The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032265	Escherichia coli strain AR_0089 chromosome, complete genome	4988092	132769	250033	4988092	tRNA,tail,integrase,holin,head,portal,plate,lysis,capsid,terminase,protease	Escherichia_phage(32.79%)	107	172974:172989	250084:250099
AXZ79012.1|132769_134530_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AXZ83478.1|134598_135117_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AXZ79013.1|135186_135354_-	ribosome modulation factor	NA	NA	NA	NA	NA
AXZ79014.1|135609_136173_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AXZ79015.1|136169_137810_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AXZ79016.1|137814_139068_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AXZ79017.1|139197_141105_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
AXZ79018.1|141116_143225_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AXZ79019.1|143322_144432_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AXZ79020.1|144428_144971_-	cell division protein ZapC	NA	NA	NA	NA	NA
AXZ79021.1|145144_146155_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AXZ83479.1|146257_146473_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ79022.1|146391_146967_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AXZ79023.1|146959_147919_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ79024.1|147915_149061_+	alkanesulfonate monooxygenase, FMNH(2)-dependent	NA	NA	NA	NA	NA
AXZ79025.1|149072_149864_+	aliphatic sulfonate ABC transporter permease SsuC	NA	G3M9Y4	Bacillus_virus	24.5	1.4e-15
AXZ79026.1|149860_150628_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
AXZ79027.1|150670_153283_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
AXZ79028.1|153548_154751_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AXZ79029.1|154919_156320_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	6.9e-82
AXZ79030.1|156922_158011_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	2.8e-99
AXZ79031.1|158026_158209_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ79032.1|158195_159386_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AXZ79033.1|159435_160083_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXZ83480.1|160109_160658_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
AXZ79034.1|160838_162686_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AXZ79035.1|162946_167407_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
AXZ79036.1|167406_168111_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
AXZ79037.1|168091_169414_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
AXZ79038.1|169410_170196_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AXZ79039.1|170331_171111_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AXZ79040.1|171087_171981_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ79041.1|172134_172881_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AXZ79042.1|172877_173060_-	protein YcaR	NA	NA	NA	NA	NA
172974:172989	attL	GCAAATAAGCTCTTGT	NA	NA	NA	NA
AXZ79043.1|173111_174344_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXZ79044.1|174380_175367_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AXZ79045.1|175363_177112_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
AXZ79046.1|177148_179413_-	ComEC family protein	NA	NA	NA	NA	NA
AXZ79047.1|179618_179903_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AXZ79048.1|180062_181736_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AXZ79049.1|181846_182530_-	cytidylate kinase	NA	NA	NA	NA	NA
AXZ79050.1|182702_183467_-|protease	metalloprotease	protease	NA	NA	NA	NA
AXZ79051.1|183636_184920_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AXZ79052.1|184990_186079_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
AXZ79053.1|186277_186970_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AXZ79054.1|187099_188860_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AXZ79055.1|189265_190123_+	formate transporter FocA	NA	NA	NA	NA	NA
AXZ79056.1|190177_192460_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AXZ79057.1|192778_193033_-	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	98.8	5.1e-44
AXZ79058.1|193078_194242_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
AXZ79059.1|194241_194721_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
AXZ79060.1|194735_197183_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.5	0.0e+00
AXZ83481.1|197175_197295_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AXZ79061.1|197327_197603_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AXZ79062.1|197659_198178_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
AXZ79063.1|198190_199381_-|tail	phage tail sheath protein	tail	Q858V1	Yersinia_virus	99.5	1.1e-224
AXZ79064.1|199748_200393_+	DNA-binding protein	NA	NA	NA	NA	NA
AXZ79065.1|200431_201142_-	RES domain-containing protein	NA	NA	NA	NA	NA
AXZ79066.1|201836_202415_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	66.0	4.7e-69
AXZ79067.1|202414_205033_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	72.4	2.5e-282
AXZ79068.1|205043_205574_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
AXZ79069.1|205566_206475_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	100.0	3.4e-162
AXZ79070.1|206479_206827_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AXZ79071.1|206823_207459_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	4.5e-113
AXZ79072.1|207525_207978_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
AXZ79073.1|207970_208438_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	6.7e-82
AXZ79074.1|208400_208574_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AXZ79075.1|208545_208971_-|lysis	LysB family phage lysis regulatory protein	lysis	M1SNP0	Escherichia_phage	97.9	1.6e-66
AXZ79076.1|208958_209384_-	protein lysA	NA	M1SV74	Escherichia_phage	90.1	1.8e-57
AXZ79077.1|209398_209896_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AXZ79078.1|209895_210177_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AXZ79079.1|210180_210384_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AXZ79080.1|210383_210893_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AXZ79081.1|210992_211736_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	97.6	1.9e-126
AXZ79082.1|211739_212813_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	99.4	5.7e-201
AXZ79083.1|212871_213726_-|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
AXZ79084.1|213899_215672_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AXZ79085.1|215671_216706_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	2.4e-201
AXZ79086.1|217045_218878_-	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.3	1.5e-89
AXZ79087.1|218994_221277_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.5	0.0e+00
AXZ79088.1|221266_221542_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AXZ79089.1|221538_221763_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
AXZ79090.1|221762_222065_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	98.0	5.5e-45
AXZ79091.1|222064_222289_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AXZ79092.1|222352_222853_-	replication protein B	NA	S4TTB7	Salmonella_phage	98.8	6.5e-91
