The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032204	Escherichia coli strain AR_0013 chromosome, complete genome	5410835	832531	892264	5410835	integrase,plate,transposase,tRNA,tail	Burkholderia_phage(21.74%)	64	824911:824926	844726:844741
824911:824926	attL	TCGGCGGTATGCTGGC	NA	NA	NA	NA
AXZ40916.1|832531_832678_-|integrase	integrase	integrase	NA	NA	NA	NA
AXZ40917.1|832636_832918_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ40918.1|833016_833553_-	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AXZ40919.1|833807_836630_+	ABC-ATPase UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	0.0e+00
AXZ40920.1|836664_837012_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AXZ40921.1|837015_837432_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
AXZ40922.1|837542_838256_-	class B acid phosphatase	NA	NA	NA	NA	NA
AXZ40923.1|838656_839160_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ40924.1|839382_840576_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
AXZ40925.1|840828_841908_-	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
AXZ40926.1|841960_843376_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	2.4e-199
AXZ40927.1|843458_844442_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AXZ40928.1|844607_844850_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
844726:844741	attR	GCCAGCATACCGCCGA	NA	NA	NA	NA
AXZ40929.1|844983_846021_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AXZ40930.1|846382_847387_-	DUF2713 family protein	NA	NA	NA	NA	NA
AXZ40931.1|847704_848220_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AXZ40932.1|848261_848471_-	CsbD family protein	NA	NA	NA	NA	NA
AXZ40933.1|848586_849966_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
AXZ40934.1|849984_850593_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AXZ40935.1|850702_851071_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AXZ45171.1|851241_853665_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AXZ40936.1|853819_854692_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AXZ40937.1|854704_855202_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AXZ40938.1|855215_855308_-	chorismate lyase	NA	NA	NA	NA	NA
AXZ40939.1|855424_857005_-	SopA family protein	NA	NA	NA	NA	NA
AXZ40940.1|857232_858153_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AXZ40941.1|858395_859736_-	maltoporin	NA	NA	NA	NA	NA
AXZ40942.1|859807_860923_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
AXZ40943.1|861099_861195_+	sugar ABC transporter	NA	NA	NA	NA	NA
AXZ40944.1|861287_862478_+	maltose-binding periplasmic protein	NA	NA	NA	NA	NA
AXZ40945.1|862631_864176_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AXZ40946.1|864190_865081_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AXZ40947.1|865174_865585_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AXZ40948.1|865798_866077_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ40949.1|866123_868220_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AXZ40950.1|868219_868957_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ40951.1|868953_869592_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AXZ40952.1|869705_869948_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ40953.1|870301_871951_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AXZ40954.1|872475_873825_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AXZ40955.1|873879_874227_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
AXZ40956.1|874324_874516_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ40957.1|874560_875079_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
AXZ40958.1|875097_876318_+|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
AXZ40959.1|876656_876944_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	47.7	8.7e-16
AXZ40960.1|876946_877552_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
AXZ40961.1|877564_877879_+	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
AXZ40962.1|878025_878481_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ40963.1|878477_878675_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ40964.1|878664_880089_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	69.8	3.5e-190
AXZ40965.1|880088_880613_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
AXZ40966.1|880663_880981_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AXZ40967.1|880940_881069_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AXZ40968.1|881170_883546_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	25.7	1.0e-56
AXZ40969.1|883545_884499_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.0	1.3e-34
AXZ40970.1|884498_884708_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	58.8	2.8e-16
AXZ40971.1|884695_885736_+	phage protein D	NA	A4JWL3	Burkholderia_virus	45.4	3.9e-74
AXZ40972.1|885745_886447_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
AXZ40973.1|886545_886905_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	4.7e-35
AXZ40974.1|886895_888011_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.7	2.0e-100
AXZ40975.1|888721_890302_+	short-chain fatty acid transporter	NA	A0A0M3ULH6	Salmonella_phage	40.8	1.3e-84
AXZ40976.1|890298_891006_+	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	4.1e-14
AXZ40977.1|891002_891458_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	43.3	1.3e-26
AXZ40978.1|891472_892264_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	44.6	2.6e-46
>prophage 2
CP032204	Escherichia coli strain AR_0013 chromosome, complete genome	5410835	1069517	1107621	5410835	transposase,integrase,tRNA	Escherichia_phage(40.0%)	40	1084561:1084620	1109149:1109304
AXZ41123.1|1069517_1069955_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AXZ41124.1|1069951_1070824_-	virulence factor BrkB family protein	NA	NA	NA	NA	NA
AXZ41125.1|1070817_1071417_-	phosphatase	NA	NA	NA	NA	NA
AXZ41126.1|1071515_1072301_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
AXZ41127.1|1072334_1073231_-	sugar kinase	NA	NA	NA	NA	NA
AXZ41128.1|1073398_1074295_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
AXZ41129.1|1074318_1075197_+	sulfofructosephosphate aldolase	NA	NA	NA	NA	NA
AXZ41130.1|1075212_1076397_+	sulfoquinovose isomerase	NA	NA	NA	NA	NA
AXZ41131.1|1076455_1077367_+	aldose-1-epimerase	NA	NA	NA	NA	NA
AXZ41132.1|1077564_1079601_+	alpha-glucosidase	NA	NA	NA	NA	NA
AXZ41133.1|1079646_1081032_+	MFS transporter	NA	NA	NA	NA	NA
AXZ41134.1|1081074_1082478_+	MFS transporter	NA	NA	NA	NA	NA
AXZ45177.1|1082544_1083237_+	porin OmpL	NA	NA	NA	NA	NA
AXZ41135.1|1083328_1084552_-	MFS transporter	NA	NA	NA	NA	NA
1084561:1084620	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
AXZ41136.1|1084863_1085724_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AXZ41137.1|1086544_1087915_-|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
AXZ41138.1|1088029_1089166_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AXZ41139.1|1089216_1089462_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ41140.1|1089467_1089659_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ41141.1|1090140_1090683_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AXZ41142.1|1090695_1091556_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AXZ41143.1|1091721_1092426_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ45178.1|1092547_1093312_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXZ41144.1|1093502_1093859_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ41145.1|1093804_1094389_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ41146.1|1094388_1095627_-	MFS transporter	NA	NA	NA	NA	NA
AXZ41147.1|1095623_1096529_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AXZ41148.1|1096650_1097355_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ41149.1|1097522_1098728_-	chromate efflux transporter	NA	NA	NA	NA	NA
AXZ41150.1|1098883_1099087_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ41151.1|1099105_1099285_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ41152.1|1099214_1100054_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AXZ41153.1|1100047_1100395_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXZ41154.1|1100558_1101350_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AXZ41155.1|1101355_1101646_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AXZ41156.1|1101757_1102255_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AXZ41157.1|1102399_1103413_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXZ41158.1|1103351_1103966_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AXZ41159.1|1104091_1104652_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AXZ41160.1|1104654_1107621_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
1109149:1109304	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCA	NA	NA	NA	NA
>prophage 3
CP032204	Escherichia coli strain AR_0013 chromosome, complete genome	5410835	2554288	2626355	5410835	integrase,plate,transposase,tRNA,tail	Enterobacteria_phage(23.53%)	69	NA	NA
AXZ42459.1|2554288_2556919_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
AXZ42460.1|2557153_2557339_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AXZ42461.1|2558394_2558961_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AXZ42462.1|2558957_2559386_+	DedA family protein	NA	NA	NA	NA	NA
AXZ42463.1|2559458_2561015_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AXZ42464.1|2561164_2561680_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AXZ42465.1|2561743_2563282_-	multidrug effux MFS transporter subunit EmrB	NA	NA	NA	NA	NA
AXZ42466.1|2563298_2564471_-	multidrug export protein EmrA	NA	NA	NA	NA	NA
AXZ42467.1|2564625_2565954_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AXZ42468.1|2566035_2566566_-	multidrug efflux MFS transporter EmrAB transcriptional repressor MprA	NA	NA	NA	NA	NA
AXZ42469.1|2566656_2566992_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
AXZ42470.1|2566981_2567719_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXZ42471.1|2567842_2569027_-	MFS transporter	NA	NA	NA	NA	NA
AXZ42472.1|2569218_2570211_-	proline/glycine betaine ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
AXZ42473.1|2570267_2571332_-	proline/glycine betaine ABC transporter permease ProW	NA	NA	NA	NA	NA
AXZ42474.1|2571324_2572527_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
AXZ42475.1|2572516_2572765_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ42476.1|2572882_2573842_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.4	5.3e-134
