The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028379	Escherichia coli O145 str. RM9872 chromosome, complete genome	5385924	558021	623730	5385924	transposase,tail,lysis,portal,terminase,integrase,head,capsid,tRNA,protease	Enterobacteria_phage(55.88%)	66	592500:592546	624153:624199
AWN76527.1|558021_559116_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AWN76528.1|559184_560111_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
AWN76529.1|560339_560822_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
AWN76530.1|560899_561715_+	transcriptional regulator	NA	NA	NA	NA	NA
AWN76531.1|561804_563586_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	5.1e-37
AWN76532.1|563598_564375_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AWN76533.1|564474_565353_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AWN76534.1|565521_566976_+	putative allantoin permease	NA	NA	NA	NA	NA
AWN76535.1|567035_568397_+	allantoinase AllB	NA	NA	NA	NA	NA
AWN76536.1|568453_569755_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
AWN76537.1|569776_570931_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.5	6.0e-47
AWN76538.1|571059_571845_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
AWN76539.1|571855_573091_-	allantoate amidohydrolase	NA	NA	NA	NA	NA
AWN76540.1|573112_574159_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AWN76541.1|574476_576144_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AWN76542.1|576153_577413_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AWN76543.1|577423_578239_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AWN76544.1|578235_579129_+	carbamate kinase	NA	NA	NA	NA	NA
AWN76545.1|579265_580333_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AWN76546.1|580329_580839_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AWN76547.1|580956_581679_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AWN76548.1|581681_582176_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AWN76549.1|582349_583735_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
AWN76550.1|583770_584292_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWN76551.1|584399_584612_-	ribosome-associated protein	NA	NA	NA	NA	NA
AWN76552.1|584613_585480_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AWN76553.1|585949_586492_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AWN76554.1|586711_587404_+	fimbrial chaperone SfmC	NA	NA	NA	NA	NA
AWN76555.1|587434_590044_+	outer membrane usher protein	NA	NA	NA	NA	NA
AWN76556.1|590056_591064_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AWN76557.1|591074_591590_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AWN76558.1|591592_592225_-	DNA-binding response regulator	NA	NA	NA	NA	NA
592500:592546	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AWN76559.1|592559_593084_-|integrase	phage integrase family protein	integrase	A0A088CD23	Shigella_phage	85.6	2.0e-87
AWN76560.1|593129_594343_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	2.5e-168
AWN76561.1|594505_595003_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
AWN76562.1|594999_595461_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	99.3	2.4e-76
AWN76563.1|595492_595786_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AWN76564.1|596146_596341_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AWN76565.1|596730_597276_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AWN76566.1|597250_599176_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AWN76567.1|599172_599379_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AWN76568.1|599375_600977_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
AWN76569.1|600957_602277_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
AWN76570.1|602286_602619_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
AWN76571.1|602674_603700_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
AWN76572.1|603741_604137_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	96.2	5.2e-59
AWN76573.1|604148_604502_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
AWN76574.1|604513_605092_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
AWN76575.1|605088_605484_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AWN81016.1|605491_606232_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
AWN76576.1|606247_606670_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
AWN76577.1|606651_607086_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AWN76578.1|607078_609658_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.6	0.0e+00
AWN76579.1|609654_609984_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
AWN76580.1|609983_610682_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
AWN76581.1|610687_611431_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
AWN76582.1|611328_612000_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
AWN76583.1|612060_615558_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.2	0.0e+00
AWN76584.1|615628_616228_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
AWN81017.1|616292_619253_+	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
AWN76585.1|619252_619837_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.2e-101
AWN76586.1|619809_619947_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AWN81018.1|619891_620518_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWN76587.1|620616_620922_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
AWN76588.1|621105_622590_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWN76589.1|622776_623730_-|protease	outer membrane protease	protease	NA	NA	NA	NA
624153:624199	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 2
CP028379	Escherichia coli O145 str. RM9872 chromosome, complete genome	5385924	836521	867463	5385924	transposase,tail,holin,lysis,portal,terminase,integrase,head,capsid	Enterobacteria_phage(50.0%)	43	829861:829920	838684:839374
829861:829920	attL	AGTGGCCAGATGCACTGTGGCACGTCTCATGGCGGTTATGGGACTTGCCGGTGTTCTCCG	NA	NA	NA	NA
AWN76785.1|836521_837592_-|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
AWN76786.1|837569_837788_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AWN76787.1|837827_837995_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
AWN81026.1|837927_838113_+	hypothetical protein	NA	NA	NA	NA	NA
AWN76788.1|838118_839331_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
AWN76789.1|839297_839432_+	PapI protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.0e-06
838684:839374	attR	AGTGGCCAGATGCACTGTGGCACGTCTCATGGCGGTTATGGGACTTGCCGGTGTTCTCCGGGGTAAAAAGGTCCGTACGACCATCAGCCGGAAAGCCGTTGCCGCAGGCGACCGCGTAAACCGTCAGTTCGTGGCAGAACGACCTGACCAGCTGTGGGTGGCTGATTTTACTTACGTCAGCACATGGCAGGGCTTCGTCTATGTGGCGTTCATCATTGATGTGTTTGCCGGATACATTGTGGGGTGGCGGGTCTCATCGTCCATGGAGACGACATTCGTGCTGGATGCACTGGAGCAGGCGTTATGGGCCCGTCGACCGTCCGGCACGGTCCATCACAGTGATAAAGGTTCTCAGTATGTATCGCTGGCCTACACACAGCGGCTTAAGGAAGCCGGATTACTGGCATCAACAGGAAGTACAGGCGACTCGTATGACAACGCGATGGCGGAGAGCATCAATGGTCTTTACAAAGCGGAGGTAATACACCGTAAGAGCTGGAAAAACCGTGCAGAAGTGGAACTGGCCACACTCACGTGGGTGGACTGGTATAACAATCGACGATTGCTGGAAAGGCTGGGCCATACTCCTCCGGCAGAAGCAGAAAAAGCTTATTATGCTTCCATCGGAAACGATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCA	NA	NA	NA	NA
AWN76790.1|839374_839647_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	98.9	1.0e-42
AWN76791.1|839702_840161_+	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	100.0	4.3e-81
AWN76792.1|840157_840685_+	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	3.6e-100
AWN76793.1|840681_840864_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
AWN76794.1|840860_841031_+	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
AWN76795.1|841023_841635_+	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	6.0e-99
AWN76796.1|841631_842297_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
AWN76797.1|842508_843468_-	DUF2219 domain-containing protein	NA	NA	NA	NA	NA
AWN76798.1|843805_843928_+	YlcG family protein	NA	NA	NA	NA	NA
AWN76799.1|843942_844632_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
AWN76800.1|844843_845560_+	hypothetical protein	NA	NA	NA	NA	NA
