The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032316	Campylobacter jejuni subsp. jejuni strain HPC5 chromosome, complete genome	1795167	470002	507680	1795167	bacteriocin,integrase,tRNA,tail,capsid,plate	Campylobacter_phage(55.17%)	56	462948:462963	486855:486870
462948:462963	attL	TGATTGATGATGCTAT	NA	NA	NA	NA
AYA31624.1|470002_472078_+|integrase	integrase	integrase	NA	NA	NA	NA
AYA31625.1|472148_473072_+|bacteriocin	bacteriocin	bacteriocin	A0A2H4JAW1	uncultured_Caudovirales_phage	24.5	6.7e-09
AYA31626.1|473074_473266_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AYA31627.1|473262_473448_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31628.1|473504_473846_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31629.1|473951_474437_+	host-nuclease inhibitor protein Gam	NA	A0A2K9VGT9	Faecalibacterium_phage	34.0	3.2e-18
AYA31630.1|474433_474613_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31631.1|474676_474949_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31632.1|474945_475332_+	hypothetical protein	NA	D5GVQ0	Campylobacter_virus	56.4	2.7e-36
AYA31633.1|475440_476403_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31634.1|476399_476669_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31635.1|476668_477361_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31636.1|477357_477807_+	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
AYA31637.1|477853_478129_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31638.1|478120_478792_-	deoxyribonuclease	NA	NA	NA	NA	NA
AYA31639.1|478885_479170_+	DNA-binding protein	NA	NA	NA	NA	NA
AYA31640.1|479300_479552_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31641.1|479544_480051_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31642.1|480028_481006_-|tail	phage tail protein	tail	A0A219Y9Y2	Aeromonas_phage	25.2	4.8e-13
AYA31643.1|480999_481191_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYA31644.1|481183_481558_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYA31645.1|481683_482922_-	hypothetical protein	NA	M4M9M5	Vibrio_phage	29.8	1.9e-19
AYA31646.1|482923_484294_-	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	26.6	4.5e-17
AYA31647.1|484303_485974_-	hypothetical protein	NA	H1ZZE1	Pseudomonas_virus	41.2	1.5e-91
AYA31648.1|485973_486573_-	DUF1804 family protein	NA	NA	NA	NA	NA
AYA31649.1|486565_487024_-	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
486855:486870	attR	ATAGCATCATCAATCA	NA	NA	NA	NA
AYA31650.1|487138_488116_-|capsid	minor capsid protein E	capsid	R9TRN2	Rhizobium_phage	23.7	5.1e-07
AYA31651.1|488118_488646_-	hypothetical protein	NA	NA	NA	NA	NA
AYA31652.1|488648_489464_-	hypothetical protein	NA	A0A2H4JAW3	uncultured_Caudovirales_phage	48.4	2.9e-24
AYA31653.1|489465_489900_-	hypothetical protein	NA	NA	NA	NA	NA
AYA31654.1|490048_490438_+	DUF882 domain-containing protein	NA	A0A1X9Q0V8	Human_gokushovirus	45.1	5.5e-21
AYA31655.1|490448_490790_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31656.1|490786_491035_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31657.1|491146_491461_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31658.1|491460_492093_+|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	35.6	4.6e-09
AYA31659.1|492101_492293_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31660.1|492289_492580_+|plate	baseplate assembly protein	plate	Q8H9N4	Vibrio_phage	40.8	2.7e-09
AYA31661.1|492576_493743_+|plate	baseplate assembly protein	plate	Q8H9N3	Vibrio_phage	24.9	1.4e-14
