The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032308	Enterococcus faecium strain HY07 chromosome, complete genome	2585631	316220	368425	2585631	integrase,transposase	Bacillus_phage(16.67%)	47	315947:316006	336919:337106
315947:316006	attL	CGTCAAAAGAAACGCGACTTCCGTAAATTGTGGATTGCTCGTATCAACGCAGCAGCTCGT	NA	NA	NA	NA
AYA33471.1|316220_317387_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	36.3	3.1e-59
AYA33472.1|317576_318062_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33473.1|318051_318678_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33474.1|318695_319616_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33475.1|319845_320421_+|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	39.4	8.4e-26
AYA33476.1|320437_321352_-	hypothetical protein	NA	NA	NA	NA	NA
AYA33477.1|321921_323112_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
AYA33478.1|323452_324022_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.0	2.8e-21
AYA33479.1|324339_325758_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33480.1|325750_325987_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33481.1|326452_326722_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33482.1|326702_328559_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33483.1|329537_329705_-	peptidase	NA	NA	NA	NA	NA
AYA33484.1|330353_330533_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33485.1|330771_330999_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33486.1|331118_332312_+	DNA methyltransferase	NA	A0A1B0XVT8	Campylobacter_phage	32.9	3.0e-25
AYA33487.1|332308_333478_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYA33488.1|333743_335357_+	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
AYA33489.1|335335_336454_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33490.1|336455_336740_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33491.1|337366_339187_+	hypothetical protein	NA	NA	NA	NA	NA
336919:337106	attR	CGTCAAAAGAAACGCGACTTCCGTAAATTGTGGATTGCTCGTATCAACGCAGCAGCTCGTATGAATGGCTTGAGCTACTCAAAATTAATGCACGGTTTGAAAGTTGCTGAAATCGACATCAACCGTAAAATGTTAGCTGACTTGGCTGTTAACGATGCAGCAGCATTTACTGCATTGGCTGACCAAGC	NA	NA	NA	NA
AYA33492.1|339336_340763_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.6	2.3e-48
AYA33493.1|341031_342369_+	citrate transporter	NA	NA	NA	NA	NA
AYA33494.1|342416_344546_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
AYA33495.1|344520_345210_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33496.1|345603_346290_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYA33497.1|346668_347109_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AYA33498.1|347112_347958_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AYA33499.1|348106_349525_+	dipeptidase PepV	NA	NA	NA	NA	NA
AYA33500.1|349580_350528_-	glycosyltransferase	NA	NA	NA	NA	NA
AYA33501.1|350749_351100_-	peptidase	NA	NA	NA	NA	NA
AYA33502.1|351299_352379_+	glutamyl aminopeptidase	NA	NA	NA	NA	NA
AYA33503.1|352521_352842_+	thioredoxin	NA	NA	NA	NA	NA
AYA33504.1|352863_353328_+	universal stress protein	NA	NA	NA	NA	NA
AYA33505.1|353523_354129_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
AYA33506.1|354167_355457_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	5.7e-22
AYA33507.1|355884_356364_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AYA33508.1|356413_357262_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	33.3	5.8e-15
AYA35482.1|357532_357916_-	hypothetical protein	NA	NA	NA	NA	NA
AYA33509.1|358142_359315_+|transposase	IS256 family transposase IS1542	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
AYA33510.1|360257_361217_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
AYA33511.1|361820_362192_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33512.1|362184_363600_+	peptidase	NA	A0A1B2AQ05	Phage_Wrath	24.3	3.3e-23
AYA33513.1|364030_364270_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33514.1|364285_365659_+	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	21.7	1.8e-13
AYA33515.1|365662_367300_+	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	28.1	4.8e-42
AYA33516.1|367516_368425_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP032308	Enterococcus faecium strain HY07 chromosome, complete genome	2585631	643394	703887	2585631	transposase,lysis,tRNA,protease	Streptococcus_phage(18.75%)	59	NA	NA
AYA33758.1|643394_644057_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
AYA35492.1|644284_644848_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AYA33759.1|644860_645145_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33760.1|645163_645856_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AYA33761.1|645867_646413_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	37.4	4.4e-24
AYA33762.1|646678_649948_+	DUF1565 domain-containing protein	NA	NA	NA	NA	NA
AYA33763.1|650367_652275_-	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.8	8.8e-80