AXZ42477.1|2573851_2575996_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.3	6.4e-196
AXZ42478.1|2575968_2576379_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
AXZ42479.1|2576375_2576621_-	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
AXZ42480.1|2576636_2576822_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ42481.1|2576829_2577261_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AXZ42482.1|2577348_2578683_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AXZ42483.1|2578739_2579069_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
AXZ42484.1|2579220_2579565_+	DUF2002 family protein	NA	NA	NA	NA	NA
AXZ42485.1|2579601_2580051_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
AXZ42486.1|2580717_2581122_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
AXZ42487.1|2581168_2581693_-	rhodanese-like domain-containing protein YgaP	NA	NA	NA	NA	NA
AXZ42488.1|2581702_2582002_-	transcriptional regulator	NA	NA	NA	NA	NA
AXZ42489.1|2582184_2582343_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
AXZ42490.1|2582426_2582876_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.6e-06
AXZ42491.1|2582876_2583539_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
AXZ42492.1|2583559_2584960_-	GABA permease	NA	NA	NA	NA	NA
AXZ42493.1|2585196_2586477_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	8.4e-34
AXZ42494.1|2586490_2587939_-	NADP-dependent succinate-semialdehyde dehydrogenase I	NA	NA	NA	NA	NA
AXZ42495.1|2587961_2589230_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
AXZ42496.1|2589249_2590227_-	protein CsiD	NA	NA	NA	NA	NA
AXZ42497.1|2590563_2592816_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ42498.1|2594204_2594561_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ42499.1|2595990_2596257_+	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	67.9	1.2e-11
AXZ42500.1|2598850_2599222_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ42501.1|2599515_2601039_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AXZ42502.1|2601567_2602473_+	hypothetical protein	NA	S5FM63	Shigella_phage	98.6	3.0e-118
AXZ42503.1|2602491_2603862_+	DNA circularization protein	NA	S5FUX4	Shigella_phage	97.8	3.1e-252
AXZ42504.1|2603858_2604938_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.2	1.7e-205
AXZ42505.1|2604937_2605486_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	97.8	9.6e-96
AXZ42506.1|2605482_2605911_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	100.0	2.3e-81
AXZ42507.1|2605897_2606956_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	5.6e-201
AXZ42508.1|2606946_2607531_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.0	1.6e-112
AXZ42509.1|2607534_2608485_+	carbohydrate kinase	NA	U5P0I1	Shigella_phage	82.7	9.5e-51
AXZ42510.1|2608481_2608880_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	46.9	1.3e-09
AXZ45238.1|2608921_2609914_-	acyltransferase	NA	G9L6E5	Escherichia_phage	28.6	5.2e-15
AXZ42511.1|2610346_2611120_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
AXZ42512.1|2611522_2612956_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
AXZ42513.1|2612990_2614199_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
AXZ42514.1|2614579_2614735_-|integrase	attP region and P4int integrase	integrase	NA	NA	NA	NA
AXZ42515.1|2614940_2617274_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
AXZ42516.1|2617288_2617609_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ42517.1|2617744_2618200_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
AXZ42518.1|2618192_2618480_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AXZ42519.1|2618472_2619072_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	3.0e-50
AXZ42520.1|2619068_2619335_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AXZ42521.1|2619887_2620622_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	99.6	9.4e-131
AXZ42522.1|2620618_2621119_+	transactivation protein	NA	NA	NA	NA	NA
AXZ42523.1|2621192_2621765_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
AXZ42524.1|2622083_2623892_+	hypothetical protein	NA	J7KK96	Streptococcus_phage	28.0	1.6e-14
AXZ42525.1|2623923_2625111_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	50.6	1.3e-105
AXZ42526.1|2625872_2626355_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 4
CP032204	Escherichia coli strain AR_0013 chromosome, complete genome	5410835	2760822	2769359	5410835		Escherichia_phage(66.67%)	9	NA	NA
AXZ42639.1|2760822_2762289_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
AXZ42640.1|2762357_2763935_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AXZ42641.1|2764811_2766335_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AXZ42642.1|2766628_2767000_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ42643.1|2767757_2768153_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	97.9	6.0e-15
AXZ42644.1|2768168_2768687_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
AXZ42645.1|2768789_2768936_-	succinate dehydrogenase	NA	NA	NA	NA	NA
AXZ42646.1|2768997_2769189_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AXZ42647.1|2769206_2769359_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 5
CP032204	Escherichia coli strain AR_0013 chromosome, complete genome	5410835	3161495	3224701	5410835	transposase,lysis,protease,tRNA	uncultured_Mediterranean_phage(11.76%)	54	NA	NA
AXZ42980.1|3161495_3161609_+|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AXZ42981.1|3161592_3162261_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
AXZ42982.1|3162277_3163435_+	DUF418 family protein	NA	NA	NA	NA	NA
AXZ42983.1|3163383_3163587_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ42984.1|3163576_3164617_+	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
AXZ42985.1|3164896_3165895_+	galactose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ42986.1|3165955_3167476_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
AXZ42987.1|3167491_3168502_+	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
AXZ42988.1|3168572_3169808_-	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
AXZ42989.1|3169801_3171040_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXZ42990.1|3171233_3171473_-	DUF2542 family protein	NA	NA	NA	NA	NA
AXZ42991.1|3171475_3172195_-	protein SanA	NA	NA	NA	NA	NA
AXZ42992.1|3172344_3173229_-	cytidine deaminase	NA	NA	NA	NA	NA
AXZ42993.1|3173358_3174054_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
AXZ42994.1|3174050_3174449_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ42995.1|3174687_3175635_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
AXZ42996.1|3175865_3176891_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXZ42997.1|3177141_3177324_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ42998.1|3177405_3178101_-	aquaporin Z	NA	NA	NA	NA	NA
AXZ42999.1|3178526_3180185_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AXZ43000.1|3180181_3181174_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AXZ43001.1|3181288_3182404_+	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AXZ43002.1|3182400_3184347_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AXZ43003.1|3184419_3184644_-	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AXZ43004.1|3184966_3185287_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AXZ43005.1|3185317_3187594_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AXZ43006.1|3187650_3187974_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ43007.1|3188340_3188559_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXZ43008.1|3188843_3189548_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXZ43009.1|3189589_3191311_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
AXZ43010.1|3191311_3193078_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
AXZ43011.1|3193200_3194166_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
AXZ43012.1|3194710_3195205_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AXZ43013.1|3195339_3199446_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AXZ43014.1|3199604_3200216_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AXZ43015.1|3200226_3201570_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.0	7.3e-81
AXZ43016.1|3201660_3202953_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AXZ43017.1|3203191_3205636_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
AXZ43018.1|3205646_3206264_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.1	1.9e-76
AXZ43019.1|3206265_3207129_+	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AXZ43020.1|3207163_3207790_-	hydrolase	NA	NA	NA	NA	NA
AXZ43021.1|3208104_3209253_+	MFS transporter	NA	NA	NA	NA	NA
AXZ43022.1|3209462_3210893_+	amino acid permease	NA	NA	NA	NA	NA
AXZ43023.1|3210893_3211802_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ43024.1|3211901_3212492_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
AXZ43025.1|3212573_3213314_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
AXZ43026.1|3213505_3215788_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
AXZ43027.1|3215842_3216700_-	formate transporter FocA	NA	NA	NA	NA	NA
AXZ43028.1|3217105_3218866_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AXZ43029.1|3218995_3219688_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AXZ43030.1|3219886_3220975_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
AXZ43031.1|3221045_3222329_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AXZ43032.1|3222401_3223730_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AXZ43033.1|3223936_3224701_+|protease	metalloprotease	protease	NA	NA	NA	NA
>prophage 6
CP032204	Escherichia coli strain AR_0013 chromosome, complete genome	5410835	3443600	3521512	5410835	portal,integrase,protease,plate,transposase,tRNA,tail,terminase,head,capsid	Enterobacteria_phage(24.29%)	104	3470769:3470783	3511049:3511063
AXZ43238.1|3443600_3445349_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.7	7.1e-92
AXZ43239.1|3445637_3445895_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43240.1|3445891_3446302_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AXZ43241.1|3446310_3446583_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AXZ43242.1|3446870_3448028_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	3.6e-137
AXZ43243.1|3448067_3448640_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	64.1	4.2e-62
AXZ43244.1|3448641_3449853_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	5.6e-189