AWN76801.1|845645_845804_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AWN76802.1|846102_846753_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	92.1	3.1e-109
AWN76803.1|846731_847928_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
AWN81027.1|849250_849403_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	98.0	5.8e-19
AWN76804.1|849575_850789_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
AWN76805.1|850942_851104_-	hypothetical protein	NA	NA	NA	NA	NA
AWN76806.1|851102_851318_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWN76807.1|851762_852976_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
AWN76808.1|853124_853562_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
AWN76809.1|853711_854329_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.4	1.2e-91
AWN76810.1|854296_854437_-	hypothetical protein	NA	NA	NA	NA	NA
AWN76811.1|854516_854711_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AWN76812.1|855105_855615_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AWN76813.1|855586_857515_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	5.5e-263
AWN76814.1|857498_857705_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AWN76815.1|857701_859294_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	1.9e-184
AWN76816.1|859283_860789_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
AWN76817.1|860825_861173_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	9.9e-22
AWN76818.1|861230_862259_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
AWN76819.1|862310_862694_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
AWN76820.1|862686_863136_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	98.1	2.3e-55
AWN76821.1|863203_863776_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	93.5	2.3e-100
AWN76822.1|863840_865154_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
AWN76823.1|865155_865425_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
AWN76824.1|865530_866412_+	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
AWN76825.1|866635_867463_+	cell division protein	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
>prophage 3
CP028379	Escherichia coli O145 str. RM9872 chromosome, complete genome	5385924	1087640	1149090	5385924	transposase,tail,holin,lysis,portal,integrase,terminase,head,capsid,protease	Enterobacteria_phage(42.22%)	75	1102736:1102795	1151320:1151384
AWN77011.1|1087640_1089401_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
AWN77012.1|1089586_1090039_+	macrodomain Ter protein	NA	NA	NA	NA	NA
AWN77013.1|1090113_1091169_-	outer membrane protein A	NA	NA	NA	NA	NA
AWN77014.1|1091323_1091542_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77015.1|1091525_1092035_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AWN77016.1|1092253_1092883_+	protein Sxy	NA	NA	NA	NA	NA
AWN81034.1|1092845_1094999_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AWN77017.1|1095017_1095464_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AWN77018.1|1095586_1097641_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
AWN77019.1|1097672_1098131_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AWN77020.1|1098226_1098889_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AWN77021.1|1099061_1099475_+	CoA-binding protein	NA	NA	NA	NA	NA
AWN77022.1|1099519_1099837_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
AWN77023.1|1099894_1101085_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
AWN77024.1|1101179_1101458_+	acylphosphatase	NA	NA	NA	NA	NA
AWN77025.1|1101454_1101784_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AWN77026.1|1101874_1102534_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
1102736:1102795	attL	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAA	NA	NA	NA	NA
AWN77027.1|1102941_1103961_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
AWN77028.1|1103938_1104181_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AWN77029.1|1104248_1106684_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
AWN77030.1|1106777_1106969_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWN77031.1|1106965_1107154_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWN77032.1|1107991_1109205_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
AWN77033.1|1109279_1109399_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWN77034.1|1109470_1110553_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
AWN77035.1|1110559_1111306_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	84.6	5.6e-115
AWN77036.1|1111327_1112098_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
AWN77037.1|1112113_1112527_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
AWN77038.1|1112878_1113652_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWN77039.1|1114199_1114412_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
AWN77040.1|1114579_1114858_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AWN77041.1|1114859_1115909_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
AWN77042.1|1115921_1116293_+	hypothetical protein	NA	V5URS4	Shigella_phage	63.7	1.3e-35
AWN77043.1|1116282_1116654_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
AWN77044.1|1116805_1117624_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWN77045.1|1117910_1118108_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
AWN77046.1|1118245_1118959_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWN77047.1|1119405_1119609_-	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
AWN77048.1|1119726_1121577_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
AWN77049.1|1121871_1122018_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77050.1|1122016_1122232_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
AWN77051.1|1122194_1122539_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77052.1|1122487_1122724_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77053.1|1122692_1122875_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77054.1|1122919_1123453_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
AWN77055.1|1123784_1124273_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	95.2	8.9e-69
AWN77056.1|1124278_1125491_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
AWN77057.1|1125647_1125788_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77058.1|1126030_1126345_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWN77059.1|1126426_1126651_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
AWN77060.1|1127052_1127562_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AWN77061.1|1127533_1129462_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	2.7e-262
AWN77062.1|1129445_1129652_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AWN77063.1|1129648_1131241_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
AWN77064.1|1131230_1132736_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	1.0e-99
AWN77065.1|1132772_1133120_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
AWN77066.1|1133177_1134206_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
AWN77067.1|1134209_1134632_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77068.1|1134624_1134978_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	8.7e-42
AWN77069.1|1134993_1135527_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
AWN77070.1|1135523_1135919_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
AWN77071.1|1135926_1136679_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
AWN77072.1|1136692_1137124_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
AWN77073.1|1137150_1137564_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
AWN77074.1|1137544_1140124_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.8	0.0e+00
AWN77075.1|1140120_1140450_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	94.5	2.2e-55
AWN77076.1|1140449_1141148_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
AWN77077.1|1141153_1141897_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.0	5.9e-149
AWN77078.1|1141794_1142475_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.9	2.4e-112