AYA33764.1|652406_653282_+	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
AYA33765.1|653361_654336_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.2	3.5e-40
AYA35493.1|654768_655905_+	cysteine desulfurase	NA	NA	NA	NA	NA
AYA33766.1|656041_656386_+	cysteine desulfurase	NA	NA	NA	NA	NA
AYA33767.1|656494_657277_-	hypothetical protein	NA	NA	NA	NA	NA
AYA33768.1|658874_659462_+	metallophosphatase	NA	A0A288TXW7	Enterococcus_phage	42.0	1.3e-34
AYA35494.1|659731_660157_-	hypothetical protein	NA	NA	NA	NA	NA
AYA33769.1|660848_661808_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
AYA33770.1|663148_663400_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33771.1|663673_663931_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33772.1|663985_664246_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33773.1|664588_664855_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33774.1|664895_665513_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33775.1|665601_666207_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33776.1|666413_667535_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AYA33777.1|667778_669200_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
AYA33778.1|669213_670332_+	aminotransferase	NA	NA	NA	NA	NA
AYA33779.1|670391_671684_-	MFS transporter	NA	NA	NA	NA	NA
AYA35495.1|671833_672394_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYA33780.1|672522_672900_+	DUF1033 family protein	NA	NA	NA	NA	NA
AYA33781.1|672832_674905_+	DNA topoisomerase III	NA	NA	NA	NA	NA
AYA33782.1|675240_676188_-	glycosyltransferase	NA	V5USA4	Oenococcus_phage	51.3	5.0e-84
AYA33783.1|676433_676898_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.8	4.0e-18
AYA33784.1|676960_678004_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AYA35496.1|678104_678308_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33785.1|678377_679346_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AYA33786.1|679576_680419_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYA33787.1|680430_680628_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33788.1|680612_681800_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
AYA33789.1|681805_682162_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	43.2	9.1e-23
AYA33790.1|682163_682502_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
AYA35497.1|682896_683931_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.1	4.2e-28
AYA33791.1|683923_684610_+	ABC transporter permease	NA	NA	NA	NA	NA
AYA33792.1|684633_685482_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYA33793.1|685678_686452_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	28.8	2.1e-08
AYA33794.1|686464_687751_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AYA33795.1|687747_688983_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.5	1.1e-112
AYA33796.1|688969_689440_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
AYA33797.1|689444_690836_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AYA33798.1|690944_692000_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYA33799.1|692055_692415_+	RidA family protein	NA	NA	NA	NA	NA
AYA35498.1|692460_693609_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AYA33800.1|693615_694362_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33801.1|694390_695569_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
AYA33802.1|695726_696362_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33803.1|696431_696671_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33804.1|696718_697403_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
AYA33805.1|697630_698242_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	41.3	4.0e-18
AYA33806.1|698275_700300_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33807.1|700312_700993_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.5	2.3e-107
AYA33808.1|701300_701537_+	XRE family transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	52.1	7.4e-13
AYA33809.1|701772_703887_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.3	5.3e-118
>prophage 3
CP032308	Enterococcus faecium strain HY07 chromosome, complete genome	2585631	1309926	1363066	2585631	transposase	unidentified_phage(27.27%)	53	NA	NA
AYA34342.1|1309926_1310886_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
AYA34343.1|1311200_1311482_+	hypothetical protein	NA	NA	NA	NA	NA
AYA34344.1|1311662_1311965_-	hypothetical protein	NA	NA	NA	NA	NA
AYA34345.1|1313071_1313269_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	78.5	2.3e-23
AYA34346.1|1313556_1313910_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYA34347.1|1314521_1315445_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AYA34348.1|1315525_1315918_-	VOC family protein	NA	NA	NA	NA	NA
AYA34349.1|1316027_1316819_-	hypothetical protein	NA	NA	NA	NA	NA
AYA35515.1|1317562_1317865_-	hypothetical protein	NA	NA	NA	NA	NA
AYA34350.1|1318046_1318460_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	30.8	2.1e-07