AXZ79093.1|222849_223047_-	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	98.5	6.1e-29
AXZ83482.1|223030_223387_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
AXZ79094.1|223495_223795_+	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
AXZ79095.1|223888_224884_+|integrase	site-specific integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
AXZ79096.1|224915_225713_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
AXZ79097.1|225809_226958_-	MFS transporter	NA	NA	NA	NA	NA
AXZ79098.1|227271_227898_+	hydrolase	NA	NA	NA	NA	NA
AXZ79099.1|227933_228797_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AXZ79100.1|228798_229416_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AXZ79101.1|229426_231871_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AXZ79102.1|232109_233402_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AXZ79103.1|233492_234836_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AXZ79104.1|234846_235458_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AXZ79105.1|235616_239723_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AXZ79106.1|239857_240352_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AXZ79107.1|240895_241861_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
AXZ79108.1|241983_243750_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AXZ79109.1|243750_245472_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
AXZ79110.1|245513_246218_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXZ79111.1|246502_246721_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXZ79112.1|247405_249682_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AXZ79113.1|249712_250033_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
250084:250099	attR	ACAAGAGCTTATTTGC	NA	NA	NA	NA
>prophage 2
CP032265	Escherichia coli strain AR_0089 chromosome, complete genome	4988092	1007133	1047917	4988092	bacteriocin,tRNA,transposase	unidentified_phage(16.67%)	43	NA	NA
AXZ79812.1|1007133_1008060_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AXZ79813.1|1008098_1009517_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
AXZ79814.1|1009513_1009993_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AXZ79815.1|1010340_1010925_+	fimbrial protein	NA	NA	NA	NA	NA
AXZ79816.1|1011021_1011762_+	fimbrial chaperone	NA	NA	NA	NA	NA
AXZ79817.1|1011796_1014397_+	outer membrane usher protein	NA	NA	NA	NA	NA
AXZ79818.1|1014413_1014986_+	fimbrial protein	NA	NA	NA	NA	NA
AXZ79819.1|1015000_1015603_+	fimbrial-like protein YadL	NA	NA	NA	NA	NA
AXZ79820.1|1015629_1016226_+	fimbrial protein StaF	NA	NA	NA	NA	NA
AXZ79821.1|1016277_1017531_+	fimbrial-like adhesin	NA	NA	NA	NA	NA
AXZ79822.1|1017643_1018438_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
AXZ79823.1|1018449_1019301_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AXZ79824.1|1019382_1019580_-|transposase	transposase	transposase	NA	NA	NA	NA
AXZ79825.1|1019648_1020569_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	4.9e-60
AXZ79826.1|1020689_1020893_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ79827.1|1020842_1021223_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AXZ79828.1|1021226_1022456_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AXZ79829.1|1022519_1022960_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AXZ79830.1|1023064_1023835_-	inner membrane transport permease YadH	NA	NA	NA	NA	NA
AXZ79831.1|1023831_1024758_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
AXZ79832.1|1024866_1025529_+	carbonic anhydrase	NA	NA	NA	NA	NA
AXZ79833.1|1025569_1026106_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AXZ79834.1|1026311_1028702_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AXZ79835.1|1028748_1030299_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	3.5e-18
AXZ79836.1|1030464_1030812_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ79837.1|1030917_1031784_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AXZ79838.1|1031799_1032594_+	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AXZ79839.1|1032631_1032994_-	UPF0231 family protein	NA	NA	NA	NA	NA
AXZ79840.1|1033168_1035766_-	aconitate hydratase B	NA	NA	NA	NA	NA
AXZ79841.1|1035746_1035863_-	aconitate hydratase	NA	NA	NA	NA	NA
AXZ79842.1|1036120_1037884_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AXZ79843.1|1037954_1039379_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
AXZ79844.1|1039586_1041479_-	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AXZ79845.1|1041493_1044157_-	pyruvate dehydrogenase E1 component	NA	NA	NA	NA	NA
AXZ83507.1|1044138_1044321_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ79846.1|1044317_1045082_-	pyruvate dehydrogenase complex repressor	NA	NA	NA	NA	NA
AXZ79847.1|1045537_1045828_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AXZ79848.1|1045828_1046068_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ79849.1|1046235_1046526_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AXZ79850.1|1046579_1046768_-	HNH endonuclease	NA	NA	NA	NA	NA
AXZ79851.1|1046934_1047225_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AXZ79852.1|1047225_1047465_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ79853.1|1047632_1047917_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 3
CP032265	Escherichia coli strain AR_0089 chromosome, complete genome	4988092	1575628	1656758	4988092	tRNA,tail,integrase,transposase,head,holin,portal,lysis,capsid,terminase	Enterobacteria_phage(43.94%)	92	1570902:1570918	1623833:1623849
1570902:1570918	attL	AAAACGGGCAGCCATTG	NA	NA	NA	NA
AXZ80325.1|1575628_1575775_-|integrase	integrase	integrase	NA	NA	NA	NA
AXZ83526.1|1575733_1576015_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ80326.1|1576113_1576650_-	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AXZ80327.1|1576904_1579727_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
AXZ80328.1|1579761_1580118_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AXZ80329.1|1580121_1580538_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
AXZ80330.1|1580648_1581362_-	acid phosphatase AphA	NA	NA	NA	NA	NA
AXZ80331.1|1581638_1583459_+	sensor histidine kinase	NA	NA	NA	NA	NA
AXZ80332.1|1583451_1584810_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXZ80333.1|1584798_1585872_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
AXZ80334.1|1585883_1587383_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
AXZ80335.1|1587594_1588467_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
AXZ80336.1|1588479_1589649_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
AXZ80337.1|1589670_1591029_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	8.6e-37
AXZ80338.1|1591099_1592254_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AXZ80339.1|1592286_1595031_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
AXZ80340.1|1595212_1596406_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
AXZ80341.1|1596487_1597492_-	ATPase	NA	K4F711	Cronobacter_phage	30.2	1.3e-26
AXZ80342.1|1597488_1598046_-	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	28.8	2.2e-15