AWN77079.1|1142428_1142635_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77080.1|1142665_1143193_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
AWN77081.1|1143326_1146803_+|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	96.7	0.0e+00
AWN77082.1|1146869_1147442_+	Ail/Lom family protein	NA	A0A0P0ZBV0	Stx2-converting_phage	93.0	1.5e-99
AWN77083.1|1147506_1148820_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	1.7e-82
AWN77084.1|1148841_1149090_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	96.3	2.8e-39
1151320:1151384	attR	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
>prophage 4
CP028379	Escherichia coli O145 str. RM9872 chromosome, complete genome	5385924	1390142	1461926	5385924	transposase,tail,holin,lysis,terminase,integrase,head,capsid,tRNA	Stx2-converting_phage(32.0%)	85	1393300:1393315	1467727:1467742
AWN77313.1|1390142_1391261_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	3.5e-84
AWN77314.1|1391229_1391499_-	excisionase	NA	NA	NA	NA	NA
AWN77315.1|1391560_1393498_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	6.7e-59
1393300:1393315	attL	GCTTGTATTCGCGATG	NA	NA	NA	NA
AWN77316.1|1393494_1394708_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
AWN81055.1|1394669_1394972_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77317.1|1395038_1395317_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.3e-11
AWN77318.1|1395318_1396368_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
AWN77319.1|1396380_1396755_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	6.4e-35
AWN77320.1|1396751_1397573_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
AWN77321.1|1398169_1398337_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
AWN77322.1|1398743_1400594_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
AWN77323.1|1400877_1401093_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	95.8	5.0e-32
AWN77324.1|1401055_1401400_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77325.1|1401348_1401585_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77326.1|1401553_1401748_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77327.1|1401780_1402314_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
AWN77328.1|1402391_1402583_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	63.9	7.8e-05
AWN81056.1|1402740_1403208_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.1	7.2e-68
AWN77329.1|1403231_1403456_+	hypothetical protein	NA	NA	NA	NA	NA
AWN81057.1|1403452_1403671_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	73.3	6.4e-11
AWN77330.1|1403812_1403953_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77331.1|1404082_1404268_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
AWN77332.1|1404309_1404675_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.6e-62
AWN77333.1|1404643_1404781_+	DNase	NA	NA	NA	NA	NA
AWN77334.1|1404963_1405527_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
AWN77335.1|1405523_1407185_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.2	0.0e+00
AWN77336.1|1407248_1409186_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
AWN81058.1|1409230_1409452_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
AWN77337.1|1411978_1412305_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	98.1	2.7e-53
AWN77338.1|1412315_1412666_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWN77339.1|1412662_1413109_+	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
AWN77340.1|1413105_1413450_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
AWN77341.1|1413508_1414225_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	5.2e-126
AWN77342.1|1414230_1414605_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
AWN77343.1|1414628_1414910_+|tail	phage tail protein	tail	A0A0P0ZED8	Stx2-converting_phage	98.9	5.1e-45
AWN77344.1|1414957_1418200_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	96.0	0.0e+00
AWN77345.1|1418192_1418534_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
AWN77346.1|1418533_1419232_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.8e-131
AWN77347.1|1419248_1419503_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77348.1|1419612_1419765_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AWN77349.1|1420028_1420907_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
AWN77350.1|1420960_1421698_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
AWN77351.1|1421595_1422276_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.8	3.3e-114
AWN77352.1|1422521_1425998_+|tail	phage tail protein	tail	A0A0P0ZBW1	Stx2-converting_phage	98.0	0.0e+00
AWN77353.1|1426064_1426664_+	Ail/Lom family protein	NA	A0A0P0ZBV0	Stx2-converting_phage	98.5	7.5e-110
AWN77354.1|1426728_1428042_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
AWN77355.1|1428043_1428313_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	1.6e-43
AWN77356.1|1428528_1430877_+	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
AWN77357.1|1431467_1434869_+	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
AWN77358.1|1435245_1435437_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77359.1|1435411_1436380_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	2.4e-174
AWN77360.1|1436345_1437559_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
AWN77361.1|1438285_1438411_+	NleB	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
AWN77362.1|1438490_1438766_-	secretion protein EspO	NA	NA	NA	NA	NA
AWN77363.1|1438826_1440188_-	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
AWN81059.1|1440308_1440521_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77364.1|1440551_1441415_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AWN77365.1|1441398_1442535_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AWN81060.1|1442513_1442729_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77366.1|1442784_1444011_+	peptidase T	NA	NA	NA	NA	NA
AWN77367.1|1444059_1445181_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AWN77368.1|1445429_1446659_+|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
AWN77369.1|1447023_1447212_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
AWN81061.1|1448016_1448214_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AWN77370.1|1448206_1448419_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77371.1|1448408_1448873_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77372.1|1448865_1449099_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77373.1|1449104_1449404_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AWN77374.1|1449400_1450801_+	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	1.2e-115
AWN77375.1|1451001_1451253_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77376.1|1451249_1451660_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWN77377.1|1451670_1451943_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWN77378.1|1451899_1452028_+	trigger factor	NA	NA	NA	NA	NA
AWN77379.1|1452069_1452294_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77380.1|1452545_1452752_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77381.1|1452751_1453807_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
AWN77382.1|1453819_1454155_+|head	head decoration protein	head	NA	NA	NA	NA
AWN77383.1|1454167_1454581_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
AWN77384.1|1454786_1455329_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
AWN77385.1|1455585_1455867_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77386.1|1456468_1457929_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AWN77387.1|1457928_1458600_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AWN77388.1|1458768_1460139_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AWN81062.1|1460142_1460784_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AWN77389.1|1460819_1461926_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
1467727:1467742	attR	CATCGCGAATACAAGC	NA	NA	NA	NA
>prophage 5
CP028379	Escherichia coli O145 str. RM9872 chromosome, complete genome	5385924	1574875	1634508	5385924	transposase,tail,terminase,integrase,head,capsid,protease	Stx2-converting_phage(33.33%)	61	1574712:1574739	1618665:1618692