AYA34351.1|1318651_1319272_+	hypothetical protein	NA	NA	NA	NA	NA
AYA34352.1|1319369_1319855_-	hypothetical protein	NA	NA	NA	NA	NA
AYA34353.1|1319992_1320208_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
AYA34354.1|1321892_1322807_-	rotamase	NA	NA	NA	NA	NA
AYA34355.1|1324025_1324973_+	peptidase	NA	NA	NA	NA	NA
AYA34356.1|1324939_1325551_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
AYA34357.1|1325706_1326213_+	cysteine hydrolase	NA	NA	NA	NA	NA
AYA34358.1|1328298_1329300_+	alpha/beta hydrolase	NA	A0A2P1EM31	Moumouvirus	32.5	3.9e-10
AYA34359.1|1329543_1329750_-	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
AYA34360.1|1330171_1331131_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
AYA34361.1|1331971_1332463_+	flavodoxin family protein	NA	NA	NA	NA	NA
AYA34362.1|1332705_1332906_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
AYA34363.1|1333472_1334018_+	hypothetical protein	NA	NA	NA	NA	NA
AYA34364.1|1334240_1334606_-	hypothetical protein	NA	NA	NA	NA	NA
AYA34365.1|1334683_1334929_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYA34366.1|1334998_1335253_-	hypothetical protein	NA	NA	NA	NA	NA
AYA34367.1|1336247_1336751_-	cysteine hydrolase	NA	NA	NA	NA	NA
AYA34368.1|1336790_1337600_-	HAD family phosphatase	NA	NA	NA	NA	NA
AYA34369.1|1337933_1338791_+	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
AYA34370.1|1338783_1339686_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
AYA34371.1|1339718_1340069_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
AYA34372.1|1340102_1341041_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
AYA34373.1|1341120_1342014_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.7	2.0e-58
AYA34374.1|1342051_1342615_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
AYA34375.1|1342626_1342815_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
AYA34376.1|1342827_1343727_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AYA34377.1|1343758_1344001_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AYA34378.1|1344288_1344660_-	hypothetical protein	NA	NA	NA	NA	NA
AYA34379.1|1345269_1349733_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AYA34380.1|1349901_1351365_+	hypothetical protein	NA	NA	NA	NA	NA
AYA34381.1|1351486_1351720_-	transcriptional regulator	NA	NA	NA	NA	NA
AYA34382.1|1351728_1352202_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
AYA34383.1|1352526_1353699_+|transposase	IS256 family transposase IS1542	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
AYA34384.1|1353822_1354782_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
AYA34385.1|1357222_1358473_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.0	2.7e-109
AYA34386.1|1358879_1359461_+	copper ABC transporter permease	NA	NA	NA	NA	NA
AYA34387.1|1359457_1359613_+	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
AYA34388.1|1359564_1359765_-	hypothetical protein	NA	NA	NA	NA	NA
AYA34389.1|1360280_1360847_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
AYA34390.1|1360859_1361048_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
AYA34391.1|1361060_1361618_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AYA34392.1|1361649_1361892_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AYA34393.1|1362106_1363066_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	7.5e-11
>prophage 4
CP032308	Enterococcus faecium strain HY07 chromosome, complete genome	2585631	1636002	1645041	2585631		Synechococcus_phage(16.67%)	9	NA	NA
AYA34634.1|1636002_1636581_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.9	1.3e-26
AYA35525.1|1636577_1637621_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.9	2.9e-61
AYA34635.1|1637652_1639092_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
AYA34636.1|1639076_1641299_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.4	1.0e-151
AYA34637.1|1641299_1641971_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYA34638.1|1641972_1642227_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AYA34639.1|1642226_1642955_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	40.9	1.1e-41
AYA34640.1|1643210_1643588_+	hypothetical protein	NA	NA	NA	NA	NA
AYA34641.1|1643745_1645041_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	1.0e-18
>prophage 5
CP032308	Enterococcus faecium strain HY07 chromosome, complete genome	2585631	2015084	2023799	2585631		Streptococcus_phage(66.67%)	10	NA	NA
AYA34980.1|2015084_2017274_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.7	6.8e-286
AYA35534.1|2017477_2017657_-	hypothetical protein	NA	NA	NA	NA	NA
AYA34981.1|2017831_2018434_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.0	4.9e-53
AYA34982.1|2018487_2019609_-	DNA polymerase IV	NA	NA	NA	NA	NA
AYA34983.1|2019717_2020590_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.1	2.1e-89
AYA34984.1|2020658_2021006_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