AXZ80343.1|1598068_1599148_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.6	3.4e-28
AXZ80344.1|1599200_1600616_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	3.7e-200
AXZ80345.1|1600688_1601723_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXZ80346.1|1601978_1603550_+	acyl CoA:acetate/3-ketoacid CoA transferase	NA	NA	NA	NA	NA
AXZ80347.1|1603542_1604322_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
AXZ80348.1|1604348_1605629_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AXZ80349.1|1605639_1607676_+	FAD-binding protein	NA	NA	NA	NA	NA
AXZ80350.1|1607781_1608765_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AXZ80351.1|1608929_1609172_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
AXZ80352.1|1609305_1610343_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AXZ80353.1|1610431_1611529_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
AXZ80354.1|1611590_1611839_+	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
AXZ83527.1|1611956_1612244_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ80355.1|1612286_1613327_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	66.7	2.1e-123
AXZ80356.1|1613336_1613618_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	2.7e-17
AXZ80357.1|1613617_1615996_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	68.6	5.7e-169
AXZ80358.1|1616060_1616663_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.5	1.2e-99
AXZ80359.1|1616730_1620210_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
AXZ80360.1|1620687_1621329_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	2.1e-94
AXZ80361.1|1621226_1621970_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.1e-146
AXZ80362.1|1621975_1622674_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.0	3.4e-130
AXZ80363.1|1622673_1623003_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	1.2e-56
AXZ80364.1|1622999_1625579_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
1623833:1623849	attR	CAATGGCTGCCCGTTTT	NA	NA	NA	NA
AXZ80365.1|1625571_1626006_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AXZ80366.1|1625987_1626410_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	82.9	7.2e-59
AXZ83528.1|1626425_1627166_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.6	1.7e-132
AXZ80367.1|1627173_1627569_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AXZ80368.1|1627565_1628144_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
AXZ80369.1|1628155_1628509_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
AXZ80370.1|1628520_1628919_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	91.7	5.7e-58
AXZ80371.1|1628960_1629986_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.1	3.9e-191
AXZ80372.1|1630041_1630374_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AXZ80373.1|1630383_1631703_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.1e-233
AXZ80374.1|1631683_1633285_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.1e-309
AXZ80375.1|1633281_1633488_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	1.7e-29
AXZ80376.1|1633484_1635410_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
AXZ80377.1|1635384_1635930_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AXZ80378.1|1636945_1637098_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
AXZ80379.1|1637085_1637553_-|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	99.4	1.4e-76
AXZ80380.1|1637549_1638083_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	97.2	3.6e-100
AXZ80381.1|1638219_1638501_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ80382.1|1638971_1639187_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
AXZ80383.1|1640007_1640433_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
AXZ80384.1|1640356_1640584_-	hypothetical protein	NA	A0A291AX11	Escherichia_phage	97.3	3.8e-14
AXZ80385.1|1640713_1641466_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	6.9e-137
AXZ80386.1|1641479_1642469_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
AXZ80387.1|1642476_1643274_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	2.2e-149
AXZ80388.1|1643293_1643683_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	100.0	3.2e-69
AXZ80389.1|1643679_1644006_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
AXZ80390.1|1644002_1644656_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
AXZ80391.1|1644655_1645150_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	1.6e-86
AXZ80392.1|1645146_1645965_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.9	8.9e-122
AXZ80393.1|1645961_1646186_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
AXZ80394.1|1646182_1647331_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	80.2	3.1e-165
AXZ80395.1|1647327_1647879_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	95.1	1.0e-97
AXZ80396.1|1647871_1648132_-	XRE family transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
AXZ80397.1|1648103_1648256_-	amino acid permease	NA	NA	NA	NA	NA
AXZ80398.1|1648229_1648922_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	95.7	1.9e-120
AXZ80399.1|1649001_1649256_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	94.9	1.4e-12
AXZ80400.1|1649357_1649552_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	98.4	2.2e-31
AXZ80401.1|1649624_1649987_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AXZ80402.1|1650052_1650877_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AXZ80403.1|1651004_1651541_+	HD family hydrolase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
AXZ80404.1|1651531_1652410_+	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	93.5	1.5e-167
AXZ80405.1|1652406_1652610_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	98.5	6.1e-32
AXZ80406.1|1652602_1652842_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	100.0	4.4e-37
AXZ80407.1|1652838_1653393_+	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	99.5	4.1e-102
AXZ80408.1|1653394_1653586_+	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	100.0	3.3e-27
AXZ80409.1|1653588_1654347_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	76.2	3.1e-105
AXZ80410.1|1654346_1654919_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	100.0	2.4e-110
AXZ80411.1|1654955_1655237_+	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
AXZ80412.1|1655497_1655740_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ80413.1|1655834_1656758_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
>prophage 4
CP032265	Escherichia coli strain AR_0089 chromosome, complete genome	4988092	2898875	2956512	4988092	transposase	Pseudomonas_phage(13.33%)	58	NA	NA
AXZ81544.1|2898875_2900148_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
AXZ81545.1|2901669_2901927_+	transcriptional regulator	NA	NA	NA	NA	NA
AXZ81546.1|2901971_2902487_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AXZ81547.1|2902572_2903160_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AXZ83588.1|2903331_2905791_+	PapC/FimD family outer membrane usher protein	NA	NA	NA	NA	NA
AXZ81548.1|2905859_2906591_+	molecular chaperone	NA	NA	NA	NA	NA
AXZ81549.1|2906627_2907191_+	nuclease PIN	NA	NA	NA	NA	NA
AXZ81550.1|2907274_2907793_+	fimbrial protein	NA	NA	NA	NA	NA