1574712:1574739	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
AWN77494.1|1574875_1576006_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
AWN77495.1|1575983_1576232_-	excisionase	NA	NA	NA	NA	NA
AWN77496.1|1578859_1579048_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWN77497.1|1579044_1579233_-	cell division inhibitor	NA	NA	NA	NA	NA
AWN77498.1|1579793_1580027_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77499.1|1580004_1580412_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
AWN77500.1|1580434_1580653_-	hypothetical protein	NA	NA	NA	NA	NA
AWN81070.1|1580725_1581025_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77501.1|1581289_1581697_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
AWN77502.1|1581773_1582001_+	transcriptional regulator	NA	NA	NA	NA	NA
AWN77503.1|1581984_1582536_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77504.1|1583336_1584002_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.9e-85
AWN77505.1|1584035_1584770_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
AWN77506.1|1585628_1586387_+	accessory colonization factor AcfC	NA	NA	NA	NA	NA
AWN77507.1|1586665_1586878_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
AWN77508.1|1587098_1587356_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77509.1|1587425_1587704_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
AWN77510.1|1587705_1588761_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
AWN77511.1|1588761_1589127_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
AWN77512.1|1589123_1589813_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
AWN77513.1|1589843_1589990_+	antiterminator	NA	NA	NA	NA	NA
AWN77514.1|1590363_1591560_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
AWN77515.1|1592065_1592629_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
AWN77516.1|1592625_1594287_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.3	0.0e+00
AWN77517.1|1594350_1596288_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.1	0.0e+00
AWN81071.1|1596332_1596554_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	95.9	3.2e-34
AWN77518.1|1599242_1599569_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AWN77519.1|1599579_1599930_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
AWN77520.1|1599926_1600373_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWN77521.1|1600369_1600714_+	hypothetical protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.2	6.1e-56
AWN77522.1|1600772_1601489_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	2.3e-126
AWN77523.1|1601494_1601869_+|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
AWN77524.1|1601892_1602174_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AWN77525.1|1602225_1605468_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	99.8	0.0e+00
AWN77526.1|1605460_1605802_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
AWN77527.1|1605801_1606500_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	97.0	1.2e-130
AWN77528.1|1606510_1607254_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
AWN77529.1|1607151_1607832_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.3	6.5e-110
AWN77530.1|1608174_1611648_+|tail	phage tail protein	tail	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
AWN77531.1|1612949_1613228_-	secretion protein EspO	NA	NA	NA	NA	NA
AWN77532.1|1613616_1613802_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77533.1|1613938_1614586_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	41.6	1.9e-42
AWN77534.1|1614769_1615360_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
AWN81072.1|1617088_1617517_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
AWN81073.1|1618122_1618341_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77535.1|1618842_1619349_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1618665:1618692	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
AWN77536.1|1619394_1619895_-	YciE/YciF family protein	NA	NA	NA	NA	NA
AWN77537.1|1619980_1620160_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77538.1|1620540_1621347_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AWN77539.1|1621346_1622540_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AWN81074.1|1622551_1623910_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
AWN77540.1|1623913_1625509_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AWN77541.1|1625508_1627071_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AWN81075.1|1627162_1627207_-	trp operon leader peptide	NA	NA	NA	NA	NA
AWN77542.1|1627344_1628226_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
AWN77543.1|1628222_1628843_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AWN77544.1|1628870_1630766_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AWN77545.1|1630978_1631854_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AWN77546.1|1631893_1632484_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AWN77547.1|1632480_1633239_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
AWN77548.1|1633458_1634508_+|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
CP028379	Escherichia coli O145 str. RM9872 chromosome, complete genome	5385924	1718114	1783423	5385924	transposase,tail,holin,lysis,portal,integrase,terminase,head,capsid,tRNA	Escherichia_phage(46.48%)	83	1717748:1717763	1737957:1737972
1717748:1717763	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
AWN77627.1|1718114_1719347_-	PAS domain S-box protein	NA	A0A127AWB9	Bacillus_phage	39.5	1.8e-17
AWN77628.1|1719601_1720585_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AWN77629.1|1720859_1721033_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77630.1|1721062_1722436_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	6.6e-53
AWN77631.1|1722564_1723500_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
AWN77632.1|1723552_1724788_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.3	1.1e-240
AWN77633.1|1724789_1725005_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AWN77634.1|1725104_1725293_-	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
AWN77635.1|1725285_1725480_-	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
AWN77636.1|1725543_1726596_-	enterohemolysin	NA	A0A0U2S5Y9	Escherichia_phage	63.3	1.4e-116
AWN77637.1|1726607_1729733_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	82.8	0.0e+00
AWN77638.1|1729834_1730110_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	4.9e-40
AWN81078.1|1730184_1730355_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	92.9	7.9e-25
AWN77639.1|1730354_1730576_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	1.2e-36
AWN77640.1|1730836_1731097_+	hypothetical protein	NA	NA	NA	NA	NA
AWN81079.1|1731145_1731355_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77641.1|1731355_1731994_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
AWN77642.1|1732005_1732158_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.3e-07
AWN77643.1|1732463_1732883_-	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
AWN77644.1|1732979_1733222_+	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
AWN77645.1|1733218_1733641_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
AWN77646.1|1733653_1734523_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.3	2.2e-78
AWN77647.1|1734529_1735276_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
AWN77648.1|1735297_1736068_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	5.7e-86
AWN77649.1|1736083_1736479_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
AWN77650.1|1736536_1736893_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	4.3e-57
AWN77651.1|1737091_1738305_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
1737957:1737972	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
AWN81080.1|1738266_1738467_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	69.8	6.7e-15
AWN77652.1|1738530_1738875_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	93.5	2.0e-46
AWN77653.1|1738871_1739225_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.8	3.2e-36