AYA31662.1|493739_494360_+|tail	phage tail protein I	tail	A7YGM6	Campylobacter_phage	97.4	2.8e-59
AYA31663.1|494359_495439_+|tail	phage tail protein	tail	A7YGV0	Campylobacter_phage	99.6	5.1e-149
AYA31664.1|495448_495955_+	DUF4376 domain-containing protein	NA	A7YGY7	Campylobacter_phage	100.0	5.7e-87
AYA31665.1|495951_496323_+	DUF1353 domain-containing protein	NA	A7YGF6	Campylobacter_phage	100.0	5.7e-68
AYA31666.1|496422_497436_+	hypothetical protein	NA	A7YGY4	Campylobacter_phage	100.0	5.9e-192
AYA31667.1|497446_498640_+|tail	phage tail sheath family protein	tail	A7YGY2	Campylobacter_phage	99.7	2.2e-201
AYA31668.1|498666_499176_+|tail	phage tail protein	tail	A7YG76	Campylobacter_phage	98.8	9.5e-90
AYA31669.1|499280_499520_+|tail	phage tail assembly protein	tail	A7YGZ3	Campylobacter_phage	93.8	1.6e-23
AYA31670.1|499631_499937_-	hypothetical protein	NA	A7YG98	Campylobacter_phage	100.0	4.7e-36
AYA31671.1|499978_502201_+|tail	phage tail tape measure protein	tail	A7YG97	Campylobacter_phage	99.1	0.0e+00
AYA31672.1|502204_502693_+	virion morphogenesis protein	NA	A7YG96	Campylobacter_phage	99.4	1.7e-88
AYA32928.1|502797_503613_+	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	99.3	1.2e-150
AYA31673.1|503643_503931_-	hypothetical protein	NA	A7YGG4	Campylobacter_phage	96.8	4.7e-46
AYA31674.1|504010_504205_-	hypothetical protein	NA	A7YG72	Campylobacter_phage	92.2	1.1e-25
AYA31675.1|504214_504535_-	hypothetical protein	NA	A7YGI4	Campylobacter_phage	100.0	1.3e-52
AYA31676.1|504615_505245_-	phage repressor protein	NA	A7YGK7	Campylobacter_phage	100.0	2.6e-60
AYA31677.1|505363_506383_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31678.1|506810_507680_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 2
CP032316	Campylobacter jejuni subsp. jejuni strain HPC5 chromosome, complete genome	1795167	537492	610101	1795167	bacteriocin,tRNA,integrase,head,protease,tail,plate	Campylobacter_phage(36.11%)	91	602294:602316	614055:614077
AYA31711.1|537492_538746_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.5	4.5e-117
AYA31712.1|538757_539798_+	rod shape-determining protein	NA	NA	NA	NA	NA
AYA31713.1|539787_540537_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AYA31714.1|540798_544068_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
AYA31715.1|544064_544487_+	Sua5 YciO YrdC YwlC family protein	NA	NA	NA	NA	NA
AYA31716.1|544487_545465_-	transaldolase	NA	NA	NA	NA	NA
AYA31717.1|545464_546088_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
AYA31718.1|546087_546609_-	purine-binding chemotaxis protein CheW	NA	Q56AR1	Bacillus_thuringiensis_phage	24.8	1.9e-05
AYA31719.1|546613_548923_-	hybrid sensor histidine kinase/response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	26.0	1.3e-13
AYA31720.1|548926_549883_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	30.9	1.0e-39
AYA32929.1|549875_550493_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AYA31721.1|550643_551129_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
AYA31722.1|551140_552235_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AYA31723.1|552331_553084_-	AcfC family glycoprotein adhesin PEB3	NA	NA	NA	NA	NA
AYA31724.1|553225_553339_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
AYA31725.1|554770_555547_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	33.7	1.0e-34
AYA31726.1|555536_556190_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	S4VW33	Pandoravirus	29.9	9.2e-13