AXZ43245.1|3449849_3450188_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
AXZ43246.1|3450184_3450481_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	2.4e-32
AXZ43247.1|3450480_3450921_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	1.9e-62
AXZ45267.1|3450913_3451087_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43248.1|3451209_3451566_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
AXZ43249.1|3451549_3453211_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.0	1.7e-276
AXZ43250.1|3453224_3453506_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43251.1|3454037_3455498_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AXZ43252.1|3455497_3456169_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AXZ43253.1|3456337_3457708_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
AXZ45268.1|3457711_3458353_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AXZ43254.1|3458388_3459495_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AXZ43255.1|3459548_3460010_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AXZ43256.1|3460019_3460658_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AXZ43257.1|3460990_3461326_-	DUF1493 family protein	NA	NA	NA	NA	NA
AXZ43258.1|3461325_3461775_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ43259.1|3462354_3463605_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
AXZ43260.1|3463718_3464861_-|integrase	integrase	integrase	Q77Z04	Phage_21	100.0	4.8e-206
AXZ43261.1|3464850_3465087_-	excisionase	NA	NA	NA	NA	NA
AXZ43262.1|3465226_3465466_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	92.4	2.0e-37
AXZ43263.1|3465513_3465732_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
AXZ43264.1|3465830_3466046_-	cell division protein ZapA	NA	M1FPM2	Enterobacteria_phage	97.2	6.5e-32
AXZ43265.1|3466053_3466806_-	hypothetical protein	NA	M1FN76	Enterobacteria_phage	100.0	6.4e-151
AXZ43266.1|3466802_3466961_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	98.1	1.5e-22
AXZ43267.1|3466957_3467638_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	3.0e-131
AXZ43268.1|3467634_3468420_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	99.2	4.5e-147
AXZ43269.1|3468425_3468722_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
AXZ43270.1|3468690_3468843_-	host-nuclease inhibitor protein Gam	NA	Q08J51	Stx2-converting_phage	98.0	4.7e-21
AXZ45269.1|3468797_3469067_-	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	97.8	1.9e-41
AXZ43271.1|3469146_3469515_-	lambda prophage-derived protein ea10	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
AXZ43272.1|3469635_3470848_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
3470769:3470783	attL	GAAAGGCTGGGCCAT	NA	NA	NA	NA
AXZ43273.1|3471490_3472704_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AXZ45270.1|3472806_3473133_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
AXZ43274.1|3473255_3473609_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45271.1|3473496_3473817_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ43275.1|3473751_3474003_+	DNA-packaging protein	NA	NA	NA	NA	NA
AXZ43276.1|3474084_3474633_+|terminase	phage terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
AXZ43277.1|3474870_3475344_+	hypothetical protein	NA	Q9EV15	Enterobacteria_phage	90.3	6.0e-70
AXZ43278.1|3475381_3475954_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
AXZ43279.1|3476025_3476538_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	48.5	4.4e-34
AXZ43280.1|3476537_3477152_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
AXZ43281.1|3477158_3478451_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	4.6e-40
AXZ43282.1|3478453_3479032_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
AXZ43283.1|3479024_3480128_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	8.3e-107
AXZ43284.1|3480520_3481117_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
AXZ43285.1|3481113_3482268_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	47.6	2.5e-85
AXZ43286.1|3482255_3482471_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
AXZ43287.1|3482467_3483352_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.9	6.8e-51
AXZ43288.1|3483351_3486303_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.6	2.0e-83
AXZ43289.1|3486378_3486537_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AXZ43290.1|3486460_3486796_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AXZ43291.1|3487177_3487699_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
AXZ43292.1|3487698_3489126_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
AXZ43293.1|3489115_3489370_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ43294.1|3489366_3489831_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AXZ43295.1|3489830_3490277_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AXZ43296.1|3490278_3490617_-	DUF2190 family protein	NA	NA	NA	NA	NA
AXZ43297.1|3490626_3491580_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
AXZ43298.1|3491594_3492710_-	peptidase	NA	A4JWJ9	Burkholderia_virus	51.6	5.5e-98
AXZ43299.1|3492924_3493383_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
AXZ43300.1|3493385_3494207_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
AXZ43301.1|3494187_3495684_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	4.0e-168
AXZ43302.1|3495683_3497279_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	63.0	2.2e-185
AXZ43303.1|3497371_3497821_-	DUF3486 family protein	NA	Q6QIC2	Burkholderia_phage	70.5	3.8e-50
AXZ43304.1|3497820_3498132_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AXZ43305.1|3498131_3498458_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AXZ43306.1|3498454_3499105_-	hypothetical protein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AXZ43307.1|3499088_3499829_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
AXZ43308.1|3499831_3500182_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
AXZ43309.1|3500312_3500789_+	ABC transporter ATPase	NA	NA	NA	NA	NA
AXZ43310.1|3501498_3502485_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ43311.1|3502481_3502943_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXZ43312.1|3502993_3503182_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	6.1e-18
AXZ43313.1|3503234_3503543_+	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	55.9	5.5e-24
AXZ43314.1|3503553_3504468_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	52.5	6.8e-70
AXZ43315.1|3504471_3506241_+|integrase	integrase	integrase	Q6QIE0	Burkholderia_phage	68.5	1.4e-228
AXZ43316.1|3506251_3507418_+	hypothetical protein	NA	A4JWN1	Burkholderia_virus	59.4	2.8e-121
AXZ43317.1|3507420_3507690_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43318.1|3507717_3508248_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.5e-58
AXZ43319.1|3508258_3508480_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ43320.1|3508536_3508809_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43321.1|3508818_3509115_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43322.1|3509129_3509345_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43323.1|3509341_3510025_+	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	36.2	1.4e-24
AXZ43324.1|3510702_3512226_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
3511049:3511063	attR	ATGGCCCAGCCTTTC	NA	NA	NA	NA
AXZ43325.1|3512519_3512891_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43326.1|3513772_3513988_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43327.1|3513977_3514430_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.9	1.6e-24
AXZ43328.1|3514401_3514791_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AXZ43329.1|3514927_3515125_+	hypothetical protein	NA	Q687E7	Enterobacteria_phage	96.5	2.4e-25
AXZ43330.1|3515189_3517589_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.2	3.0e-133
AXZ43331.1|3517585_3517867_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
AXZ43332.1|3517876_3518581_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
AXZ43333.1|3518591_3518885_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43334.1|3518976_3519834_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AXZ43335.1|3519830_3520688_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AXZ43336.1|3520684_3521512_-	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	7.6e-12
>prophage 7
CP032204	Escherichia coli strain AR_0013 chromosome, complete genome	5410835	3615152	3704444	5410835	integrase,protease,transposase,head,holin,tail,terminase,portal,capsid	Enterobacteria_phage(31.37%)	97	3630481:3630495	3652374:3652388
AXZ43429.1|3615152_3616481_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AXZ43430.1|3616606_3619282_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
AXZ43431.1|3619758_3620406_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
AXZ45278.1|3621143_3622775_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
AXZ43432.1|3622860_3623781_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AXZ43433.1|3623795_3624704_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
AXZ43434.1|3624715_3625729_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
AXZ43435.1|3625725_3626730_+	oligopeptide transport ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
AXZ43436.1|3626782_3627112_-	DUF440 family protein	NA	NA	NA	NA	NA
AXZ43437.1|3627146_3628607_-	cardiolipin synthase A	NA	NA	NA	NA	NA
AXZ43438.1|3628638_3628923_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43439.1|3628977_3630231_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
3630481:3630495	attL	AAACAAGAACACGGT	NA	NA	NA	NA
AXZ43440.1|3630530_3630827_-	YciI family protein	NA	NA	NA	NA	NA
AXZ45279.1|3631050_3631767_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
AXZ43441.1|3631806_3632205_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AXZ43442.1|3632309_3632849_-	intracellular septation protein A	NA	NA	NA	NA	NA
AXZ43443.1|3632878_3633622_-	UPF0259 family protein	NA	NA	NA	NA	NA
AXZ43444.1|3633977_3634616_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
AXZ43445.1|3634661_3635792_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
AXZ43446.1|3635769_3636018_-	excisionase	NA	NA	NA	NA	NA
AXZ43447.1|3636082_3638554_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
AXZ43448.1|3638649_3638838_-	DUF1482 family protein	NA	NA	NA	NA	NA
AXZ43449.1|3638834_3639023_-	cell division inhibitor	NA	NA	NA	NA	NA