AWN77654.1|1739340_1739445_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77655.1|1739433_1739589_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	83.8	1.9e-09
AWN77656.1|1739633_1739846_+	type I toxin-antitoxin system hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.8e-27
AWN77657.1|1740082_1740334_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77658.1|1740405_1741005_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	91.0	1.6e-104
AWN77659.1|1741004_1741295_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	5.7e-47
AWN77660.1|1741291_1741846_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	71.6	7.5e-72
AWN77661.1|1742119_1742701_+	hypothetical protein	NA	Q8VNP5	Enterobacteria_phage	97.6	8.7e-63
AWN77662.1|1742821_1743142_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.1	2.7e-34
AWN77663.1|1743379_1744593_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
AWN81081.1|1744913_1745303_+	envelope protein	NA	NA	NA	NA	NA
AWN77664.1|1745752_1746184_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
AWN77665.1|1746755_1748606_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
AWN77666.1|1749042_1749258_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
AWN77667.1|1749262_1749607_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
AWN77668.1|1749657_1750107_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.0	2.5e-73
AWN77669.1|1750112_1751325_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
AWN77670.1|1751309_1751504_+	hypothetical protein	NA	A0A0N7C1K4	Escherichia_phage	51.6	4.8e-26
AWN77671.1|1751774_1752344_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AWN81082.1|1752492_1752960_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	83.8	3.7e-64
AWN77672.1|1753042_1753183_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77673.1|1753423_1753738_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWN77674.1|1753819_1754044_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
AWN77675.1|1754191_1754293_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77676.1|1754432_1754978_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AWN77677.1|1754952_1756878_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
AWN77678.1|1756874_1757081_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AWN77679.1|1757077_1758679_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
AWN77680.1|1758659_1759979_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
AWN77681.1|1759988_1760321_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
AWN77682.1|1760376_1761402_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
AWN77683.1|1761443_1761839_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	96.2	5.2e-59
AWN77684.1|1761850_1762204_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
AWN77685.1|1762215_1762794_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
AWN77686.1|1762790_1763186_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	93.1	7.4e-66
AWN77687.1|1763193_1763946_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
AWN77688.1|1763959_1764382_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
AWN77689.1|1764408_1764822_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
AWN77690.1|1764802_1767415_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.1	0.0e+00
AWN77691.1|1767411_1767741_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWN77692.1|1767740_1768439_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
AWN77693.1|1768444_1769188_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.3	1.4e-145
AWN77694.1|1769085_1769766_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.7	1.8e-115
AWN77695.1|1770011_1773488_+|tail	phage tail protein	tail	Q687E8	Enterobacteria_phage	95.5	0.0e+00
AWN77696.1|1773554_1774154_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	5.2e-111
AWN77697.1|1774218_1775532_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	98.2	2.8e-77
AWN77698.1|1775533_1775803_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	96.6	3.5e-43
AWN77699.1|1776012_1776204_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77700.1|1776232_1777219_+	peptidase M85	NA	NA	NA	NA	NA
AWN77701.1|1777589_1777844_-	damage-inducible protein DinI	NA	Q687E4	Enterobacteria_phage	86.2	9.1e-25
AWN77702.1|1777845_1779058_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
AWN77703.1|1779619_1780833_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.9e-168
AWN77704.1|1781962_1783423_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
>prophage 7
CP028379	Escherichia coli O145 str. RM9872 chromosome, complete genome	5385924	1914892	2031305	5385924	transposase,tail,holin,lysis,portal,terminase,head,capsid,protease	Escherichia_phage(35.94%)	125	NA	NA
AWN77817.1|1914892_1916854_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.6	1.6e-23
AWN77818.1|1916926_1917463_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWN77819.1|1917515_1918727_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
AWN77820.1|1918761_1919430_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
AWN77821.1|1919733_1920327_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
AWN77822.1|1920323_1921316_-	TDT family transporter	NA	NA	NA	NA	NA
AWN77823.1|1921439_1922420_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77824.1|1922414_1922951_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
AWN77825.1|1923013_1923238_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AWN77826.1|1923253_1923457_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77827.1|1923377_1925033_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AWN77828.1|1925063_1925261_+	hypothetical protein	NA	NA	NA	NA	NA
AWN77829.1|1925257_1926601_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
AWN77830.1|1926817_1927741_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWN77831.1|1927778_1929419_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
AWN77832.1|1929808_1929958_+	type I toxin-antitoxin system hok family toxin	NA	NA	NA	NA	NA
AWN77833.1|1930029_1930203_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
AWN81088.1|1930447_1930978_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
AWN77834.1|1931166_1932168_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AWN77835.1|1932209_1933649_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWN77836.1|1933845_1934646_-	YdcF family protein	NA	NA	NA	NA	NA
AWN77837.1|1934917_1938820_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	1.1e-52
AWN77838.1|1939020_1939626_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AWN81089.1|1939679_1940972_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77839.1|1940985_1942743_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77840.1|1942758_1943655_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77841.1|1943654_1944260_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
AWN77842.1|1944429_1946736_-	DUF2773 domain-containing protein	NA	NA	NA	NA	NA
AWN77843.1|1946799_1947660_-	oxidoreductase	NA	NA	NA	NA	NA
AWN77844.1|1947891_1948482_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
AWN77845.1|1948463_1949414_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
AWN77846.1|1949741_1950500_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
AWN77847.1|1950496_1951567_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
AWN77848.1|1951574_1952072_-	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
AWN77849.1|1952840_1953128_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
AWN77850.1|1953139_1954069_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
AWN77851.1|1954353_1956399_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
AWN77852.1|1956646_1958920_+	primary-amine oxidase	NA	NA	NA	NA	NA
AWN77853.1|1961791_1962118_-	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
AWN77854.1|1962125_1962311_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
AWN77855.1|1962307_1964947_-	YdbH family protein	NA	NA	NA	NA	NA
AWN77856.1|1965154_1966144_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
AWN77857.1|1966254_1966677_+	heat-shock protein HslJ	NA	NA	NA	NA	NA