AXZ81551.1|2907815_2908808_+	nuclease PIN	NA	NA	NA	NA	NA
AXZ81552.1|2908860_2909643_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXZ81553.1|2911259_2912525_-	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
AXZ81554.1|2912988_2913315_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXZ81555.1|2913311_2913575_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AXZ81556.1|2913646_2914513_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AXZ83590.1|2914597_2914795_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AXZ81557.1|2915016_2915394_-	toxin	NA	NA	NA	NA	NA
AXZ81558.1|2915483_2915852_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AXZ81559.1|2915901_2916546_-	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.6e-25
AXZ81560.1|2916560_2916782_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	6.5e-11
AXZ83589.1|2916850_2917297_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AXZ81561.1|2917342_2917828_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	1.2e-12
AXZ81562.1|2917918_2918737_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	4.7e-46
AXZ81563.1|2918826_2919060_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AXZ81564.1|2919065_2919743_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ81565.1|2919861_2920746_-	GTPase	NA	NA	NA	NA	NA
AXZ81566.1|2920851_2921796_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ81567.1|2921792_2922602_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ81568.1|2924300_2925032_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AXZ83591.1|2925820_2926033_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ81569.1|2926056_2926290_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AXZ81570.1|2926567_2927116_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ81571.1|2927451_2927643_-	osmoprotectant transport activator ProQ	NA	NA	NA	NA	NA
AXZ81572.1|2929525_2929723_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ81573.1|2930979_2931795_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
AXZ81574.1|2931881_2932184_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AXZ81575.1|2932077_2932329_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ81576.1|2932949_2933228_-	pilus assembly protein	NA	NA	NA	NA	NA
AXZ81577.1|2933264_2933456_+	papI protein	NA	NA	NA	NA	NA
AXZ81578.1|2933481_2933664_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ81579.1|2933650_2933965_+	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
AXZ81580.1|2934150_2934495_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AXZ81581.1|2934554_2935763_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	2.3e-235
AXZ81582.1|2936128_2937334_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
AXZ81583.1|2937777_2938098_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AXZ81584.1|2938090_2938477_+	amino acid-binding protein	NA	NA	NA	NA	NA
AXZ81585.1|2938484_2939171_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ81586.1|2939148_2939775_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ81587.1|2939853_2941059_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
AXZ81588.1|2941171_2941840_-	putative tetracyline resistance transcriptional regulator TetC	NA	NA	NA	NA	NA
AXZ81589.1|2942278_2943487_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	2.3e-235
AXZ81590.1|2943556_2944686_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.1	8.7e-51
AXZ81591.1|2944716_2945340_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
AXZ81592.1|2945465_2948351_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
AXZ81593.1|2948508_2949324_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	99.6	7.9e-163
AXZ81594.1|2949541_2950378_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AXZ81595.1|2950377_2951181_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
AXZ81596.1|2952377_2954909_+	PapC/FimD family outer membrane usher protein	NA	NA	NA	NA	NA
AXZ81597.1|2954940_2956512_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
>prophage 5
CP032265	Escherichia coli strain AR_0089 chromosome, complete genome	4988092	2972173	2980181	4988092		Escherichia_phage(50.0%)	15	NA	NA
AXZ81612.1|2972173_2973562_+	replicative DNA helicase	NA	O80281	Escherichia_phage	50.1	5.8e-113
AXZ81613.1|2973551_2975201_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AXZ81614.1|2975193_2975925_+	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	36.6	1.4e-17
AXZ81615.1|2975921_2976500_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
AXZ81616.1|2976496_2976745_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ81617.1|2976924_2977137_+	enterohemolysin 2	NA	A0A2D1GLY5	Escherichia_phage	82.2	1.7e-13
AXZ81618.1|2977133_2977355_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ81619.1|2977341_2977941_+	ead/Ea22-like family protein	NA	A0A2D1GLY5	Escherichia_phage	64.8	1.4e-55
AXZ83594.1|2978170_2978458_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	98.9	2.1e-54
AXZ81620.1|2978454_2978853_+	hypothetical protein	NA	A0A1U9AJ59	Stx1_converting_phage	62.6	1.4e-32
AXZ81621.1|2978854_2979076_+	hypothetical protein	NA	K7P6F8	Enterobacteria_phage	74.6	4.5e-20
AXZ81622.1|2979077_2979275_+	hypothetical protein	NA	A0A1I9SEY0	Klebsiella_phage	86.2	1.3e-31
AXZ81623.1|2979285_2979699_+	hypothetical protein	NA	A0A076G611	Escherichia_phage	77.8	1.5e-29
AXZ81624.1|2979747_2979963_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ81625.1|2979959_2980181_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	54.1	5.3e-13
>prophage 6
CP032265	Escherichia coli strain AR_0089 chromosome, complete genome	4988092	3315592	3322732	4988092		Escherichia_phage(83.33%)	6	NA	NA
AXZ81929.1|3315592_3316231_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
AXZ81930.1|3316227_3317490_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
AXZ81931.1|3317486_3318395_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
AXZ81932.1|3318590_3319358_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
AXZ81933.1|3319408_3320065_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
AXZ81934.1|3320170_3322732_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 7
CP032265	Escherichia coli strain AR_0089 chromosome, complete genome	4988092	3898975	3908420	4988092		Enterobacteria_phage(85.71%)	10	NA	NA
AXZ82447.1|3898975_3899902_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
AXZ82448.1|3899906_3900638_+	ABC transporter permease	NA	NA	NA	NA	NA
AXZ82449.1|3900618_3900726_-	protein YohO	NA	NA	NA	NA	NA
AXZ82450.1|3900785_3901517_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
AXZ82451.1|3901738_3903424_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AXZ82452.1|3903420_3904140_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXZ82453.1|3904186_3904657_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AXZ82454.1|3904697_3905159_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AXZ82455.1|3905283_3907287_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AXZ82456.1|3907283_3908420_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.4	6.7e-160
>prophage 8
CP032265	Escherichia coli strain AR_0089 chromosome, complete genome	4988092	4002394	4008697	4988092		Enterobacteria_phage(50.0%)	7	NA	NA
