|3856696_3856867_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AXZ03847.1|3856866_3857322_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
AXZ03848.1|3857318_3857420_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ03849.1|3857769_3858813_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXZ03850.1|3861298_3862446_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
AXZ03851.1|3864617_3865319_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
AXZ03852.1|3865315_3866335_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
AXZ03853.1|3866331_3866871_-	regulator	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
AXZ03854.1|3866940_3867171_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AXZ03855.1|3867209_3867965_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AXZ03856.1|3868560_3868767_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AXZ03857.1|3868842_3869139_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
AXZ03858.1|3869144_3869930_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AXZ03859.1|3869926_3870607_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
AXZ03860.1|3870603_3870786_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
AXZ03861.1|3870758_3870950_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
AXZ03862.1|3870960_3871242_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
AXZ03863.1|3871340_3871562_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
AXZ03864.1|3871561_3871888_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
AXZ03865.1|3871871_3872111_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
AXZ03866.1|3872250_3872487_+	excisionase	NA	NA	NA	NA	NA
AXZ03867.1|3872476_3873619_+|integrase	integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
AXZ03868.1|3873732_3874983_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
AXZ03869.1|3875154_3875808_+	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AXZ03870.1|3875817_3876279_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AXZ03871.1|3876332_3877439_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3879108:3879122	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
>prophage 13
CP032201	Escherichia coli strain AR_0086 chromosome, complete genome	5107215	4074547	4198557	5107215	transposase,portal,protease,plate,tRNA,integrase,capsid,tail,terminase,holin,head	Enterobacteria_phage(42.27%)	145	4141935:4141954	4180592:4180611
AXZ04056.1|4074547_4075333_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AXZ04057.1|4075468_4076248_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AXZ04058.1|4076224_4077118_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ04059.1|4077271_4078018_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AXZ04060.1|4078014_4078197_-	protein YcaR	NA	NA	NA	NA	NA
AXZ04061.1|4078248_4079481_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXZ04062.1|4079517_4080504_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AXZ04063.1|4080500_4082249_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
AXZ04064.1|4082285_4084550_-	ComEC family protein	NA	NA	NA	NA	NA
AXZ04065.1|4084755_4085040_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AXZ04066.1|4085199_4086873_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AXZ04067.1|4086983_4087667_-	cytidylate kinase	NA	NA	NA	NA	NA
AXZ04068.1|4087839_4088622_-|protease	metalloprotease	protease	NA	NA	NA	NA
AXZ04069.1|4088765_4089155_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
AXZ04070.1|4089126_4089576_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
AXZ04071.1|4089577_4089784_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ04072.1|4089773_4090004_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ04073.1|4090000_4090684_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
AXZ04074.1|4090680_4090896_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ04075.1|4090910_4091207_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ04076.1|4091216_4091489_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ04077.1|4091545_4091767_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ04078.1|4091777_4092308_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
AXZ04079.1|4092335_4092605_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ04080.1|4092607_4093774_-	hypothetical protein	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
AXZ04081.1|4093784_4095554_-|transposase	transposase	transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
AXZ04082.1|4095569_4095887_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ04083.1|4095886_4096807_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
AXZ04084.1|4096817_4097126_-	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
AXZ04085.1|4097178_4097367_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
AXZ04086.1|4097460_4097817_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXZ04087.1|4097933_4098698_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
AXZ04088.1|4098888_4099104_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ04089.1|4099102_4099507_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ04090.1|4099482_4100211_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ04091.1|4100341_4100692_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
AXZ04092.1|4100694_4101435_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
AXZ04093.1|4101418_4102069_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
AXZ04094.1|4102065_4102392_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
AXZ04095.1|4102391_4102703_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AXZ04096.1|4102702_4103248_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AXZ04097.1|4103244_4104840_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.5e-185
AXZ04098.1|4104839_4106336_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
AXZ04099.1|4106316_4107138_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
AXZ04100.1|4107140_4107599_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
AXZ04101.1|4107813_4108929_+	peptidase	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
AXZ04102.1|4108943_4109897_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
AXZ04103.1|4109906_4110245_+	DUF2190 family protein	NA	NA	NA	NA	NA
AXZ04104.1|4110246_4110693_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AXZ04105.1|4110692_4111157_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AXZ04106.1|4111153_4111408_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ04107.1|4111397_4112825_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
AXZ04108.1|4112824_4113346_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
AXZ04109.1|4113348_4113630_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ04110.1|4113727_4114063_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AXZ04111.1|4113986_4114145_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AXZ04112.1|4114220_4117172_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
AXZ04113.1|4117171_4118056_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.9	6.8e-51
AXZ04114.1|4118052_4118268_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