AXZ45281.1|3638931_3639171_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43450.1|3639112_3639298_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43451.1|3639594_3639873_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45280.1|3639832_3640234_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	1.0e-09
AXZ45282.1|3640245_3640398_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	1.1e-06
AXZ43452.1|3640663_3641083_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
AXZ43453.1|3641183_3641465_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
AXZ43454.1|3641448_3641874_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AXZ45283.1|3641896_3642859_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	1.6e-69
AXZ43455.1|3642865_3643612_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
AXZ43456.1|3643633_3644404_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
AXZ43457.1|3644419_3644845_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	4.8e-63
AXZ43458.1|3645019_3645685_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43459.1|3645865_3646078_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
AXZ43460.1|3646119_3646299_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ43461.1|3646245_3646518_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
AXZ43462.1|3646519_3647575_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
AXZ43463.1|3647575_3647941_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	4.6e-38
AXZ43464.1|3647937_3648627_+	antiterminator	NA	I6PDF8	Cronobacter_phage	46.4	2.3e-54
AXZ43465.1|3648841_3649039_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
AXZ43466.1|3649189_3650239_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
AXZ43467.1|3650750_3650972_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43468.1|3651512_3653366_+	DUF1737 domain-containing protein	NA	Q08JA2	Stx2-converting_phage	90.2	0.0e+00
3652374:3652388	attR	AAACAAGAACACGGT	NA	NA	NA	NA
AXZ43469.1|3653516_3653732_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AXZ43470.1|3653736_3654081_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
AXZ43471.1|3654046_3654319_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ43472.1|3654424_3654958_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
AXZ43473.1|3656072_3656213_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43474.1|3656345_3656531_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
AXZ43475.1|3657267_3658791_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AXZ43476.1|3659084_3659456_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43477.1|3660517_3661027_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AXZ43478.1|3660998_3662927_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.9e-261
AXZ43479.1|3662910_3663117_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AXZ43480.1|3663113_3664706_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.7e-185
AXZ43481.1|3664695_3666201_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	2.7e-100
AXZ43482.1|3666237_3666585_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
AXZ43483.1|3666642_3667671_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
AXZ43484.1|3667722_3668106_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
AXZ43485.1|3668098_3668452_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
AXZ43486.1|3668467_3669001_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	2.6e-58
AXZ43487.1|3668997_3669393_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AXZ43488.1|3669400_3670147_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.0	5.6e-123
AXZ43489.1|3670165_3670597_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
AXZ43490.1|3670623_3671037_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AXZ43491.1|3671017_3673579_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
AXZ43492.1|3673575_3673905_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	4.7e-58
AXZ43493.1|3673904_3674603_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	95.7	1.3e-126
AXZ43494.1|3674613_3675357_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.3	4.9e-143
AXZ43495.1|3675254_3675935_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.6	2.1e-108
AXZ43496.1|3676278_3680058_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	83.9	0.0e+00
AXZ43497.1|3680125_3680725_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.5	1.3e-101
AXZ43498.1|3681585_3682742_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.8e-67
AXZ43499.1|3684203_3684482_+	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	46.2	3.0e-21
AXZ43500.1|3684491_3684788_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43501.1|3684905_3685238_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AXZ43502.1|3685423_3685876_+	VapA/VapB family virulence-associated protein	NA	NA	NA	NA	NA
AXZ43503.1|3686507_3686966_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AXZ43504.1|3687059_3687560_-	YciE/YciF family protein	NA	NA	NA	NA	NA
AXZ43505.1|3687645_3687825_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ43506.1|3688205_3689012_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AXZ43507.1|3689011_3690205_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AXZ45284.1|3690216_3691575_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	6.6e-37
AXZ43508.1|3691578_3693174_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
AXZ43509.1|3693173_3694736_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AXZ45285.1|3694827_3694872_-	trp operon leader peptide	NA	NA	NA	NA	NA
AXZ43510.1|3695009_3695891_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
AXZ43511.1|3695887_3696508_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AXZ43512.1|3696535_3698425_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AXZ43513.1|3698635_3699511_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AXZ43514.1|3701468_3701777_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43515.1|3701829_3702420_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AXZ43516.1|3702416_3703175_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
AXZ43517.1|3703394_3704444_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 8
CP032204	Escherichia coli strain AR_0013 chromosome, complete genome	5410835	3790371	3852078	5410835	transposase,integrase,tRNA	Enterobacteria_phage(28.57%)	52	3797990:3798049	3850811:3852121
AXZ43596.1|3790371_3791307_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.5e-144
AXZ43597.1|3791482_3791917_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AXZ43598.1|3792057_3793191_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	54.3	6.8e-104
AXZ43599.1|3793551_3797076_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AXZ43600.1|3797349_3797616_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
3797990:3798049	attL	CTGAACCGCCCCGGGAATCCTGGAGACTAAACTTCCTGAGAAAGAGGTAAACAGGATGAC	NA	NA	NA	NA
AXZ43601.1|3798044_3799257_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AXZ43602.1|3799458_3800448_-	lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
AXZ43603.1|3800655_3803295_+	YdbH family protein	NA	NA	NA	NA	NA
AXZ43604.1|3803291_3803477_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
AXZ43605.1|3803484_3803808_+	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
AXZ43606.1|3804260_3810140_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
AXZ43607.1|3810347_3811208_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
AXZ43608.1|3811271_3813578_+	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
AXZ43609.1|3813747_3814353_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
AXZ43610.1|3814352_3815249_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43611.1|3815264_3817031_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AXZ43612.1|3817938_3818310_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ43613.1|3818603_3820127_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AXZ43614.1|3820738_3821167_-	plasmid stability protein	NA	NA	NA	NA	NA
AXZ43615.1|3821135_3822107_-	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
AXZ43616.1|3822335_3822980_+	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
AXZ43617.1|3822973_3823249_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AXZ43618.1|3823386_3824196_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
AXZ43619.1|3824196_3824502_-	toxin CcdB	NA	NA	NA	NA	NA
AXZ43620.1|3824503_3824722_-	antitoxin CcdA	NA	NA	NA	NA	NA
AXZ43621.1|3825359_3825587_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43622.1|3826826_3827057_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ43623.1|3827043_3827685_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43624.1|3827741_3827948_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43625.1|3828061_3828550_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43626.1|3828859_3829837_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.5	6.1e-101
AXZ43627.1|3830079_3830820_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
AXZ43628.1|3830940_3831129_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AXZ43629.1|3831495_3832665_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43630.1|3833511_3833784_-	transcriptional regulator	NA	NA	NA	NA	NA
AXZ43631.1|3835026_3836997_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXZ43632.1|3837003_3837795_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
AXZ43633.1|3837975_3839189_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AXZ43634.1|3839290_3839551_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43635.1|3839547_3840117_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43636.1|3840174_3841387_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
AXZ43637.1|3841398_3841746_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45289.1|3841678_3841897_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43638.1|3841874_3842210_+	colicin transporter	NA	NA	NA	NA	NA
AXZ43639.1|3842227_3842437_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ43640.1|3842440_3842623_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ43641.1|3843009_3843204_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ43642.1|3844636_3845554_+	iron-regulated protein	NA	NA	NA	NA	NA
AXZ43643.1|3845561_3846338_+	energy transducer TonB	NA	NA	NA	NA	NA
AXZ43644.1|3846506_3848768_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXZ43645.1|3848737_3850012_+	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