AYA34985.1|2020998_2021823_-	signal peptidase	NA	NA	NA	NA	NA
AYA34986.1|2021858_2022797_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.8	6.1e-34
AYA34987.1|2022810_2023140_-	hypothetical protein	NA	NA	NA	NA	NA
AYA34988.1|2023154_2023799_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	2.4e-58
>prophage 1
CP032307	Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence	258852	15753	58679	258852	protease,holin,transposase	Streptococcus_phage(25.0%)	49	NA	NA
AYA32959.1|15753_16713_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	5.0e-31
AYA32960.1|16893_17589_+	hypothetical protein	NA	NA	NA	NA	NA
AYA32961.1|17625_18123_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYA32962.1|18178_19087_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AYA32963.1|19246_19558_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32964.1|19547_19730_-	enterocin	NA	NA	NA	NA	NA
AYA32965.1|20071_20305_-	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
AYA32966.1|20314_20581_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32967.1|20562_20958_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32968.1|21218_21419_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32969.1|21638_22076_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32970.1|22091_22343_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32971.1|22342_22549_-	DNA helicase UvrA	NA	NA	NA	NA	NA
AYA32972.1|22997_23258_-	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	1.2e-11
AYA32973.1|23412_23535_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AYA32974.1|23693_23951_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32975.1|23972_24458_-	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	60.5	7.5e-44
AYA32976.1|24460_25360_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AYA32977.1|25372_25969_-	transcriptional regulator	NA	NA	NA	NA	NA
AYA32978.1|26214_28419_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	51.3	9.4e-118
AYA32979.1|28429_29899_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32980.1|29959_32332_-	hypothetical protein	NA	B5SP25	Lactococcus_phage	32.5	2.3e-13
AYA32981.1|32344_32539_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32982.1|32678_33014_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32983.1|33025_34618_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32984.1|34636_35059_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32985.1|35060_35357_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32986.1|35871_36102_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32987.1|36124_36931_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32988.1|36941_37586_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32989.1|37601_38807_-	peptidase M23	NA	Q6SEC2	Lactobacillus_prophage	42.4	5.6e-32
AYA32990.1|38806_40831_-	ATPase	NA	NA	NA	NA	NA
AYA32991.1|40993_41587_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32992.1|41587_41920_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32993.1|41971_44362_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32994.1|44358_46968_-	type IV secretory protein	NA	NA	NA	NA	NA
AYA32995.1|46967_49022_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32996.1|49091_49394_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32997.1|49411_49654_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32998.1|49650_50109_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32999.1|50296_50506_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33000.1|50625_52677_+|protease	serine protease	protease	NA	NA	NA	NA
AYA33001.1|52712_54824_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
AYA33002.1|54854_55103_-	hypothetical protein	NA	NA	NA	NA	NA
AYA33003.1|55112_55940_-	hypothetical protein	NA	NA	NA	NA	NA
AYA33004.1|55936_56692_-	class C sortase	NA	NA	NA	NA	NA
AYA33005.1|56704_57082_-	peptidase	NA	NA	NA	NA	NA
AYA33006.1|57135_58254_-|transposase	transposase	transposase	A0A286QMQ9	Streptococcus_phage	50.8	1.5e-95
AYA33007.1|58277_58679_-|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	62.4	6.9e-43
>prophage 2
CP032307	Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence	258852	70273	128241	258852	integrase,transposase	Streptococcus_phage(22.22%)	53	75629:75651	132825:132847
AYA33019.1|70273_71182_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AYA33020.1|71268_72123_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYA33021.1|72219_74469_+	alpha-galactosidase	NA	NA	NA	NA	NA
AYA33022.1|74471_75647_+	MFS transporter	NA	NA	NA	NA	NA
75629:75651	attL	AACCCGTGGTGCTAGTTAATTTT	NA	NA	NA	NA
AYA33023.1|75649_76558_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
AYA33024.1|76791_77055_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AYA33025.1|77054_77327_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AYA33026.1|77403_77733_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AYA33027.1|77722_78010_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYA33028.1|78295_79153_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