AXZ82527.1|4002394_4003789_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
AXZ82528.1|4003963_4004857_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
AXZ82529.1|4004893_4005157_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ83633.1|4005228_4006314_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	6.7e-101
AXZ82530.1|4006313_4007213_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
AXZ82531.1|4007271_4008150_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.7e-107
AXZ82532.1|4008154_4008697_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 9
CP032265	Escherichia coli strain AR_0089 chromosome, complete genome	4988092	4131535	4178629	4988092	tail,integrase,transposase,holin,head,portal,lysis,capsid,terminase,protease	Escherichia_phage(43.9%)	57	4120055:4120069	4141266:4141280
4120055:4120069	attL	GCAGACGATGCAGGG	NA	NA	NA	NA
AXZ82631.1|4131535_4132798_-	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
AXZ83646.1|4133135_4133933_-	protein MtfA	NA	NA	NA	NA	NA
AXZ82632.1|4134168_4135194_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
AXZ82633.1|4135193_4135397_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AXZ82634.1|4135455_4137927_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
AXZ82635.1|4138019_4138211_-	DUF1482 family protein	NA	NA	NA	NA	NA
AXZ82636.1|4138207_4138396_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AXZ82637.1|4138963_4139182_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ82638.1|4139211_4139340_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ83647.1|4139341_4139497_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	4.0e-07
AXZ82639.1|4139762_4140182_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
AXZ82640.1|4140282_4140564_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
AXZ82641.1|4140547_4140973_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AXZ82642.1|4141044_4142115_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	61.6	2.2e-59
4141266:4141280	attR	GCAGACGATGCAGGG	NA	NA	NA	NA
AXZ82643.1|4142152_4142569_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	69.8	3.1e-46
AXZ82644.1|4142803_4145602_+	ATP-binding protein	NA	NA	NA	NA	NA
AXZ82645.1|4145822_4146035_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
AXZ83648.1|4146274_4146571_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ82646.1|4146867_4147146_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	2.2e-11
AXZ82647.1|4147147_4148206_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	2.6e-89
AXZ82648.1|4148206_4148572_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	3.2e-39
AXZ82649.1|4148568_4149258_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	2.1e-60
AXZ82650.1|4149288_4149411_+	antiterminator	NA	NA	NA	NA	NA
AXZ82651.1|4150071_4150287_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
AXZ82652.1|4150706_4151240_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
AXZ82653.1|4151236_4151704_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	89.0	1.4e-66
AXZ82654.1|4151882_4152368_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXZ82655.1|4152612_4152813_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ82656.1|4152820_4153171_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	1.8e-63
AXZ82657.1|4153318_4153801_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	96.2	4.8e-83
AXZ82658.1|4153800_4155558_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
AXZ82659.1|4155569_4155752_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
AXZ82660.1|4155751_4156993_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	7.6e-242
AXZ82661.1|4156934_4157621_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	1.1e-125
AXZ82662.1|4157635_4158841_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	98.5	1.5e-221
AXZ82663.1|4158892_4159081_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
AXZ82664.1|4159092_4159398_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
AXZ82665.1|4159406_4159745_+|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
AXZ82666.1|4159741_4160191_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	79.9	1.1e-62
AXZ82667.1|4160187_4160532_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
AXZ82668.1|4160591_4161296_+|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	95.7	3.3e-117
AXZ82669.1|4161295_4161682_+|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
AXZ83649.1|4161723_4161984_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	98.8	7.1e-41
AXZ82670.1|4162029_4165257_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.1	0.0e+00
AXZ82671.1|4165234_4165591_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
AXZ82672.1|4165590_4166289_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.4	1.8e-131
AXZ82673.1|4166294_4167038_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.9e-149
AXZ82674.1|4166935_4167583_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	7.8e-113
AXZ82675.1|4167643_4171057_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.7	0.0e+00
AXZ82676.1|4171117_4173490_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.5	1.1e-167
AXZ82677.1|4173489_4173771_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
AXZ82678.1|4173780_4174821_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	66.1	1.7e-122
AXZ83650.1|4174863_4175157_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ82679.1|4175265_4175445_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ82680.1|4176005_4176335_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ82681.1|4176370_4177021_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
AXZ82682.1|4177281_4178629_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
>prophage 10
CP032265	Escherichia coli strain AR_0089 chromosome, complete genome	4988092	4209413	4306001	4988092	tRNA,tail,integrase,transposase,holin,head,portal,plate,capsid,terminase	Pectobacterium_phage(22.22%)	116	4227997:4228056	4270608:4270732
AXZ83653.1|4209413_4209938_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
AXZ82720.1|4209960_4210290_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	85.6	4.0e-41
AXZ82721.1|4210171_4210669_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	65.2	7.7e-52
AXZ82722.1|4210777_4211011_-	SirA-like protein	NA	NA	NA	NA	NA
AXZ82723.1|4211007_4212213_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
AXZ82724.1|4212399_4212813_+	lipoprotein	NA	NA	NA	NA	NA
AXZ82725.1|4212846_4214334_-	alpha-amylase	NA	NA	NA	NA	NA
AXZ82726.1|4214411_4214777_-	flagellar protein FliT	NA	NA	NA	NA	NA
AXZ82727.1|4214776_4215187_-	flagella export chaperone FliS	NA	NA	NA	NA	NA
AXZ82728.1|4215202_4216618_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
AXZ82729.1|4216865_4217915_+	flagellin FliC	NA	NA	NA	NA	NA
AXZ82730.1|4218078_4218798_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
AXZ82731.1|4218843_4219395_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
AXZ82732.1|4219482_4220283_+	cystine-binding periplasmic protein	NA	NA	NA	NA	NA
AXZ82733.1|4220387_4221374_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