AXZ43646.1|3850865_3852078_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
3850811:3852121	attR	CTGAACCGCCCCGGGAATCCTGGAGACTAAACTTCCTGAGAAAGAGGTAAACAGGATGACTAAAAATACTCGTTTTTCCCCCGAAGTCCGTCAACGGGCAGTCCGTATGGTTCTGGAAAGTCAGAGCGAATATGACTCACAATGGGCGACAATTTGTTCCATTGCTCCAAAGATTGGCTGTACGCCGGAGACTCTGCGTGTCTGGGTTCGCCAGCATGAGCGGGATACCGGGGGCGGTGATGGAGGGCTCACCACCGCTGAACGTCAGCGTCTGAAAGAGCTGGAACGTGAAAATCGTGAACTGCGCCGCAGTAACGATATCCTTCGCCAGGCTTCCGCTTATTTTGCGAAGGCGGAGTTCGACCGCCTCTGGAAAAAATGATGCCACTGCTGGATAAGCTGCGTGAGCAGTACGGGGTCGGACCGCTATGCAGCGAACTGCATATTGCCCCGTCAACGTATTACCACTGTCAGCAACAGCGACATCATCCGGATAAACGCAGTGCCCGTGCGCAGCGCGATGACTGGCTGAAGAAAGAGATACAGCGCGTATACGATGAAAATCACAAGGTATACGGTGTGCGTAAAGTCTGGCGTCAGTTGTTACGGGAAGGTATCAGAGTGGCCAGATGCACTGTGGCACGTCTCATGGCGGTTATGGGACTTGCCGGTGTTCTCCGGGGTAAAAAGGTCCGTACGACCATCAGCCGGAAAGCCGTTGCCGCAGGCGACCGCGTAAACCGTCAGTTCGTGGCAGAACGACCTGACCAGCTGTGGGTGGCTGATTTTACTTACGTCAGCACATGGCGGGGCTTCGTCTATGTGGCGTTCATCATTGATGTGTTTGCCGGATACATCGTGGGGTGGCGGGTCTCATCGTCCATGGAAACGACATTCGTGCTGGATGCACTGGAGCAGGCGTTATGGGCCCGTCGACCGTCCGGCACGGTCCATCACAGTGATAAAGGTTCTCAGTATGTATCGCTGGCCTACACACAGCGGCTTAAGGAAGCCGGATTACTGGCATCAACAGGAAGTACAGGCGACTCGTATGACAACGCGATGGCGGAGAGCATCAATGGTCTTTACAAAGCGGAGGTAATACACCGTAAGAGCTGGAAAAACCGTGCAGAAGTGGAACTGGCCACACTCACGTGGGTGGACTGGTATAACAATCGACGATTGCTGGAAAGGCTGGGCCATACTCCTCCGGCAGAAGCAGAAAAAGCTTATTATGCTTCCATCGGAAACGATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCA	NA	NA	NA	NA
>prophage 9
CP032204	Escherichia coli strain AR_0013 chromosome, complete genome	5410835	4016948	4040485	5410835	portal,plate,transposase,lysis,tail,head,capsid	Salmonella_phage(77.42%)	32	NA	NA
AXZ43792.1|4016948_4017167_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AXZ43793.1|4017257_4018358_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	1.7e-176
AXZ43794.1|4018354_4018840_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
AXZ43795.1|4018836_4021914_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
AXZ43796.1|4021906_4022026_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AXZ43797.1|4022040_4022343_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	9.1e-40
AXZ43798.1|4022397_4022913_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
AXZ43799.1|4023146_4023644_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	61.2	4.7e-49
AXZ43800.1|4023643_4024246_+|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	85.9	1.4e-92
AXZ43801.1|4024217_4024655_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	67.1	6.5e-47
AXZ43802.1|4024656_4025043_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXZ43803.1|4025073_4025640_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
AXZ43804.1|4027780_4028386_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
AXZ43805.1|4028378_4029287_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
AXZ43806.1|4029273_4029633_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
AXZ43807.1|4029629_4030208_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
AXZ43808.1|4030276_4030723_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	5.1e-63
AXZ43809.1|4030715_4031147_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	4.4e-72
AXZ43810.1|4031109_4031313_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	6.1e-24
AXZ43811.1|4031242_4031671_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.9e-47
AXZ43812.1|4031667_4032045_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
AXZ45295.1|4032046_4032520_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	2.2e-80
AXZ43813.1|4032539_4032755_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	78.9	6.9e-26
AXZ43814.1|4032758_4032962_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AXZ43815.1|4032961_4033426_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	3.2e-76
AXZ43816.1|4033521_4034172_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	95.4	5.6e-111
AXZ43817.1|4034175_4035234_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
AXZ43818.1|4035250_4036084_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.1e-122
AXZ43819.1|4036226_4037993_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AXZ43820.1|4037992_4039027_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.6	1.2e-168
AXZ43821.1|4039156_4040369_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AXZ43822.1|4040335_4040485_+	PapI protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	7.2e-06
>prophage 10
CP032204	Escherichia coli strain AR_0013 chromosome, complete genome	5410835	4336928	4426752	5410835	protease,holin,tRNA,tail,terminase,portal	Escherichia_phage(33.82%)	107	NA	NA
AXZ44109.1|4336928_4337810_-|protease	protease HtpX	protease	NA	NA	NA	NA
AXZ44110.1|4338001_4340050_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
AXZ44111.1|4340069_4340768_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AXZ44112.1|4340864_4341362_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AXZ44113.1|4341491_4342775_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AXZ44114.1|4342743_4345377_+	MCE family protein	NA	NA	NA	NA	NA
AXZ45309.1|4345456_4346896_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AXZ44115.1|4347013_4347250_+	DUF1480 family protein	NA	NA	NA	NA	NA
AXZ45310.1|4347354_4347546_+	DUF1482 family protein	NA	NA	NA	NA	NA
AXZ44116.1|4347546_4348203_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	1.5e-55
AXZ44117.1|4348596_4348938_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AXZ44118.1|4348950_4349823_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44119.1|4349826_4350201_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AXZ44120.1|4350339_4350570_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AXZ44121.1|4350671_4351328_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AXZ44122.1|4351351_4352014_+	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AXZ44123.1|4352010_4354071_-	oligopeptidase B	NA	NA	NA	NA	NA
AXZ44124.1|4354277_4354937_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
AXZ44125.1|4355262_4355619_-	protein YebF	NA	NA	NA	NA	NA
AXZ44126.1|4355685_4355976_-	damage-inducible protein YebG	NA	NA	NA	NA	NA
AXZ44127.1|4356109_4357288_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AXZ44128.1|4357343_4357985_-	KHG/KDPG aldolase	NA	NA	NA	NA	NA
AXZ44129.1|4358021_4359833_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AXZ44130.1|4360067_4361543_-	glucose-6-phosphate 1-dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
AXZ44131.1|4361879_4362749_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ44132.1|4362876_4364319_+	pyruvate kinase	NA	NA	NA	NA	NA
AXZ44133.1|4364450_4365422_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AXZ44134.1|4365540_4366863_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
AXZ45311.1|4366878_4367811_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AXZ44135.1|4367889_4368645_+	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AXZ44136.1|4368641_4369427_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AXZ44137.1|4369574_4370585_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AXZ44138.1|4370593_4371205_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AXZ45312.1|4371343_4371409_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44139.1|4371479_4372082_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
AXZ44140.1|4372083_4372605_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AXZ44141.1|4372639_4373380_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXZ44142.1|4373408_4373861_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AXZ44143.1|4373853_4375626_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AXZ44144.1|4375935_4376502_+	hydrolase	NA	NA	NA	NA	NA
AXZ44145.1|4376855_4377104_+	damage-inducible protein DinI	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
AXZ44146.1|4377221_4377509_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44147.1|4377518_4377797_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
AXZ44148.1|4377793_4379854_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	64.5	4.3e-149
AXZ44149.1|4379918_4380518_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	96.5	1.8e-108
AXZ44150.1|4380585_4384278_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.0	0.0e+00
AXZ44151.1|4384524_4385205_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.7	6.9e-112
AXZ44152.1|4385102_4385846_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.3	4.9e-143
AXZ44153.1|4385856_4386555_-|tail	phage minor tail protein L	tail	A0A0P0ZD82	Stx2-converting_phage	97.0	2.2e-129
AXZ44154.1|4386554_4386884_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AXZ44155.1|4386880_4389493_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.8	0.0e+00
AXZ44156.1|4389482_4389887_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	78.4	6.9e-43
AXZ44157.1|4389913_4390345_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	8.2e-42
AXZ44158.1|4390363_4391110_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	1.7e-124
AXZ44159.1|4391117_4391516_-|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
AXZ44160.1|4391528_4392152_-|tail	phage tail protein	tail	S5MBY4	Escherichia_phage	98.1	4.7e-99
AXZ44161.1|4392154_4392436_-	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	97.8	7.9e-46
AXZ44162.1|4392428_4392755_-	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	99.1	1.8e-49
AXZ45313.1|4392842_4394798_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	99.4	0.0e+00
AXZ44163.1|4394811_4396314_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.4	4.5e-289
AXZ44164.1|4396313_4396550_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	100.0	4.5e-34
AXZ44165.1|4396522_4398646_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	0.0e+00
AXZ44166.1|4398642_4399119_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
AXZ44167.1|4399173_4399377_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ44168.1|4399407_4399620_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	71.2	4.2e-23
AXZ44169.1|4399661_4399886_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44170.1|4399953_4400154_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	71.2	1.3e-13
AXZ44171.1|4400672_4401206_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.9	6.9e-99
AXZ44172.1|4401334_4401649_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	99.0	4.0e-54