AYA31727.1|556264_556645_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AYA31728.1|556641_557490_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AYA31729.1|557500_558325_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	40.2	3.7e-51
AYA31730.1|558478_559369_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.0	2.9e-25
AYA31731.1|559365_560040_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AYA31732.1|560032_560434_-	molybdenum-pterin-binding protein	NA	NA	NA	NA	NA
AYA31733.1|560430_561180_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYA31734.1|561230_561917_-	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
AYA31735.1|561913_562525_-	DUF452 family protein	NA	NA	NA	NA	NA
AYA31736.1|562521_563664_-	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	27.1	7.5e-26
AYA31737.1|563731_565015_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
AYA31738.1|565001_565607_-	dethiobiotin synthase	NA	NA	NA	NA	NA
AYA31739.1|565616_565931_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AYA31740.1|565933_566272_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AYA31741.1|566403_566940_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
AYA31742.1|566936_567482_+|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AYA31743.1|567483_568542_+	LptF/LptG family permease	NA	NA	NA	NA	NA
AYA31744.1|568585_569794_+	diaminopimelate decarboxylase	NA	A0A060D2X4	Bovine_gammaherpesvirus	27.7	1.1e-22
AYA31745.1|569795_570563_+	HAD-IIA family hydrolase	NA	NA	NA	NA	NA
AYA31746.1|570550_571624_+	prephenate dehydratase	NA	NA	NA	NA	NA
AYA31747.1|571613_572708_+	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.4	5.7e-15
AYA31748.1|572759_574442_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
AYA31749.1|574441_575470_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AYA31750.1|575477_576308_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AYA31751.1|576300_578148_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AYA31752.1|578233_578644_+	transcriptional repressor	NA	NA	NA	NA	NA
AYA31753.1|579222_579852_+	phage repressor protein	NA	A7YG70	Campylobacter_phage	99.1	1.3e-59
AYA31754.1|579932_580253_+	hypothetical protein	NA	A7YGI4	Campylobacter_phage	99.1	1.7e-52
AYA31755.1|580262_580457_+	hypothetical protein	NA	A7YG72	Campylobacter_phage	100.0	1.8e-28
AYA31756.1|580536_580824_+	hypothetical protein	NA	A7YGG4	Campylobacter_phage	100.0	1.9e-47
AYA31757.1|580851_581667_-	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	99.6	1.5e-150
AYA31758.1|581768_582737_-|tail	phage tail protein	tail	A0A219Y9Y2	Aeromonas_phage	26.8	4.3e-14
AYA31759.1|582730_582922_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYA31760.1|582914_583289_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYA31761.1|583290_585255_-|tail	phage tail tape measure protein	tail	A7YG97	Campylobacter_phage	29.6	4.2e-08
AYA31762.1|585284_585515_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31763.1|585622_585859_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AYA31764.1|585869_586385_-|tail	phage tail protein	tail	A0A0F7LDZ1	Escherichia_phage	25.7	5.8e-10
AYA31765.1|586531_587722_-|tail	phage tail sheath family protein	tail	A7YGY2	Campylobacter_phage	99.5	1.4e-200
AYA31766.1|587732_588746_-	hypothetical protein	NA	A7YGY4	Campylobacter_phage	100.0	5.9e-192
AYA31767.1|588845_589217_-	DUF1353 domain-containing protein	NA	A7YGF6	Campylobacter_phage	100.0	5.7e-68