AXZ82734.1|4221388_4222057_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXZ82735.1|4222053_4222806_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
AXZ82736.1|4223035_4223758_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
AXZ82737.1|4223825_4224050_-	DUF2594 family protein	NA	NA	NA	NA	NA
AXZ82738.1|4224508_4225165_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXZ82739.1|4225161_4226994_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AXZ82740.1|4227050_4227599_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
4227997:4228056	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
AXZ82741.1|4228182_4229199_-|integrase	integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
AXZ82742.1|4229167_4229431_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
AXZ82743.1|4229366_4229591_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	56.3	7.3e-10
AXZ82744.1|4229640_4229823_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ82745.1|4229822_4230392_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
AXZ82746.1|4230388_4232605_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
AXZ82747.1|4232635_4232956_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ82748.1|4233966_4234380_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
AXZ82749.1|4234478_4234709_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
AXZ82750.1|4234767_4235244_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
AXZ82751.1|4235283_4235508_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
AXZ82752.1|4235504_4236260_+	replication protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
AXZ82753.1|4236249_4237665_+	helicase DnaB	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
AXZ82754.1|4237703_4238114_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ82755.1|4238115_4238352_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ82756.1|4238348_4238660_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
AXZ82757.1|4238656_4238881_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ82758.1|4239068_4239290_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ83654.1|4239562_4240351_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
AXZ82759.1|4240525_4241449_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ82760.1|4242637_4243336_+	lysogenic protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
AXZ82761.1|4243798_4244404_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ82762.1|4244413_4244902_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
AXZ82763.1|4245300_4245534_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ82764.1|4245777_4246419_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ82765.1|4246570_4246750_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ82766.1|4246827_4247424_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
AXZ82767.1|4247420_4247714_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
AXZ82768.1|4247713_4248385_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
AXZ82769.1|4248497_4248881_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ82770.1|4248880_4249153_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
AXZ82771.1|4249152_4249632_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
AXZ82772.1|4249639_4249834_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ83655.1|4249893_4250139_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ82773.1|4250507_4251074_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
AXZ82774.1|4251060_4252923_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
AXZ82775.1|4252922_4253156_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ82776.1|4253152_4254727_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
AXZ82777.1|4254726_4256034_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
AXZ82778.1|4256033_4256363_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
AXZ82779.1|4256421_4257456_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.2	1.2e-104
AXZ82780.1|4257490_4257910_+	DNA-packaging protein	NA	NA	NA	NA	NA
AXZ82781.1|4257906_4258287_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ82782.1|4258318_4258999_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ82783.1|4258995_4259532_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ82784.1|4259512_4260415_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
AXZ82785.1|4260417_4260759_+|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
AXZ82786.1|4260755_4261676_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
AXZ82787.1|4261678_4262305_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
AXZ82788.1|4262297_4263482_+	hypothetical protein	NA	J9QDX3	Clostridium_phage	35.2	2.5e-16
AXZ82789.1|4263481_4263871_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
AXZ82790.1|4263867_4265370_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
AXZ82791.1|4265387_4265900_+|tail	phage tail protein	tail	NA	NA	NA	NA
AXZ82792.1|4265912_4266194_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AXZ82793.1|4266302_4267943_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
AXZ83656.1|4267978_4268368_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
AXZ82794.1|4268529_4268754_+|tail	phage tail protein	tail	NA	NA	NA	NA
AXZ82795.1|4268757_4269801_+	late control protein	NA	R9TNM7	Vibrio_phage	28.5	2.0e-33
AXZ82796.1|4269967_4270387_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
AXZ82797.1|4270858_4271524_+	YecA family protein	NA	NA	NA	NA	NA
4270608:4270732	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
AXZ82798.1|4271574_4272786_-	tyrosine transporter	NA	NA	NA	NA	NA
AXZ82799.1|4272976_4273216_+	DUF2492 family protein	NA	NA	NA	NA	NA
AXZ82800.1|4273253_4273751_-	non-heme ferritin	NA	NA	NA	NA	NA
AXZ82801.1|4273922_4274246_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ82802.1|4274509_4274596_+	stress response protein AzuC	NA	NA	NA	NA	NA
AXZ82803.1|4274710_4274962_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AXZ82804.1|4275039_4275543_-	non-heme ferritin	NA	NA	NA	NA	NA
AXZ82805.1|4276014_4276254_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ82806.1|4276339_4277329_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ82807.1|4277398_4278913_+	arabinose import ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
AXZ82808.1|4278927_4279914_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
AXZ82809.1|4280080_4280881_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AXZ82810.1|4280855_4282280_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AXZ82811.1|4282286_4282715_-	universal stress protein UspC	NA	NA	NA	NA	NA
AXZ82812.1|4283494_4283845_+	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
AXZ82813.1|4283847_4284426_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
AXZ82814.1|4284552_4285440_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AXZ82815.1|4285436_4286363_+	motility protein MotB	NA	NA	NA	NA	NA
AXZ82816.1|4286367_4288332_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