AXZ44173.1|4401658_4402465_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	95.1	6.2e-144
AXZ44174.1|4402469_4402685_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AXZ44175.1|4402761_4403007_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	91.4	7.4e-16
AXZ44176.1|4403044_4403227_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
AXZ44177.1|4403361_4405332_-	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	66.1	1.1e-250
AXZ44178.1|4406105_4406819_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXZ44179.1|4406953_4407151_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
AXZ44180.1|4407366_4407747_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	3.2e-66
AXZ44181.1|4407764_4408754_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	2.1e-194
AXZ44182.1|4408761_4409571_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.3	9.0e-151
AXZ44183.1|4409590_4409980_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
AXZ44184.1|4409976_4410630_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.1	4.7e-126
AXZ44185.1|4410629_4411124_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	89.5	6.9e-77
AXZ44186.1|4411120_4412062_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.1	4.0e-150
AXZ44187.1|4412058_4412913_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	69.4	3.4e-100
AXZ44188.1|4412890_4413082_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	7.1e-14
AXZ45314.1|4413257_4413842_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
AXZ44189.1|4413879_4414080_-	cell division protein	NA	NA	NA	NA	NA
AXZ44190.1|4414177_4414804_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	3.2e-47
AXZ44191.1|4415160_4415655_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44192.1|4416223_4416586_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	94.2	7.5e-57
AXZ44193.1|4416651_4417476_+	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	97.8	3.3e-148
AXZ44194.1|4417603_4418140_+	HD family hydrolase	NA	S5MW55	Escherichia_phage	99.4	4.8e-100
AXZ44195.1|4418130_4418481_+	Eae protein	NA	A0A0P0ZBF8	Stx2-converting_phage	98.3	4.6e-59
AXZ44196.1|4418477_4419227_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	77.9	4.1e-49
AXZ44197.1|4419228_4419615_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	63.1	1.9e-29
AXZ44198.1|4419645_4419942_+	hypothetical protein	NA	B1GS43	Salmonella_phage	87.4	7.1e-37
AXZ44199.1|4419934_4420189_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	4.2e-38
AXZ44200.1|4420175_4420874_+	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	63.0	2.5e-48
AXZ44201.1|4420875_4421709_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	66.4	2.8e-46
AXZ44202.1|4421793_4422036_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	90.0	1.5e-32
AXZ44203.1|4422039_4422186_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	97.9	2.2e-23
AXZ44204.1|4422194_4422431_+	excisionase	NA	Q8W657	Enterobacteria_phage	100.0	9.9e-42
AXZ44205.1|4422486_4423800_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	96.1	1.1e-246
AXZ44206.1|4423781_4424552_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
AXZ44207.1|4424604_4425000_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ44208.1|4425040_4425784_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AXZ44209.1|4425780_4426752_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
>prophage 11
CP032204	Escherichia coli strain AR_0013 chromosome, complete genome	5410835	4432269	4520012	5410835	integrase,plate,transposase,holin,tRNA,tail,terminase,capsid	Enterobacteria_phage(66.0%)	101	4463467:4463483	4521705:4521721
AXZ44213.1|4432269_4434003_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	4.4e-86
AXZ44214.1|4434055_4434448_-	flagellar protein FlhE	NA	NA	NA	NA	NA
AXZ44215.1|4434447_4436526_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AXZ44216.1|4436518_4437667_-	flagellar biosynthetic protein FlhB	NA	NA	NA	NA	NA
AXZ44217.1|4437875_4438520_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
AXZ44218.1|4438530_4438920_-	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.7e-06
AXZ44219.1|4438934_4439984_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AXZ44220.1|4439986_4440847_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AXZ44221.1|4441137_4442799_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AXZ44222.1|4442943_4443447_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXZ44223.1|4443467_4445432_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AXZ44224.1|4445436_4446363_-	motility protein MotB	NA	NA	NA	NA	NA
AXZ44225.1|4446359_4447247_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AXZ44226.1|4447373_4447952_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
AXZ44227.1|4447954_4448305_-	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
AXZ44228.1|4449084_4449513_+	universal stress protein UspC	NA	NA	NA	NA	NA
AXZ44229.1|4449519_4450944_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AXZ44230.1|4450918_4451719_-	trehalose-phosphatase	NA	NA	NA	NA	NA
AXZ44231.1|4451885_4452872_-	arabinose ABC transporter permease	NA	NA	NA	NA	NA
AXZ44232.1|4452886_4454401_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	5.7e-13
AXZ44233.1|4454470_4455460_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ44234.1|4456256_4456760_+	non-heme ferritin	NA	NA	NA	NA	NA
AXZ44235.1|4456838_4457090_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AXZ44236.1|4457203_4457290_-	stress response protein AzuC	NA	NA	NA	NA	NA
AXZ44237.1|4457383_4457596_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44238.1|4457553_4457877_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ44239.1|4458048_4458546_+	non-heme ferritin	NA	NA	NA	NA	NA
AXZ44240.1|4458583_4458823_-	DUF2492 family protein	NA	NA	NA	NA	NA
AXZ44241.1|4459013_4460225_+	tyrosine transporter	NA	NA	NA	NA	NA
AXZ44242.1|4460274_4460940_-	YecA family protein	NA	NA	NA	NA	NA
AXZ44243.1|4461296_4462298_-|integrase	integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
AXZ44244.1|4462303_4462651_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AXZ44245.1|4462680_4463331_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44246.1|4463346_4463751_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
4463467:4463483	attL	AATCACCGCGTTTTTCA	NA	NA	NA	NA
AXZ44247.1|4463826_4464033_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ44248.1|4464049_4464253_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
AXZ44249.1|4464274_4464625_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
AXZ44250.1|4464635_4464914_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
AXZ44251.1|4464925_4465168_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
AXZ44252.1|4465370_4465787_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ44253.1|4465810_4466014_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	79.1	7.2e-25
AXZ44254.1|4466010_4466277_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.0	1.2e-30
AXZ44255.1|4466273_4466573_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	6.2e-41
AXZ44256.1|4466623_4466839_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44257.1|4466895_4467126_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	96.1	2.6e-31
AXZ44258.1|4467198_4467564_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	3.3e-60
AXZ44259.1|4467570_4470396_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.1	0.0e+00
AXZ44260.1|4470581_4471427_+	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	26.6	2.8e-09
AXZ44261.1|4471444_4473142_+	AAA family ATPase	NA	NA	NA	NA	NA
AXZ44262.1|4474879_4476631_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
AXZ44263.1|4476785_4477622_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	3.0e-149
AXZ44264.1|4477645_4478698_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.0	1.9e-188
AXZ44265.1|4478743_4479544_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	86.8	7.9e-123
AXZ44266.1|4479647_4480142_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	100.0	4.1e-90
AXZ44267.1|4480141_4480342_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	3.0e-31
AXZ44268.1|4480344_4480668_+|holin	phage holin, lambda family	holin	A0A0A7NRY9	Enterobacteria_phage	97.2	1.4e-49
AXZ44269.1|4480664_4481057_+	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	3.2e-69
AXZ44270.1|4481053_4481461_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	7.2e-64
AXZ44271.1|4481599_4483480_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.1	4.2e-300
AXZ44272.1|4483503_4483971_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	96.8	7.2e-84
AXZ44273.1|4483963_4484599_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
AXZ44274.1|4484595_4485177_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	8.6e-103
AXZ44275.1|4485173_4485524_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
AXZ44276.1|4485527_4486424_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	9.7e-154
AXZ44277.1|4486416_4487025_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	2.6e-86
AXZ44278.1|4487021_4488617_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	56.3	4.4e-141
AXZ44279.1|4488616_4489228_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	78.0	1.8e-82
AXZ45316.1|4489234_4489750_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	55.0	2.2e-38
AXZ44280.1|4489782_4490382_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.6e-86
AXZ44281.1|4490408_4490903_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	7.3e-87
AXZ44282.1|4490909_4493717_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.9	0.0e+00
AXZ44283.1|4493703_4493940_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	1.9e-21
AXZ44284.1|4493867_4494233_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
AXZ44285.1|4494287_4494800_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
AXZ44286.1|4494799_4495984_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.7	8.4e-222
AXZ44287.1|4496141_4497251_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.4	2.8e-203
AXZ44288.1|4497293_4497554_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ44289.1|4497745_4497886_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
AXZ44290.1|4499348_4499897_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AXZ44291.1|4499953_4501786_-	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AXZ44292.1|4501782_4502439_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXZ44293.1|4502897_4503122_+	DUF2594 family protein	NA	NA	NA	NA	NA