AYA33029.1|79153_79702_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33030.1|80331_81012_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.2	9.4e-109
AYA33031.1|81776_82784_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AYA33032.1|83250_84657_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	30.2	3.4e-44
AYA33033.1|84679_85003_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AYA33034.1|85013_86696_+	PTS lactose transporter subunit IIBC	NA	NA	NA	NA	NA
AYA33035.1|88320_89073_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.9e-17
AYA33036.1|89665_91123_-	PTS glucitol transporter subunit IIA	NA	NA	NA	NA	NA
AYA33037.1|91144_91447_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
AYA33038.1|91503_91983_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AYA33039.1|92147_92921_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.1	1.3e-18
AYA33040.1|92940_93369_+	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
AYA33041.1|93387_93903_+	galactose-6-phosphate isomerase subunit LacB	NA	A0A222YX14	Synechococcus_phage	29.0	9.5e-05
AYA33042.1|93915_94842_+	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
AYA33043.1|94854_95841_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
AYA33044.1|96296_96965_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.4	8.8e-27
AYA33045.1|96955_98089_+	ATP-binding protein	NA	NA	NA	NA	NA
AYA33046.1|99216_99459_-	hypothetical protein	NA	NA	NA	NA	NA
AYA33047.1|99451_100237_-	SinI family restriction endonuclease	NA	NA	NA	NA	NA
AYA33048.1|100360_101956_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	51.1	2.3e-126
AYA33049.1|101945_102806_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AYA33050.1|103976_105132_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.8e-75
AYA33051.1|106612_107035_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYA33052.1|107460_108291_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AYA33053.1|108290_109040_-	ABC transporter permease	NA	NA	NA	NA	NA
AYA33054.1|109032_109950_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.2	4.6e-42
AYA33055.1|110132_110747_-	XRE family transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	46.8	5.5e-07
AYA33056.1|110736_110934_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYA33057.1|111099_111459_+	XRE family transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	40.4	4.4e-17
AYA33058.1|111876_112143_+	hypothetical protein	NA	A0A2H4PQP5	Staphylococcus_phage	36.0	6.2e-08
AYA33059.1|112171_113149_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
AYA33060.1|113329_114163_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
AYA33061.1|114168_114759_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	33.1	8.3e-21
AYA33062.1|115339_116479_+	MFS transporter	NA	NA	NA	NA	NA
AYA33181.1|116930_117323_+	recombinase family protein	NA	NA	NA	NA	NA
AYA33063.1|117322_118624_+	DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	99.0	1.9e-105
AYA33064.1|118747_120538_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AYA33065.1|120891_122244_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.2	8.0e-43
AYA33066.1|122260_123229_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
AYA33067.1|123253_124285_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
AYA33068.1|124302_125508_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
AYA33069.1|125794_126859_+	2,3-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.7	7.2e-15
AYA33070.1|127554_128241_-|transposase	IS6-like element ISEnfa1 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	88.5	4.8e-113
132825:132847	attR	AAAATTAACTAGCACCACGGGTT	NA	NA	NA	NA
>prophage 3
CP032307	Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence	258852	131826	195717	258852	bacteriocin,integrase,transposase	Streptococcus_phage(35.71%)	56	132430:132489	182465:182881
AYA33073.1|131826_132735_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
132430:132489	attL	CTTGATAGTGTAAGCTAAGTTTGAACTTAAGCGAGTGAATCGACTCCTACTAGGAAAGTC	NA	NA	NA	NA
AYA33074.1|132861_133101_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33075.1|133102_134401_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33076.1|136356_137547_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	24.6	1.7e-28
AYA33077.1|138081_138654_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	42.6	3.9e-23
AYA33078.1|138798_139503_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AYA33079.1|139730_140069_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33080.1|141055_141289_+	copper chaperone	NA	NA	NA	NA	NA
AYA33081.1|141486_143391_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.8	2.4e-101
AYA33082.1|143739_144912_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.4	2.2e-121
AYA33083.1|145188_145542_+	transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	40.7	4.4e-17