AYA31768.1|589213_589720_-	DUF4376 domain-containing protein	NA	A7YGY7	Campylobacter_phage	100.0	5.7e-87
AYA31769.1|589729_590809_-|tail	phage tail protein	tail	A7YGV0	Campylobacter_phage	99.6	5.1e-149
AYA31770.1|590808_591429_-|tail	phage tail protein I	tail	A7YGM6	Campylobacter_phage	97.4	2.8e-59
AYA31771.1|591425_592592_-|plate	baseplate assembly protein	plate	Q8H9N3	Vibrio_phage	24.9	1.4e-14
AYA31772.1|592588_592879_-|plate	baseplate assembly protein	plate	Q8H9N4	Vibrio_phage	40.8	2.7e-09
AYA31773.1|592875_593067_-	hypothetical protein	NA	NA	NA	NA	NA
AYA31774.1|593075_593708_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	35.6	4.6e-09
AYA31775.1|593704_594169_-	DUF1804 family protein	NA	NA	NA	NA	NA
AYA31776.1|594299_595340_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31777.1|595339_596227_+|head	head protein	head	A0A2K9VH18	Faecalibacterium_phage	43.7	3.5e-63
AYA31778.1|596226_596496_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31779.1|596492_596846_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31780.1|596842_597208_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31781.1|597197_597587_+	DUF882 domain-containing protein	NA	A0A1X9Q0V8	Human_gokushovirus	45.9	1.9e-21
AYA31782.1|597597_597939_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31783.1|597935_598184_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31784.1|598295_598610_+	hypothetical protein	NA	NA	NA	NA	NA
AYA31785.1|598699_600226_+	hypothetical protein	NA	A0A0M3LQB7	Mannheimia_phage	31.1	6.4e-49
AYA31786.1|600222_601605_+	DUF935 family protein	NA	A0A0M3LRU4	Mannheimia_phage	22.7	8.2e-11
AYA31787.1|601597_602731_+	hypothetical protein	NA	A0A1C6ZDL9	Pseudomonas_phage	34.2	5.1e-27
602294:602316	attL	AAAATACAAAATTATGAAAATTT	NA	NA	NA	NA
AYA31788.1|602869_603349_-	hypothetical protein	NA	NA	NA	NA	NA
AYA31789.1|603335_603527_-	hypothetical protein	NA	NA	NA	NA	NA
AYA31790.1|603578_604007_-	hypothetical protein	NA	NA	NA	NA	NA
AYA31791.1|604003_604183_-	hypothetical protein	NA	NA	NA	NA	NA
AYA31792.1|604293_604749_-	hypothetical protein	NA	A0A2R3ZY25	Campylobacter_phage	37.8	1.5e-14
AYA31793.1|604745_605018_-	hypothetical protein	NA	NA	NA	NA	NA
AYA31794.1|605089_605575_-	host-nuclease inhibitor protein Gam	NA	A0A2K9VGT9	Faecalibacterium_phage	32.7	1.2e-17
AYA31795.1|605561_605774_-	hypothetical protein	NA	NA	NA	NA	NA
AYA31796.1|605770_606109_-	hypothetical protein	NA	NA	NA	NA	NA
AYA31797.1|606182_606614_-	hypothetical protein	NA	NA	NA	NA	NA
AYA31798.1|606852_607044_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AYA31799.1|607040_607898_-|bacteriocin	bacteriocin	bacteriocin	A0A0M3LP72	Mannheimia_phage	31.2	9.6e-26
AYA31800.1|607986_610101_-|integrase	integrase	integrase	NA	NA	NA	NA
614055:614077	attR	AAAATACAAAATTATGAAAATTT	NA	NA	NA	NA
>prophage 3
CP032316	Campylobacter jejuni subsp. jejuni strain HPC5 chromosome, complete genome	1795167	777740	785721	1795167		Nitratiruptor_phage(33.33%)	11	NA	NA
AYA31969.1|777740_779816_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.9	6.7e-65
AYA31970.1|780346_780517_-	DNA-binding protein	NA	NA	NA	NA	NA
AYA31971.1|780509_781052_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AYA32930.1|781053_781722_-	hypothetical protein	NA	M5AAE8	Nitratiruptor_phage	51.9	2.5e-13
AYA32931.1|781887_782115_-	XRE family transcriptional regulator	NA	M5A9C2	Nitratiruptor_phage	43.2	8.1e-09
AYA31972.1|782366_783398_-	(p)ppGpp synthetase	NA	A0A1B0VBT5	Salmonella_phage	29.0	3.6e-27