AXZ44294.1|4503189_4503912_-	transcriptional regulator SdiA	NA	NA	NA	NA	NA
AXZ44295.1|4504141_4504894_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
AXZ44296.1|4504890_4505559_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXZ44297.1|4505573_4506560_-	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
AXZ44298.1|4506664_4507465_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ44299.1|4507552_4508104_-	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
AXZ44300.1|4508149_4508869_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
AXZ44301.1|4509034_4509247_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	1.0e-05
AXZ44302.1|4509212_4510426_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AXZ44303.1|4512319_4513726_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
AXZ44304.1|4513750_4514161_+	flagella export chaperone FliS	NA	NA	NA	NA	NA
AXZ44305.1|4514160_4514526_+	flagellar protein FliT	NA	NA	NA	NA	NA
AXZ44306.1|4514603_4516091_+	alpha-amylase	NA	NA	NA	NA	NA
AXZ44307.1|4516124_4516538_-	lipoprotein	NA	NA	NA	NA	NA
AXZ44308.1|4516724_4517930_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
AXZ44309.1|4517926_4518160_+	SirA-like protein	NA	NA	NA	NA	NA
AXZ44310.1|4518268_4518937_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	6.9e-80
AXZ44311.1|4519047_4519527_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXZ44312.1|4519769_4520012_+|integrase	integrase	integrase	NA	NA	NA	NA
4521705:4521721	attR	TGAAAAACGCGGTGATT	NA	NA	NA	NA
>prophage 12
CP032204	Escherichia coli strain AR_0013 chromosome, complete genome	5410835	4550650	4591521	5410835	portal,lysis,holin,tail,terminase,head,capsid	Escherichia_phage(44.68%)	56	NA	NA
AXZ44350.1|4550650_4550929_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	7.9e-22
AXZ44351.1|4550925_4552989_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	65.7	4.2e-152
AXZ44352.1|4553053_4553653_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	8.5e-106
AXZ44353.1|4553720_4557413_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
AXZ44354.1|4557660_4558341_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.8	5.9e-111
AXZ44355.1|4558238_4558982_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.4	3.7e-143
AXZ44356.1|4558992_4559691_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.6e-127
AXZ44357.1|4559690_4560020_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AXZ44358.1|4560016_4562590_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.4	0.0e+00
AXZ44359.1|4562570_4562984_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AXZ44360.1|4563010_4563442_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
AXZ44361.1|4563460_4564207_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	8.7e-124
AXZ44362.1|4564214_4564610_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	1.7e-57
AXZ44363.1|4564606_4565182_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	8.3e-50
AXZ44364.1|4565197_4565551_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
AXZ44365.1|4565543_4565927_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
AXZ44366.1|4565978_4567007_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
AXZ44367.1|4567064_4567412_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	3.7e-21
AXZ44368.1|4567448_4568954_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	9.3e-101
AXZ44369.1|4568943_4570536_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	2.9e-185
AXZ44370.1|4570532_4570739_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AXZ44371.1|4570722_4572651_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.5	1.2e-262
AXZ44372.1|4572622_4573132_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AXZ44373.1|4573253_4573433_-	DNA-packaging protein	NA	NA	NA	NA	NA
AXZ44374.1|4573406_4573727_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ44375.1|4573614_4573968_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ44376.1|4574090_4574471_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AXZ44377.1|4574728_4575196_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
AXZ44378.1|4575344_4575560_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44379.1|4575683_4576217_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.6	3.3e-101
AXZ44380.1|4576253_4577144_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	70.3	6.7e-107
AXZ44381.1|4577148_4577364_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AXZ44382.1|4577439_4577709_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	76.4	1.8e-10
AXZ44383.1|4577746_4577929_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
AXZ44384.1|4578065_4580027_-	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	3.3e-239
AXZ44385.1|4580287_4580623_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
AXZ44386.1|4581007_4581205_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	2.3e-28
AXZ44387.1|4581431_4582253_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.4e-79
AXZ44388.1|4582249_4582624_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
AXZ44389.1|4582636_4583683_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.3	1.2e-110
AXZ44390.1|4583684_4583963_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	3.9e-05
AXZ44391.1|4584029_4584281_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44392.1|4584497_4584653_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AXZ44393.1|4584911_4585091_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44394.1|4585211_4585727_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	1.2e-36
AXZ44395.1|4585892_4586075_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	2.0e-26
AXZ44396.1|4586168_4586525_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
AXZ44397.1|4586502_4586964_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	91.7	3.8e-37
AXZ44398.1|4586960_4587257_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
AXZ44399.1|4587253_4587661_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.6e-39
AXZ44400.1|4587661_4588432_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	5.1e-87
AXZ44401.1|4588465_4589131_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.4e-79
AXZ44402.1|4589931_4590483_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44403.1|4590466_4590694_-	transcriptional regulator	NA	NA	NA	NA	NA
AXZ44404.1|4590720_4591179_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	6.2e-24
AXZ44405.1|4591368_4591521_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
>prophage 13
CP032204	Escherichia coli strain AR_0013 chromosome, complete genome	5410835	4704313	4713169	5410835		Enterobacteria_phage(42.86%)	8	NA	NA
AXZ44492.1|4704313_4705426_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	25.7	1.7e-14
AXZ44493.1|4705428_4706859_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AXZ44494.1|4706862_4707408_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.9	1.6e-47
AXZ44495.1|4707412_4708291_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.7e-107
AXZ44496.1|4708349_4709249_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
AXZ45326.1|4709248_4710334_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	3.9e-101
AXZ44497.1|4710706_4711600_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AXZ44498.1|4711774_4713169_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.4e-18
>prophage 14
CP032204	Escherichia coli strain AR_0013 chromosome, complete genome	5410835	4790470	4867794	5410835	lysis,holin,tRNA,tail,terminase,head,capsid	Enterobacteria_phage(45.45%)	83	NA	NA
AXZ44567.1|4790470_4792504_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
AXZ44568.1|4792644_4796451_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
AXZ44569.1|4796463_4800252_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
AXZ44570.1|4800261_4803900_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
AXZ44571.1|4803960_4804278_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ44572.1|4804981_4806070_+	MoxR family ATPase	NA	NA	NA	NA	NA
AXZ44573.1|4806080_4808360_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ44574.1|4808352_4809489_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
AXZ44575.1|4809485_4811486_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
AXZ44576.1|4811610_4812072_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AXZ44577.1|4812112_4812583_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
AXZ44578.1|4812629_4813349_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AXZ44579.1|4813345_4815031_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
AXZ44580.1|4815545_4815794_+	DinI family protein	NA	H6WZN4	Escherichia_phage	84.0	1.8e-30
AXZ44581.1|4815911_4816208_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44582.1|4816217_4816496_-	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	46.2	3.0e-21
AXZ44583.1|4816492_4818553_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	65.7	4.2e-152
AXZ44584.1|4818704_4819304_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	93.0	5.2e-103
AXZ44585.1|4819371_4823064_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.9	0.0e+00
AXZ44586.1|4823407_4824088_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	92.4	2.0e-103
AXZ44587.1|4823985_4824729_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.3	4.9e-143
AXZ44588.1|4824739_4825438_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.6e-127
AXZ44589.1|4825437_4825779_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
AXZ44590.1|4825771_4829038_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	79.8	0.0e+00
AXZ44591.1|4829085_4829367_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	95.7	3.3e-44
AXZ45333.1|4829390_4829765_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	91.9	2.9e-59
AXZ44592.1|4829778_4830492_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	95.4	3.5e-122
AXZ44593.1|4830558_4830903_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	91.2	1.0e-50
AXZ44594.1|4830899_4831346_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	98.6	5.8e-75
AXZ44595.1|4831342_4831693_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	97.4	1.5e-57
AXZ44596.1|4831704_4832031_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
AXZ44597.1|4834719_4834941_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
AXZ44598.1|4834985_4836923_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	97.5	0.0e+00