AWN77858.1|1966673_1966940_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AWN77859.1|1967213_1970738_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AWN77860.1|1970648_1970828_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77861.1|1971104_1972238_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.8	2.4e-117
AWN77862.1|1972378_1972813_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AWN77863.1|1974629_1974821_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77864.1|1975030_1975300_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
AWN77865.1|1975301_1976615_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	2.9e-82
AWN77866.1|1976679_1977279_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	6.3e-109
AWN77867.1|1977346_1980820_-|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	97.1	0.0e+00
AWN77868.1|1981066_1981747_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	91.6	1.8e-107
AWN77869.1|1981644_1982388_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.8e-146
AWN77870.1|1982398_1983097_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	5.8e-130
AWN77871.1|1983096_1983426_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWN77872.1|1983422_1986035_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.4	0.0e+00
AWN77873.1|1986015_1986429_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
AWN77874.1|1986455_1986878_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.1	3.4e-69
AWN77875.1|1986891_1987644_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
AWN77876.1|1987651_1988047_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AWN77877.1|1988043_1988577_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.2e-58
AWN77878.1|1988592_1988946_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
AWN77879.1|1988938_1989322_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
AWN77880.1|1989373_1990402_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
AWN77881.1|1990459_1990807_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	6.8e-23
AWN77882.1|1990843_1992349_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
AWN77883.1|1992338_1993931_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
AWN77884.1|1993927_1994134_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AWN77885.1|1994117_1996046_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	2.3e-261
AWN81090.1|1996017_1996524_-	DNA-packaging protein	NA	O64316	Escherichia_phage	47.9	1.5e-34
AWN77886.1|1997010_1997235_-	hypothetical protein	NA	NA	NA	NA	NA
AWN81091.1|1997258_1997726_-|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.7	1.2e-67
AWN77887.1|1997872_1998088_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77888.1|1998211_1998745_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
AWN77889.1|1998795_1999140_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
AWN77890.1|1999144_1999360_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
AWN77891.1|1999798_2001649_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
AWN77892.1|2001697_2001826_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77893.1|2002127_2002559_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
AWN77894.1|2002748_2002958_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.5e-20
AWN77895.1|2003010_2003235_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77896.1|2003615_2003768_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
AWN77897.1|2003782_2003992_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.4	6.3e-24
AWN77898.1|2004077_2004830_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
AWN77899.1|2004843_2005893_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	57.3	6.1e-115
AWN77900.1|2005894_2006164_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
AWN77901.1|2006217_2006445_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77902.1|2006668_2007040_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWN77903.1|2007032_2007350_+	transcriptional regulator	NA	NA	NA	NA	NA
AWN77904.1|2007452_2007665_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
AWN77905.1|2007709_2007865_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	94.6	2.4e-12
AWN77906.1|2007853_2007958_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77907.1|2008073_2008787_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.2e-34
AWN77908.1|2008987_2009200_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
AWN77909.1|2009248_2009605_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	4.3e-57
AWN77910.1|2009582_2010302_-	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	64.4	1.7e-68
AWN77911.1|2010467_2010650_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
AWN77912.1|2010683_2010896_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
AWN77913.1|2010946_2011303_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
AWN77914.1|2011652_2011949_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
AWN77915.1|2011945_2012353_-	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	62.6	2.3e-38
AWN77916.1|2012353_2013124_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	69.2	1.3e-85
AWN77917.1|2013158_2013824_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	3.5e-84
AWN77918.1|2014590_2015804_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
AWN77919.1|2015937_2016489_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77920.1|2016472_2016703_-	transcriptional regulator	NA	NA	NA	NA	NA
AWN77921.1|2016786_2017194_+	transcriptional regulator	NA	B1B6L9	Salmonella_phage	58.7	3.1e-14
AWN77922.1|2017360_2017513_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
AWN77923.1|2017524_2018163_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
AWN81092.1|2018163_2018373_-	hypothetical protein	NA	NA	NA	NA	NA
AWN77924.1|2018940_2019129_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWN77925.1|2019125_2019317_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWN77926.1|2019410_2021882_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	1.6e-57
AWN77927.1|2021951_2022203_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
AWN77928.1|2022222_2023518_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
AWN77929.1|2023537_2023648_-	transporter	NA	NA	NA	NA	NA
AWN77930.1|2023705_2024725_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.7	1.0e-18
AWN77931.1|2024736_2025951_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWN77932.1|2026617_2026959_+	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWN77933.1|2026993_2027554_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWN81093.1|2027556_2028267_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWN77934.1|2028374_2028680_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWN77935.1|2028878_2031305_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.3e-213
>prophage 8
CP028379	Escherichia coli O145 str. RM9872 chromosome, complete genome	5385924	2164860	2212599	5385924	tail,holin,portal,plate,integrase,terminase,capsid,tRNA	Enterobacteria_phage(76.6%)	60	2167263:2167287	2205241:2205265
AWN78057.1|2164860_2165610_-	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	7.1e-09
AWN78058.1|2165609_2166161_-	glutathione peroxidase	NA	NA	NA	NA	NA
AWN78059.1|2166223_2167204_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2167263:2167287	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
AWN78060.1|2167396_2167834_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
AWN78061.1|2167934_2168435_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78062.1|2168437_2169376_-|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.1	1.1e-80
AWN78063.1|2169464_2169776_-	XRE family transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	1.2e-21
AWN78064.1|2169867_2170146_+	DNA-binding protein	NA	NA	NA	NA	NA
AWN78065.1|2170160_2170499_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	83.6	6.0e-48
AWN78066.1|2170509_2170797_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.9	6.0e-33
AWN78067.1|2170808_2171051_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AWN78068.1|2171254_2171665_+	hypothetical protein	NA	NA	NA	NA	NA