AXZ04115.1|4118255_4119410_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
AXZ04116.1|4119406_4120003_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
AXZ04117.1|4120057_4120405_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
AXZ04118.1|4120395_4121499_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
AXZ04119.1|4121491_4122070_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
AXZ04120.1|4122072_4123320_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
AXZ04121.1|4123360_4123843_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	44.7	7.5e-28
AXZ04122.1|4123842_4124457_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
AXZ04123.1|4124463_4124925_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
AXZ04124.1|4124996_4125569_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
AXZ04125.1|4125824_4127108_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AXZ04126.1|4127178_4128267_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
AXZ04127.1|4128465_4129158_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AXZ04128.1|4129287_4131048_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AXZ04129.1|4131453_4132311_+	formate transporter FocA	NA	NA	NA	NA	NA
AXZ04130.1|4132365_4134648_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AXZ04131.1|4134839_4135580_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
AXZ04132.1|4135676_4136825_-	MFS transporter	NA	NA	NA	NA	NA
AXZ04133.1|4137138_4137765_+	hydrolase	NA	NA	NA	NA	NA
AXZ04134.1|4137800_4138664_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AXZ04135.1|4138665_4139283_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AXZ04136.1|4139293_4141738_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
4141935:4141954	attL	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
AXZ04137.1|4142037_4143030_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
AXZ05219.1|4143099_4143441_-	XRE family transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
AXZ04138.1|4143545_4144067_+	transcriptional regulator	NA	NA	NA	NA	NA
AXZ04139.1|4144071_4144494_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ04140.1|4144500_4144692_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ04141.1|4144829_4145180_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
AXZ04142.1|4145190_4145469_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
AXZ04143.1|4145480_4145723_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AXZ04144.1|4145926_4146337_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ04145.1|4146360_4146564_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
AXZ04146.1|4146560_4146827_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
AXZ04147.1|4146823_4147123_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
AXZ04148.1|4147173_4147389_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ04149.1|4147445_4147676_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	97.4	9.1e-32
AXZ04150.1|4147748_4148114_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
AXZ05220.1|4148258_4150943_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
AXZ04151.1|4151019_4151979_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
AXZ04152.1|4151983_4152298_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
AXZ04153.1|4152381_4153224_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ04154.1|4153263_4153761_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
AXZ04155.1|4154484_4155009_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ04156.1|4155023_4156070_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
AXZ04157.1|4156069_4157821_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
AXZ04158.1|4157975_4158812_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
AXZ04159.1|4158835_4159888_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
AXZ04160.1|4159933_4160734_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
AXZ04161.1|4160835_4161330_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
AXZ04162.1|4161329_4161530_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AXZ04163.1|4161532_4161856_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
AXZ04164.1|4161852_4162245_+	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
AXZ04165.1|4162241_4162637_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
AXZ04166.1|4162775_4164653_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
AXZ04167.1|4164676_4165144_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
AXZ04168.1|4165136_4165772_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
AXZ04169.1|4165768_4166350_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
AXZ04170.1|4166346_4166697_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
AXZ04171.1|4166700_4167597_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
AXZ04172.1|4167589_4168120_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
AXZ04173.1|4168122_4170108_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	86.0	3.2e-173
AXZ04174.1|4170110_4170644_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
AXZ04175.1|4170672_4171200_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
AXZ04176.1|4171201_4171987_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	76.6	1.1e-108
AXZ04177.1|4172214_4172814_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
AXZ04178.1|4172842_4173337_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	2.1e-86
AXZ04179.1|4173343_4176151_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
AXZ04180.1|4176137_4176374_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AXZ04181.1|4176301_4176676_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
AXZ04182.1|4176731_4177244_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AXZ04183.1|4177243_4178428_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
AXZ04184.1|4178585_4179695_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
AXZ04185.1|4179735_4179996_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ04186.1|4180187_4180328_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AXZ04187.1|4180633_4181926_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
4180592:4180611	attR	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
AXZ04188.1|4182016_4183360_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AXZ04189.1|4183370_4183982_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AXZ04190.1|4184140_4188247_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AXZ04191.1|4188381_4188876_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AXZ04192.1|4189419_4190385_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
AXZ04193.1|4190507_4192274_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AXZ04194.1|4192274_4193996_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	1.4e-20
AXZ04195.1|4194037_4194742_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXZ04196.1|4195026_4195245_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXZ04197.1|4195929_4198206_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AXZ04198.1|4198236_4198557_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 14