AYA33084.1|145566_146184_+	cadmium resistance protein CadD	NA	NA	NA	NA	NA
AYA33085.1|147386_147809_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AYA33086.1|147842_148340_+	PTS mannose/fructose/sorbose transporter subunit IIB	NA	NA	NA	NA	NA
AYA33087.1|148360_149179_+	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
AYA33088.1|149175_150006_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
AYA33089.1|150182_152708_+	AAA family ATPase	NA	NA	NA	NA	NA
AYA33090.1|153121_153808_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	2.2e-126
AYA33091.1|154383_155409_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AYA33092.1|155702_156812_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYA33093.1|157806_158631_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AYA33094.1|158662_159991_+	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
AYA33095.1|160284_161544_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AYA33096.1|161553_162426_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AYA33097.1|162437_163268_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AYA33098.1|163307_165491_+	alpha-galactosidase	NA	NA	NA	NA	NA
AYA33099.1|165551_165707_+	oligo-1,6-glucosidase	NA	NA	NA	NA	NA
AYA33100.1|165802_166771_+	oligo-1,6-glucosidase	NA	NA	NA	NA	NA
AYA33101.1|166767_168228_+	sucrose phosphorylase	NA	NA	NA	NA	NA
AYA33102.1|169732_169942_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
AYA33103.1|169934_170084_+|integrase	integrase	integrase	NA	NA	NA	NA
AYA33104.1|170118_170247_+|integrase	integrase	integrase	NA	NA	NA	NA
AYA33105.1|170237_170903_+|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	31.1	5.2e-19
AYA33106.1|171186_172272_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
AYA33107.1|172605_172839_+	addiction module antitoxin	NA	NA	NA	NA	NA
AYA33108.1|172835_173243_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	38.9	4.0e-14
AYA33109.1|173681_174860_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	1.8e-30
AYA33110.1|175041_175551_-	hypothetical protein	NA	NA	NA	NA	NA
AYA33183.1|175691_176042_-	hypothetical protein	NA	NA	NA	NA	NA
AYA33111.1|176034_177360_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	44.5	7.0e-100
AYA33184.1|177697_177988_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33185.1|178243_178555_-	hypothetical protein	NA	NA	NA	NA	NA
AYA33112.1|180344_180542_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33186.1|180634_180799_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AYA33113.1|180803_181070_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYA33114.1|181707_182396_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.2	2.7e-124
AYA33115.1|182884_183229_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
182465:182881	attR	CTTGATAGTGTAAGCTAAGTTTGAACTTAAGCGAGTGAATCGACTCCTACTAGGAAAGTCACCATTAGGAAATAAGACGGAACAAACCGCTCTATACGTGGCTCTTTGGCTAGTATAGCCATTAATTATGCCCCATATAACACAAGCAATAATCACTGTATCGCGTTGCTTCAGTTGATCAGTATTTCTTCGGTTTTTAATCTTATCTGGTACACAATTGTGGTATATGTTAGAAACAGTTCTCATAATTTCCTTGAATGTTATAAAAGTATCTGTATAATGTTCAGTATATTTTGATGAACGCATATGTAGTCCTCATTTCTTGGGAGTTTTGAGACTACTATATGCGTTTTTTTGTTGATTTACCAACATGTTTAGACATTTTCCTCTAGGAAAAAATTAACTAGCACCACGGGT	NA	NA	NA	NA
AYA33116.1|183222_183486_-	PbsX family transcriptional regulator	NA	NA	NA	NA	NA
AYA33117.1|184633_184876_-	hypothetical protein	NA	NA	NA	NA	NA
AYA33118.1|186836_187790_-	ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	27.5	3.5e-29
AYA33119.1|187799_189956_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	58.2	1.5e-240
AYA33120.1|190105_190573_-	ribonucleotide reductase assembly protein NrdI	NA	NA	NA	NA	NA
AYA33121.1|190741_191413_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AYA33122.1|191510_192680_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AYA33123.1|192841_193930_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33124.1|194070_195717_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	49.7	8.0e-146
>prophage 4
CP032307	Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence	258852	207696	217450	258852	transposase	Leptospira_phage(33.33%)	9	NA	NA
AYA33132.1|207696_208989_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.1	3.9e-55
AYA33188.1|209082_209181_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33189.1|209177_209615_-	hypothetical protein	NA	NA	NA	NA	NA
AYA33133.1|211038_211233_+	hypothetical protein	NA	NA	NA	NA	NA
AYA33134.1|211222_211576_+	IS66 family insertion sequence hypothetical protein	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
AYA33135.1|211677_213225_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
AYA33136.1|213867_214827_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.0	6.1e-37
AYA33137.1|215046_216009_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.5	6.8e-20
AYA33138.1|216010_217450_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.8e-16