AWN78069.1|2171688_2171892_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	1.9e-25
AWN78070.1|2171888_2172155_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	76.1	6.8e-31
AWN78071.1|2172220_2172688_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78072.1|2173074_2173305_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	89.5	4.7e-28
AWN78073.1|2173377_2173743_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
AWN81102.1|2173887_2176572_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.4	0.0e+00
AWN78074.1|2176648_2177608_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.9e-180
AWN78075.1|2177612_2177924_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	8.5e-49
AWN78076.1|2177987_2178512_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	59.5	2.6e-05
AWN78077.1|2179003_2180050_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AWN78078.1|2180049_2181801_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.5	0.0e+00
AWN78079.1|2181955_2182792_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
AWN78080.1|2182815_2183868_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
AWN78081.1|2183913_2184714_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
AWN78082.1|2184816_2185311_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
AWN78083.1|2185310_2185511_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	97.0	3.9e-31
AWN78084.1|2185513_2185837_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AWN78085.1|2185833_2186226_+	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AWN78086.1|2186222_2186630_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
AWN81103.1|2186601_2186781_+	hypothetical protein	NA	NA	NA	NA	NA
AWN78087.1|2186767_2187235_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
AWN78088.1|2187227_2187863_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
AWN78089.1|2187859_2188441_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	8.6e-103
AWN78090.1|2188437_2188788_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AWN78091.1|2188791_2189688_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
AWN78092.1|2189680_2190211_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
AWN78093.1|2190213_2192610_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	60.4	3.3e-209
AWN78094.1|2192611_2193139_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	90.9	6.0e-87
AWN78095.1|2193167_2193701_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.3	7.1e-96
AWN78096.1|2194728_2195328_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	97.8	1.2e-96
AWN78097.1|2195354_2195849_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	2.5e-87
AWN78098.1|2195855_2198663_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	97.1	0.0e+00
AWN78099.1|2198649_2198886_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.9e-22
AWN78100.1|2198813_2199179_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
AWN78101.1|2199233_2199746_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
AWN78102.1|2199745_2200930_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	4.0e-224
AWN78103.1|2201086_2202196_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	92.4	2.7e-190
AWN78104.1|2202547_2204131_+	DUF262 domain-containing protein	NA	E5E3X3	Burkholderia_phage	54.9	8.5e-161
AWN78105.1|2204388_2204649_+	hypothetical protein	NA	NA	NA	NA	NA
AWN78106.1|2204839_2204980_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AWN78107.1|2205282_2205582_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2205241:2205265	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
AWN78108.1|2205586_2207974_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWN78109.1|2207988_2208972_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AWN81104.1|2209254_2209299_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AWN78110.1|2209421_2209778_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWN78111.1|2209830_2210028_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWN78112.1|2210124_2210667_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AWN78113.1|2210670_2212599_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.6e-129
>prophage 9
CP028379	Escherichia coli O145 str. RM9872 chromosome, complete genome	5385924	2322543	2418234	5385924	tail,holin,lysis,portal,terminase,tRNA,protease	Escherichia_phage(36.07%)	104	NA	NA
AWN78227.1|2322543_2323425_-|protease	protease HtpX	protease	NA	NA	NA	NA
AWN78228.1|2323616_2325665_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
AWN78229.1|2325684_2326383_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AWN78230.1|2326479_2326977_-	methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AWN78231.1|2327106_2328390_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AWN78232.1|2328358_2330992_+	MCE family protein	NA	NA	NA	NA	NA
AWN81108.1|2331071_2332511_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AWN78233.1|2332628_2332865_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AWN81109.1|2332969_2333161_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWN78234.1|2333161_2333818_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
AWN78235.1|2334212_2334554_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AWN78236.1|2334566_2335439_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78237.1|2335442_2335817_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AWN78238.1|2335955_2336186_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AWN78239.1|2336287_2336944_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AWN78240.1|2336967_2337630_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AWN78241.1|2337626_2339687_-	oligopeptidase B	NA	NA	NA	NA	NA
AWN78242.1|2339688_2339871_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78243.1|2339895_2340555_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
AWN78244.1|2340881_2341238_-	protein YebF	NA	NA	NA	NA	NA
AWN78245.1|2341304_2341595_-	damage-inducible protein YebG	NA	NA	NA	NA	NA
AWN78246.1|2341728_2342907_+	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
AWN78247.1|2342962_2343604_-	KHG/KDPG aldolase	NA	NA	NA	NA	NA
AWN78248.1|2343640_2345452_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AWN78249.1|2345686_2347162_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
AWN78250.1|2347499_2348369_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWN78251.1|2348496_2349939_+	pyruvate kinase	NA	NA	NA	NA	NA
AWN78252.1|2350069_2351041_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AWN78253.1|2351160_2352483_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
AWN81110.1|2352498_2353431_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AWN78254.1|2353509_2354265_+	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AWN78255.1|2354261_2355047_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AWN78256.1|2355292_2356303_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AWN78257.1|2356311_2356923_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AWN81111.1|2357061_2357127_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78258.1|2357197_2357800_+	hypothetical protein	NA	NA	NA	NA	NA
AWN78259.1|2357801_2358323_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AWN78260.1|2358357_2359098_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWN78261.1|2359126_2359579_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AWN78262.1|2359696_2361469_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AWN78263.1|2361778_2362345_+	hydrolase	NA	NA	NA	NA	NA
AWN78264.1|2362651_2362900_+	DNA damage-inducible protein DinI	NA	Q687E4	Enterobacteria_phage	95.1	3.5e-37
AWN78265.1|2363270_2364257_-	peptidase M85	NA	NA	NA	NA	NA
AWN78266.1|2364285_2364477_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78267.1|2364686_2364956_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	7.1e-44
AWN78268.1|2364957_2366280_-|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	91.4	7.7e-75
AWN78269.1|2366345_2366969_-	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	62.3	1.1e-68
AWN78270.1|2367037_2370733_-|tail	phage tail protein	tail	S5MW25	Escherichia_phage	80.7	0.0e+00