CP032201	Escherichia coli strain AR_0086 chromosome, complete genome	5107215	4957647	4998431	5107215	tRNA,transposase,bacteriocin	unidentified_phage(16.67%)	43	NA	NA
AXZ04898.1|4957647_4958574_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AXZ04899.1|4958612_4960031_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
AXZ04900.1|4960027_4960507_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AXZ04901.1|4960854_4961439_+	fimbrial protein	NA	NA	NA	NA	NA
AXZ04902.1|4961535_4962276_+	fimbrial chaperone	NA	NA	NA	NA	NA
AXZ04903.1|4962310_4964911_+	outer membrane usher protein	NA	NA	NA	NA	NA
AXZ04904.1|4964927_4965500_+	fimbrial protein	NA	NA	NA	NA	NA
AXZ04905.1|4965514_4966117_+	fimbrial-like protein YadL	NA	NA	NA	NA	NA
AXZ04906.1|4966143_4966740_+	fimbrial protein StaF	NA	NA	NA	NA	NA
AXZ04907.1|4966791_4968045_+	fimbrial-like adhesin	NA	NA	NA	NA	NA
AXZ04908.1|4968157_4968952_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
AXZ04909.1|4968963_4969815_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AXZ04910.1|4969896_4970094_-|transposase	transposase	transposase	NA	NA	NA	NA
AXZ04911.1|4970162_4971083_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	4.9e-60
AXZ04912.1|4971203_4971407_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ04913.1|4971356_4971737_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AXZ04914.1|4971740_4972970_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AXZ04915.1|4973033_4973474_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AXZ04916.1|4973578_4974349_-	inner membrane transport permease YadH	NA	NA	NA	NA	NA
AXZ04917.1|4974345_4975272_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
AXZ04918.1|4975380_4976043_+	carbonic anhydrase	NA	NA	NA	NA	NA
AXZ04919.1|4976083_4976620_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AXZ04920.1|4976825_4979216_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AXZ04921.1|4979262_4980813_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	3.5e-18
AXZ04922.1|4980978_4981326_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ04923.1|4981431_4982298_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AXZ04924.1|4982313_4983108_+	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AXZ04925.1|4983145_4983508_-	UPF0231 family protein	NA	NA	NA	NA	NA
AXZ04926.1|4983682_4986280_-	aconitate hydratase B	NA	NA	NA	NA	NA
AXZ04927.1|4986260_4986377_-	aconitate hydratase	NA	NA	NA	NA	NA
AXZ04928.1|4986634_4988398_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AXZ05246.1|4988468_4989893_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
AXZ04929.1|4990100_4991993_-	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AXZ04930.1|4992007_4994671_-	pyruvate dehydrogenase E1 component	NA	NA	NA	NA	NA
AXZ05247.1|4994652_4994835_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ04931.1|4994831_4995596_-	pyruvate dehydrogenase complex repressor	NA	NA	NA	NA	NA
AXZ04932.1|4996051_4996342_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AXZ04933.1|4996342_4996582_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ04934.1|4996749_4997040_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AXZ04935.1|4997093_4997282_-	HNH endonuclease	NA	NA	NA	NA	NA
AXZ04936.1|4997448_4997739_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AXZ04937.1|4997739_4997979_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ04938.1|4998146_4998431_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 1
CP032202	Escherichia coli strain AR_0086 plasmid unnamed1, complete sequence	140509	13063	52709	140509	protease,transposase	Escherichia_phage(46.15%)	49	NA	NA
AXZ05260.1|13063_14677_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AXZ05261.1|15221_15779_+	conjugal transfer protein	NA	NA	NA	NA	NA
AXZ05262.1|15930_16134_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ05263.1|16875_17337_+	endonuclease	NA	A0A0R6PHV6	Moraxella_phage	35.8	6.1e-19
AXZ05264.1|17439_17652_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ05265.1|17976_18414_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ05266.1|18354_18558_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ05267.1|18612_18762_+	type I toxin-antitoxin system hok family toxin	NA	NA	NA	NA	NA
AXZ05268.1|19046_19304_+	transcriptional regulator	NA	NA	NA	NA	NA
AXZ05397.1|19539_19614_+	positive regulator of RepFIC repA1 expression	NA	NA	NA	NA	NA
AXZ05269.1|19594_20464_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AXZ05270.1|20826_21213_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ05271.1|21402_22056_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXZ05272.1|22275_22740_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AXZ05273.1|22736_22841_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ05274.1|23024_24335_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AXZ05275.1|24611_25472_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AXZ05276.1|25770_26475_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXZ05277.1|26643_27504_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AXZ05278.1|28718_29543_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	99.6	1.5e-156
AXZ05279.1|29576_30281_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXZ05280.1|31219_31411_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ05281.1|31416_31662_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ05282.1|31712_32849_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AXZ05283.1|34277_34982_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXZ05284.1|35037_35874_+	EamA family transporter	NA	NA	NA	NA	NA
AXZ05285.1|35905_37105_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AXZ05286.1|37183_37837_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ05398.1|37868_38105_-	relaxase	NA	NA	NA	NA	NA
AXZ05287.1|38158_38995_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AXZ05288.1|38994_39798_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AXZ05289.1|39858_40674_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AXZ05290.1|40981_41194_-	replication C family protein	NA	NA	NA	NA	NA
AXZ05291.1|41218_41923_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ05292.1|42044_42950_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AXZ05293.1|42946_44185_+	MFS transporter	NA	NA	NA	NA	NA
AXZ05294.1|44184_44769_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ05295.1|44714_45071_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ05399.1|45261_46026_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXZ05296.1|46054_46237_+	resolvase	NA	NA	NA	NA	NA
AXZ05297.1|46252_46558_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ05298.1|46568_47774_-	chromate efflux transporter	NA	NA	NA	NA	NA
AXZ05299.1|47929_48133_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ05300.1|48151_48331_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ05301.1|48260_49100_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXZ05302.1|49093_49441_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXZ05303.1|49646_50435_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AXZ05400.1|50565_51039_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
AXZ05304.1|52004_52709_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