AXZ44599.1|4838645_4839209_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	84.9	4.0e-73
AXZ44600.1|4839499_4839865_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	3.5e-62
AXZ44601.1|4839906_4840098_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	94.8	1.2e-24
AXZ44602.1|4840239_4840566_-	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
AXZ44603.1|4840501_4840753_-	hypothetical protein	NA	H6WZK4	Escherichia_phage	95.7	4.2e-30
AXZ45334.1|4840674_4840908_-	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	78.0	1.7e-14
AXZ44604.1|4840904_4841372_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	96.1	1.3e-72
AXZ44605.1|4841373_4841487_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	91.9	4.3e-11
AXZ44606.1|4841708_4842236_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	3.1e-99
AXZ44607.1|4843265_4843481_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AXZ44608.1|4843556_4843826_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	76.4	1.8e-10
AXZ44609.1|4843863_4844046_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
AXZ44610.1|4844182_4846144_-	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	3.3e-239
AXZ44611.1|4846730_4847159_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AXZ45335.1|4847639_4847972_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.0	3.1e-49
AXZ44612.1|4847968_4848220_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44613.1|4848428_4849511_+	porin	NA	Q1MVN1	Enterobacteria_phage	78.7	1.4e-162
AXZ44614.1|4849698_4850082_-	antitermination protein	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
AXZ44615.1|4850099_4851089_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.9	5.8e-192
AXZ44616.1|4851141_4851399_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	70.1	1.6e-21
AXZ44617.1|4851395_4852796_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.0	1.1e-244
AXZ44618.1|4852792_4853692_-	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	94.8	2.3e-139
AXZ44619.1|4853702_4854695_-	replication protein	NA	Q8W642	Enterobacteria_phage	96.4	4.6e-56
AXZ44620.1|4854691_4854991_-	transcriptional regulator	NA	NA	NA	NA	NA
AXZ44621.1|4854987_4855212_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44622.1|4855208_4855403_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44623.1|4855399_4856248_-	peptidase	NA	A5LH69	Enterobacteria_phage	65.4	3.8e-91
AXZ44624.1|4856356_4857064_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	85.5	2.0e-106
AXZ44625.1|4857060_4857288_-	hypothetical protein	NA	Q8W647	Enterobacteria_phage	91.0	4.9e-30
AXZ44626.1|4857399_4858056_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	97.7	3.1e-125
AXZ44627.1|4858159_4858663_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	95.5	8.9e-64
AXZ44628.1|4858550_4858811_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44629.1|4858950_4859157_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	94.1	1.3e-29
AXZ44630.1|4859351_4859540_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	49.1	3.9e-09
AXZ44631.1|4859545_4860127_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	64.5	5.6e-70
AXZ44632.1|4860137_4860386_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ44633.1|4860375_4860693_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	82.6	5.2e-38
AXZ44634.1|4860646_4860961_+	hypothetical protein	NA	B1GS43	Salmonella_phage	86.0	2.8e-39
AXZ44635.1|4860947_4861634_+	ead/Ea22-like family protein	NA	A5VWB1	Enterobacteria_phage	68.2	1.8e-38
AXZ44636.1|4861630_4862167_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	67.2	1.6e-63
AXZ44637.1|4862168_4862432_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
AXZ44638.1|4862442_4863204_+	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	85.0	2.2e-114
AXZ44639.1|4863288_4863531_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
AXZ44640.1|4863534_4863669_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.5	1.9e-21
AXZ44641.1|4863687_4863942_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
AXZ44642.1|4863975_4865262_+	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	99.8	2.2e-252
AXZ44643.1|4865297_4865984_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.9	8.6e-102
AXZ44644.1|4866043_4866151_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ44645.1|4866131_4866863_-	ABC transporter permease	NA	NA	NA	NA	NA
AXZ44646.1|4866867_4867794_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 15
CP032204	Escherichia coli strain AR_0013 chromosome, complete genome	5410835	5210408	5271862	5410835	portal,protease,lysis,tRNA,tail,terminase,head,capsid	Enterobacteria_phage(47.5%)	70	NA	NA
AXZ44957.1|5210408_5211362_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
AXZ44958.1|5211548_5213033_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXZ45348.1|5213613_5214240_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXZ44959.1|5214184_5214322_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AXZ44960.1|5214433_5214727_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44961.1|5214737_5215442_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	9.2e-59
AXZ44962.1|5215451_5215733_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	3.1e-18
AXZ44963.1|5215729_5218129_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.2	3.9e-133
AXZ44964.1|5218193_5218793_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
AXZ44965.1|5218860_5222340_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
AXZ44966.1|5222400_5223072_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
AXZ44967.1|5222969_5223713_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	9.8e-144
AXZ44968.1|5223717_5224416_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	3.6e-132
AXZ44969.1|5224415_5224745_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	1.8e-57
AXZ44970.1|5224741_5227288_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.2	0.0e+00
AXZ44971.1|5227256_5227715_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.8e-63
AXZ44972.1|5227696_5228119_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AXZ45349.1|5228134_5228875_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.2	2.9e-132
AXZ44973.1|5228882_5229278_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AXZ44974.1|5229274_5229853_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.5e-80
AXZ44975.1|5229864_5230218_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
AXZ44976.1|5230229_5230628_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	1.4e-59
AXZ44977.1|5231667_5232810_+	TIR domain-containing protein	NA	NA	NA	NA	NA
AXZ44978.1|5233408_5233792_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXZ44979.1|5233803_5234145_-|head	head decoration protein	head	NA	NA	NA	NA
AXZ44980.1|5234154_5235195_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	42.4	2.0e-65
AXZ44981.1|5235412_5235862_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AXZ44982.1|5235858_5236104_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44983.1|5238208_5238496_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AXZ44984.1|5238498_5238723_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ44985.1|5238715_5239081_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AXZ44986.1|5239289_5239592_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ44987.1|5239942_5240479_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ44988.1|5240548_5240776_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXZ44989.1|5240777_5242013_-	DUF4102 domain-containing protein	NA	A0A2H4JB45	uncultured_Caudovirales_phage	44.9	1.1e-99
AXZ45350.1|5242145_5242415_-|capsid	capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	100.0	5.3e-39
AXZ44990.1|5242477_5242810_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	4.2e-54
AXZ44991.1|5242819_5244139_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	2.8e-234
AXZ44992.1|5244119_5245721_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.2e-309
AXZ44993.1|5245717_5245924_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AXZ44994.1|5245920_5247846_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
AXZ44995.1|5247820_5248366_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AXZ44996.1|5249033_5249327_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AXZ44997.1|5249358_5249820_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.7	1.2e-75
AXZ44998.1|5249816_5250314_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
AXZ44999.1|5250313_5250529_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
AXZ45000.1|5250717_5251458_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXZ45001.1|5251800_5252760_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AXZ45002.1|5252952_5253477_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
AXZ45003.1|5253632_5254010_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	5.6e-55
AXZ45004.1|5254095_5254236_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AXZ45005.1|5254232_5254595_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
AXZ45006.1|5254591_5254882_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
AXZ45007.1|5254874_5255045_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
AXZ45008.1|5255044_5255500_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
AXZ45009.1|5255496_5255598_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45010.1|5255714_5256512_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXZ45011.1|5256521_5257073_-	kinase inhibitor	NA	NA	NA	NA	NA
AXZ45012.1|5258406_5259930_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AXZ45013.1|5260223_5260595_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45014.1|5261984_5262617_+	fimbriae biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
AXZ45015.1|5262619_5263120_-	fimbriae assembly protein	NA	NA	NA	NA	NA
AXZ45016.1|5263146_5264154_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AXZ45017.1|5264166_5266776_-	outer membrane usher protein	NA	NA	NA	NA	NA
AXZ45018.1|5266806_5267499_-	molecular chaperone FimC	NA	NA	NA	NA	NA
AXZ45019.1|5267717_5268260_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AXZ45020.1|5268731_5269598_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AXZ45021.1|5269599_5269812_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AXZ45022.1|5269919_5270441_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AXZ45023.1|5270476_5271862_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