AXZ82817.1|4288352_4288856_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXZ82818.1|4289000_4290662_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AXZ82819.1|4290952_4291813_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AXZ82820.1|4291815_4292865_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AXZ82821.1|4292879_4293269_+	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AXZ82822.1|4293279_4293924_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
AXZ82823.1|4294112_4295261_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
AXZ82824.1|4295253_4297332_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AXZ82825.1|4297331_4297724_+	flagellar protein FlhE	NA	NA	NA	NA	NA
AXZ82826.1|4297776_4299510_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
AXZ83657.1|4299725_4300292_+	VOC family protein	NA	NA	NA	NA	NA
AXZ82827.1|4300305_4301052_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AXZ82828.1|4301439_4302540_+	cytochrome C	NA	NA	NA	NA	NA
AXZ82829.1|4302564_4304994_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AXZ82830.1|4305029_4306001_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
>prophage 1
CP032263	Escherichia coli strain AR_0089 plasmid unnamed1, complete sequence	155784	0	4090	155784		Yersinia_phage(100.0%)	8	NA	NA
AXZ78587.1|350_785_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AXZ78588.1|781_1501_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AXZ78589.1|1780_1939_+	protein hok	NA	NA	NA	NA	NA
AXZ78590.1|2158_2389_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78737.1|2439_2628_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78591.1|2629_2836_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AXZ78592.1|2860_3148_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78593.1|3157_4090_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.8e-44
>prophage 2
CP032263	Escherichia coli strain AR_0089 plasmid unnamed1, complete sequence	155784	12190	12412	155784		Vibrio_virus(100.0%)	1	NA	NA
AXZ78605.1|12190_12412_+	protein TraR	NA	A2I309	Vibrio_virus	40.8	3.3e-07
>prophage 3
CP032263	Escherichia coli strain AR_0089 plasmid unnamed1, complete sequence	155784	21557	147897	155784	transposase,bacteriocin,protease,integrase	Enterobacteria_phage(15.15%)	119	94392:94451	146612:147771
AXZ78615.1|21557_23099_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AXZ78616.1|23113_23860_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
AXZ78617.1|24062_24347_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
AXZ78618.1|24333_24879_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
AXZ78619.1|24775_25150_+	conjugal transfer protein TrbJ	NA	NA	NA	NA	NA
AXZ78620.1|25136_25325_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
AXZ78621.1|25515_26889_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
AXZ78622.1|26885_29711_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AXZ78623.1|29707_30217_+	conjugal transfer protein TraS	NA	NA	NA	NA	NA
AXZ78624.1|30230_30962_+	complement resistance protein TraT	NA	NA	NA	NA	NA
AXZ78625.1|31214_33290_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
AXZ78626.1|33298_33697_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AXZ78627.1|33696_33927_-	antitoxin	NA	NA	NA	NA	NA
AXZ78628.1|34005_39276_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
AXZ78629.1|39295_40042_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	8.7e-07
AXZ78630.1|40100_40961_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
AXZ78631.1|41063_41624_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
AXZ78632.1|41759_41972_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ78633.1|42387_42597_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ78741.1|42652_42802_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AXZ78634.1|43085_43343_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
AXZ78743.1|43364_43496_-	replication protein RepA	NA	NA	NA	NA	NA
AXZ78742.1|43574_43649_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
AXZ78635.1|43629_44124_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78636.1|44116_44974_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AXZ78637.1|45542_45731_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ78638.1|45936_46188_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AXZ78639.1|46184_46472_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	5.8e-20
AXZ78640.1|46740_47954_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	2.7e-167
AXZ78641.1|48222_52356_+|protease	hemoglobin-binding protease autotransporter Hbp	protease	Q9LA54	Enterobacteria_phage	41.6	5.6e-297
AXZ78642.1|53189_54212_-	DNA helicase UvrD	NA	NA	NA	NA	NA
AXZ78643.1|54196_55762_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AXZ78644.1|55836_56253_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AXZ78645.1|56249_56480_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXZ78646.1|56841_57294_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXZ78647.1|57325_58720_-	monooxygenase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	4.7e-06
AXZ78648.1|58734_60306_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AXZ78649.1|60325_60673_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AXZ78650.1|60672_61350_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AXZ78651.1|61349_61565_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXZ78652.1|61561_61831_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ78653.1|61832_62849_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AXZ78654.1|62851_63679_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AXZ78655.1|63662_64901_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	27.8	2.8e-26
AXZ78656.1|65440_66574_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78657.1|66593_66878_+	korC	NA	NA	NA	NA	NA
AXZ78658.1|66874_67072_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ78744.1|67304_67505_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ78745.1|67663_68044_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AXZ78659.1|68040_68388_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AXZ78660.1|70001_71232_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
AXZ78661.1|71497_74995_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	35.3	2.8e-100
AXZ78662.1|74931_75180_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ78663.1|76300_76534_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	92.3	6.6e-06
AXZ78664.1|76427_77660_-	MFS transporter	NA	NA	NA	NA	NA
AXZ78665.1|77671_78433_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	8.8e-15
AXZ78666.1|78432_79470_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AXZ78667.1|79469_80468_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ78668.1|81053_82058_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AXZ78669.1|82149_82740_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	4.3e-25
AXZ78670.1|83240_83525_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AXZ78671.1|83524_83800_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXZ78672.1|83905_84145_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78746.1|84307_85479_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXZ78673.1|85836_87975_+	AAA family ATPase	NA	NA	NA	NA	NA