AYA31973.1|783435_783672_-	hypothetical protein	NA	NA	NA	NA	NA
AYA31974.1|783681_783975_-	hypothetical protein	NA	NA	NA	NA	NA
AYA31975.1|783985_784825_-	hypothetical protein	NA	NA	NA	NA	NA
AYA31976.1|785011_785254_-	hypothetical protein	NA	A0A1B0XVK7	Campylobacter_phage	93.8	1.5e-37
AYA31977.1|785250_785721_-	hypothetical protein	NA	A0A2R3ZY25	Campylobacter_phage	62.7	6.2e-43
>prophage 4
CP032316	Campylobacter jejuni subsp. jejuni strain HPC5 chromosome, complete genome	1795167	807604	816063	1795167		Campylobacter_phage(88.89%)	10	NA	NA
AYA32006.1|807604_808639_+	hypothetical protein	NA	A0A2I7SBK1	Pseudomonas_phage	30.9	1.2e-17
AYA32007.1|808638_809043_+	hypothetical protein	NA	NA	NA	NA	NA
AYA32008.1|809219_811862_+	hypothetical protein	NA	X2KLU0	Campylobacter_phage	65.6	5.4e-43
AYA32009.1|811863_812313_+	hypothetical protein	NA	X2KXK7	Campylobacter_phage	98.7	6.7e-79
AYA32010.1|812958_813342_+	hypothetical protein	NA	X2KXD5	Campylobacter_phage	100.0	2.4e-61
AYA32011.1|813334_813709_+	DUF1353 domain-containing protein	NA	X2KPN9	Campylobacter_phage	96.0	9.2e-66
AYA32012.1|813705_814986_+	hypothetical protein	NA	X2KRN1	Campylobacter_phage	92.6	2.2e-212
AYA32013.1|815034_815511_+	hypothetical protein	NA	X2KRD2	Campylobacter_phage	69.4	7.6e-57
AYA32014.1|815507_815948_+	hypothetical protein	NA	X2KX19	Campylobacter_phage	86.8	1.1e-46
AYA32015.1|815865_816063_+	hypothetical protein	NA	X2KPN2	Campylobacter_phage	96.9	3.7e-26
>prophage 5
CP032316	Campylobacter jejuni subsp. jejuni strain HPC5 chromosome, complete genome	1795167	1726398	1736642	1795167		Tupanvirus(25.0%)	11	NA	NA
AYA32841.1|1726398_1727739_+	long-chain fatty acid--CoA ligase	NA	A0A2K9L3I8	Tupanvirus	25.6	3.8e-05
AYA32842.1|1727762_1729544_-	alpha-2,3-sialyltransferase	NA	NA	NA	NA	NA
AYA32843.1|1729636_1730302_-	D-glycero-D-manno-heptose 1-phosphate guanosyltransferase	NA	A0A2K9L821	Tupanvirus	27.2	2.4e-08
AYA32844.1|1730289_1730895_-	SIS domain-containing protein	NA	A0A067XQR2	Caulobacter_phage	34.4	1.8e-15
AYA32845.1|1730882_1731902_-	dehydrogenase	NA	A0A222YW25	Synechococcus_phage	41.0	7.8e-59
AYA32846.1|1731898_1732930_-	SDR family oxidoreductase	NA	A0A222YY99	Synechococcus_phage	72.7	1.6e-144
AYA32847.1|1732938_1733979_-	NAD-dependent epimerase/dehydratase family protein	NA	M1HKX0	Paramecium_bursaria_Chlorella_virus	40.8	4.8e-64
AYA32848.1|1734059_1735160_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	43.2	3.3e-79
AYA32849.1|1735163_1735790_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32850.1|1735776_1736094_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32851.1|1736096_1736642_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D7XFA9	Escherichia_phage	30.2	1.1e-14
>prophage 6
CP032316	Campylobacter jejuni subsp. jejuni strain HPC5 chromosome, complete genome	1795167	1753777	1789571	1795167	head,tRNA,tail,plate	Campylobacter_phage(72.73%)	47	NA	NA
AYA32866.1|1753777_1754743_-|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AYA32867.1|1754732_1756052_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AYA32868.1|1756125_1757223_+	peptide chain release factor 2	NA	NA	NA	NA	NA
AYA32869.1|1757817_1758936_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AYA32870.1|1758904_1759726_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
AYA32871.1|1759812_1760886_+	hypothetical protein	NA	NA	NA	NA	NA