AXZ78674.1|88136_88553_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AXZ78675.1|88549_88780_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXZ78676.1|88757_88895_-	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
AXZ78677.1|89341_89692_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78678.1|89735_90425_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78679.1|90421_91213_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	9.4e-52
AXZ78747.1|91390_91744_+	colicin M immunity protein	NA	NA	NA	NA	NA
AXZ78680.1|91793_92609_-|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
AXZ78681.1|92852_93380_+	colicin B immunity protein	NA	NA	NA	NA	NA
AXZ78682.1|93737_94019_+	hypothetical protein	NA	NA	NA	NA	NA
94392:94451	attL	CCCATAAGCGCTAACTTAAGGGTTGAACCATCTGAAGAATGCGACGCCTCGGTGCCTCGT	NA	NA	NA	NA
AXZ78683.1|94564_96136_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXZ78748.1|96110_97352_-	colicin V secretion protein CvaA	NA	NA	NA	NA	NA
AXZ78684.1|97581_98810_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.3	3.0e-174
AXZ78685.1|99331_99601_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78686.1|99597_99879_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXZ78687.1|99924_100773_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	38.5	3.8e-27
AXZ78688.1|100889_101372_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78689.1|101522_101729_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ78690.1|101673_102021_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78691.1|102370_102562_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78692.1|103535_103736_+	phospho-2-dehydro-3-deoxyheptonate aldolase	NA	NA	NA	NA	NA
AXZ78693.1|103944_104172_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ78694.1|104469_106647_+	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
AXZ78695.1|106691_107648_-	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
AXZ78696.1|107732_108962_-	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
AXZ78697.1|109065_112851_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
AXZ78698.1|112864_113980_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
AXZ78749.1|114178_114442_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ78699.1|116431_116614_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78700.1|117129_117423_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AXZ78701.1|117796_118039_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ78702.1|118004_119277_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	1.1e-174
AXZ78703.1|119862_120087_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78704.1|120501_121695_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AXZ78705.1|123757_123946_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78706.1|123955_124897_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78707.1|125693_127064_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
AXZ78708.1|127067_129008_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
AXZ78709.1|129004_130192_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
AXZ78710.1|131645_132859_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	2.7e-167
AXZ78711.1|133037_133220_+|transposase	transposase	transposase	NA	NA	NA	NA
AXZ78712.1|133369_133633_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78713.1|133999_134389_-|protease	outer membrane protease	protease	NA	NA	NA	NA
AXZ78714.1|134492_135446_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
AXZ78715.1|135535_135820_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ78716.1|135878_136988_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
AXZ78717.1|137050_137959_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
AXZ78718.1|138332_138521_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AXZ78719.1|138641_139382_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
AXZ78720.1|139666_140644_-	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
AXZ78721.1|141052_141349_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ78722.1|143648_144815_+	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
AXZ78723.1|144814_145786_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
AXZ78724.1|146784_147897_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
146612:147771	attR	CCCATAAGCGCTAACTTAAGGGTTGAACCATCTGAAGAATGCGACGCCTCGGTGCCTCGTTAAGACGATGCCTCGCGTTCTTCAATTGCGTTTTGTAGGCTGTCAGGGATACTGTCCCACGAATGGCCACCTGTAAGCTCCAGATGACCATTTTTGTTATTCTCCACAACGAGTTAGTTCTTCTTTTCGGATCCGGCACTTCTGGGGGGGAAATCCAGCGATGGCTGGATTATGTCGTCAATTAAAAATGCGGCGAGTAGATTAGCAAATATCCACGCTTTCGCGAGTTCAGGTTCCTTTGCACGCAAAGCATCCAGGTGCAGCAAACTTTTGAGCCGCTTAAAAGCCAGTTCAATTTGCCATCGCAGACGGTAACAATCAGCCACTTGCTCTGCTGAATATTCATCTTCCGGTAATGATGTTAGCAATAGCACATGGCCCGCTGCTTCCAGCGTTTCCGCCTGAACTACTCGTCCTTTTCGACGATTCTCGCTGAGCAGTCGGGTTTTACTGATTAATGCTTTTTCGGGAGGAAGTGATACGGCAATGAGACGTGCCGGAAAGGGAGCTCCGGCTTTTTTATTACCTGAATTGCCTATCATTACAGTGGTTTCACCGTTCTTACCGCAATCCAGCCCGCGCAGAAAACCCATCATGTCAAAGCGCATTCCTTCTGCAGTTAACCAGCGCAATCCTCGCCAGTGAACCCGGACGATATAATCAGCTTCTCCAAAAGCAAGTGAGCGGATACATTCGGGACGCGAACCGAATCCCCGGTCAGCAATGCGTATCTCGTCTGCCGTTTGCGCAAATCGGTCCAGCCGTTCAGCGTCTCTGCTGTCGGTTAGCTCAAAATCAGTGAACTGACAGGTATGAGGATCATATCCCATATGTAGTCGCCATTCAGCGCTGCCGCCCCCGGGCGCACTGATTGCTGTTCCATCGACAAGACGCAATCTCTTTCCGCTTGTACAACCCGTAACTGCGGCGCGTACAGCAAGTGTTTGTGCGGCAAGTATGCCAAACCAGTCGGCGGCATTCCGCAGCCGCTTCAGGAGAGCCACGTCAGATAATGTTGCAACGTCATGGAGCTGAGCCCATGCAGTGACTTCACGTAATGACATCCCCCCGGGGCCGTAAGCCAGCCCCAGACGTAGCAG	NA	NA	NA	NA
>prophage 4
CP032263	Escherichia coli strain AR_0089 plasmid unnamed1, complete sequence	155784	151792	154063	155784		Thalassomonas_phage(33.33%)	7	NA	NA
AXZ78732.1|151792_152356_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	3.9e-20
AXZ78733.1|152507_152774_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78751.1|152677_152902_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ78750.1|152824_153019_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78734.1|152945_153182_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ78735.1|153246_153774_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	54.3	6.7e-46
AXZ78736.1|153829_154063_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	3.9e-06
>prophage 1
CP032264	Escherichia coli strain AR_0089 plasmid unnamed2, complete sequence	101614	74958	82276	101614	transposase	Stx2-converting_phage(50.0%)	10	NA	NA
AXZ78832.1|74958_75636_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AXZ78833.1|75635_75983_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AXZ78834.1|76002_77574_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AXZ78835.1|77663_78566_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	5.8e-66
AXZ78836.1|78630_78897_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ78837.1|78990_79425_-	post-segregation killing protein PndC	NA	NA	NA	NA	NA
AXZ78838.1|79447_79693_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ78839.1|79714_80014_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ78840.1|80153_80654_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	2.4e-05
AXZ78841.1|81100_82276_-|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	81.6	7.1e-173