AYA32872.1|1760882_1761266_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AYA32873.1|1761258_1761942_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AYA32874.1|1762000_1763047_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
AYA32875.1|1763046_1763388_+	hypothetical protein	NA	NA	NA	NA	NA
AYA32876.1|1763450_1763648_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
AYA32877.1|1763689_1764124_+	flagellar protein FlgN	NA	NA	NA	NA	NA
AYA32878.1|1764133_1765960_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
AYA32879.1|1765976_1766732_+	TIGR02757 family protein	NA	NA	NA	NA	NA
AYA32880.1|1766742_1767507_+	hypothetical protein	NA	NA	NA	NA	NA
AYA32881.1|1768088_1769108_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32882.1|1769226_1769856_+	phage repressor protein	NA	A7YGK7	Campylobacter_phage	100.0	2.6e-60
AYA32883.1|1769936_1770257_+	hypothetical protein	NA	A7YGI4	Campylobacter_phage	100.0	1.3e-52
AYA32884.1|1770266_1770461_+	hypothetical protein	NA	A7YG72	Campylobacter_phage	92.2	1.1e-25
AYA32885.1|1770540_1770828_+	hypothetical protein	NA	A7YGG4	Campylobacter_phage	96.8	4.7e-46
AYA32952.1|1770858_1771674_-	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	99.3	1.2e-150
AYA32886.1|1771778_1772267_-	virion morphogenesis protein	NA	A7YG96	Campylobacter_phage	99.4	1.7e-88
AYA32887.1|1772270_1774493_-|tail	phage tail tape measure protein	tail	A7YG97	Campylobacter_phage	99.1	0.0e+00
AYA32888.1|1774534_1774840_+	hypothetical protein	NA	A7YG98	Campylobacter_phage	100.0	4.7e-36
AYA32889.1|1774951_1775191_-|tail	phage tail assembly protein	tail	A7YGZ3	Campylobacter_phage	93.8	1.6e-23
AYA32890.1|1775295_1775805_-|tail	phage tail protein	tail	A7YG76	Campylobacter_phage	98.8	9.5e-90
AYA32891.1|1775831_1777025_-|tail	phage tail sheath family protein	tail	A7YGY2	Campylobacter_phage	99.7	2.2e-201
AYA32892.1|1777035_1778049_-	hypothetical protein	NA	A7YGY4	Campylobacter_phage	100.0	5.9e-192
AYA32893.1|1778148_1778520_-	DUF1353 domain-containing protein	NA	A7YGF6	Campylobacter_phage	100.0	5.7e-68
AYA32894.1|1778516_1779023_-	DUF4376 domain-containing protein	NA	A7YGY7	Campylobacter_phage	100.0	5.7e-87
AYA32895.1|1779032_1780112_-|tail	phage tail protein	tail	A7YGV0	Campylobacter_phage	99.6	5.1e-149
AYA32896.1|1780111_1780732_-|tail	phage tail protein I	tail	A7YGM6	Campylobacter_phage	97.4	2.8e-59
AYA32897.1|1780728_1781895_-|plate	baseplate assembly protein	plate	Q8H9N3	Vibrio_phage	24.9	1.4e-14
AYA32898.1|1781891_1782182_-|plate	baseplate assembly protein	plate	Q8H9N4	Vibrio_phage	40.8	2.7e-09
AYA32899.1|1782178_1782370_-	hypothetical protein	NA	NA	NA	NA	NA
AYA32900.1|1782378_1783011_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	35.6	4.6e-09
AYA32901.1|1783007_1783472_-	DUF1804 family protein	NA	NA	NA	NA	NA
AYA32902.1|1783602_1784643_+	hypothetical protein	NA	NA	NA	NA	NA
AYA32903.1|1784642_1785530_+|head	head protein	head	A0A2K9VH18	Faecalibacterium_phage	43.7	3.5e-63
AYA32904.1|1785529_1785841_+	hypothetical protein	NA	NA	NA	NA	NA
AYA32905.1|1785837_1786191_+	hypothetical protein	NA	NA	NA	NA	NA
AYA32906.1|1786187_1786553_+	hypothetical protein	NA	NA	NA	NA	NA
AYA32907.1|1786542_1786932_+	DUF882 domain-containing protein	NA	A0A1X9Q0V8	Human_gokushovirus	45.1	5.5e-21
AYA32908.1|1786942_1787284_+	hypothetical protein	NA	NA	NA	NA	NA
AYA32909.1|1787280_1787529_+	hypothetical protein	NA	NA	NA	NA	NA
AYA32910.1|1787640_1787955_+	hypothetical protein	NA	NA	NA	NA	NA
AYA32911.1|1788044_1789571_+	hypothetical protein	NA	A0A0M3LQB7	Mannheimia_phage	31.1	6.4e-49