AWN78271.1|2370973_2371654_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.8	1.2e-108
AWN78272.1|2371551_2372295_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.0	2.9e-148
AWN78273.1|2372305_2373004_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
AWN78274.1|2373003_2373333_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
AWN78275.1|2373329_2375975_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	97.3	0.0e+00
AWN78276.1|2376018_2376327_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
AWN78277.1|2376353_2376776_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	100.0	5.1e-73
AWN78278.1|2376792_2377542_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	98.8	5.3e-137
AWN78279.1|2377549_2377948_-|tail	phage tail protein	tail	S5MW30	Escherichia_phage	96.2	7.2e-69
AWN78280.1|2377957_2378584_-|tail	phage tail protein	tail	S5MBY4	Escherichia_phage	100.0	7.8e-102
AWN78281.1|2378586_2378868_-	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	98.9	2.7e-46
AWN78282.1|2378860_2379187_-	DUF2190 domain-containing protein	NA	S5MQJ5	Escherichia_phage	100.0	6.1e-50
AWN81112.1|2379274_2381230_-	peptidase S14	NA	S5M7Q8	Escherichia_phage	99.4	0.0e+00
AWN78283.1|2381243_2382746_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
AWN78284.1|2382745_2382982_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	100.0	4.5e-34
AWN78285.1|2382954_2385078_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.9	0.0e+00
AWN78286.1|2385074_2385551_-	DUF1441 domain-containing protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
AWN78287.1|2386004_2386472_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	99.4	2.2e-77
AWN78288.1|2386770_2387304_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.4e-99
AWN81113.1|2387815_2388301_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78289.1|2388304_2388520_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AWN78290.1|2388597_2388843_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	82.7	8.5e-20
AWN78291.1|2388883_2389063_-	DUF1378 domain-containing protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
AWN78292.1|2389199_2391146_-	sialate O-acetylesterase	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
AWN78293.1|2391657_2391927_-	Shiga toxin Stx2 subunit B	NA	Q6DWN4	Enterobacteria_phage	98.9	1.3e-42
AWN78294.1|2391938_2392898_-	Shiga toxin Stx2 subunit A	NA	Q5TJL6	Enterobacteria_phage	99.7	2.1e-175
AWN78295.1|2393280_2394339_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.6	3.4e-206
AWN78296.1|2394489_2394687_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
AWN78297.1|2394902_2395283_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
AWN78298.1|2395301_2396291_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	4.7e-194
AWN78299.1|2396343_2396601_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
AWN78300.1|2396597_2397998_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.2	4.9e-245
AWN78301.1|2397994_2398885_-	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	63.3	9.8e-82
AWN78302.1|2398904_2399798_-	DNA-binding protein	NA	C5IHL2	Burkholderia_virus	45.1	4.4e-58
AWN78303.1|2399784_2400018_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	48.6	1.9e-13
AWN78304.1|2400623_2401331_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	79.9	1.2e-103
AWN78305.1|2401412_2401646_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
AWN78306.1|2401802_2402492_+	hypothetical protein	NA	A0A1B5FPF4	Escherichia_phage	88.2	3.0e-115
AWN78307.1|2402639_2403332_+	transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	63.6	1.4e-38
AWN78308.1|2403337_2403538_+	hypothetical protein	NA	NA	NA	NA	NA
AWN78309.1|2403735_2403918_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	3.8e-09
AWN78310.1|2403923_2404496_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
AWN78311.1|2404680_2404869_+	hypothetical protein	NA	NA	NA	NA	NA
AWN78312.1|2404865_2405693_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	97.1	1.3e-128
AWN78313.1|2405733_2406105_+	hypothetical protein	NA	Q8W655	Enterobacteria_phage	95.9	1.4e-61
AWN78314.1|2406296_2406551_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
AWN78315.1|2406584_2407871_+	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	99.8	6.9e-254
AWN81114.1|2407887_2408652_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.6e-72
AWN78316.1|2408704_2409100_+	hypothetical protein	NA	NA	NA	NA	NA
AWN78317.1|2409140_2409884_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
AWN78318.1|2409880_2410852_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AWN78319.1|2411016_2413446_-	trimethylamine-N-oxide reductase TorA	NA	NA	NA	NA	NA
AWN78320.1|2413470_2414571_-	cytochrome C	NA	NA	NA	NA	NA
AWN78321.1|2414958_2415705_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AWN78322.1|2415718_2416285_-	VOC family protein	NA	NA	NA	NA	NA
AWN78323.1|2416500_2418234_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 10
CP028379	Escherichia coli O145 str. RM9872 chromosome, complete genome	5385924	2489989	2587182	5385924	transposase,tail,holin,portal,plate,integrase,terminase,head,capsid	Enterobacteria_phage(32.2%)	110	2550964:2551023	2585927:2587236
AWN78385.1|2489989_2490268_+|integrase	integrase	integrase	A0A286S1S8	Klebsiella_phage	46.8	3.6e-06
AWN78386.1|2490187_2490502_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AWN78387.1|2490716_2492375_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
AWN78388.1|2492367_2493363_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AWN78389.1|2493355_2494042_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AWN78390.1|2494041_2495382_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
AWN78391.1|2495433_2495877_+	flagellar protein FliJ	NA	NA	NA	NA	NA
AWN78392.1|2495873_2497001_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
AWN78393.1|2497105_2497570_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AWN78394.1|2497574_2498579_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AWN78395.1|2498575_2498989_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AWN78396.1|2498991_2499357_+	flagellar protein FliO	NA	NA	NA	NA	NA
AWN78397.1|2499356_2500094_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AWN78398.1|2500103_2500373_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AWN78399.1|2500380_2501166_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
AWN78400.1|2501455_2502079_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
AWN78401.1|2502122_2502365_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78402.1|2502297_2502486_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78403.1|2502473_2502701_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AWN78404.1|2502998_2503814_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AWN78405.1|2503810_2505505_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.8	1.7e-18
AWN78406.1|2505425_2505614_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78407.1|2505675_2505858_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AWN78408.1|2505936_2506854_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78409.1|2507026_2507947_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AWN78410.1|2507935_2508406_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
AWN78411.1|2508386_2509805_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.9	4.0e-101
AWN78412.1|2509871_2510567_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	8.1e-07
AWN78413.1|2510606_2510972_-	permease	NA	NA	NA	NA	NA
AWN78414.1|2511537_2512611_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.1	1.2e-97
AWN78415.1|2512819_2513023_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78416.1|2513202_2514054_+	Molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
AWN78417.1|2514161_2515520_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
AWN81117.1|2515519_2516191_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	1.2e-31
AWN78418.1|2516323_2516737_+	5-hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AWN78419.1|2516845_2517850_+	sulfoxide reductase	NA	NA	NA	NA	NA
AWN78420.1|2517850_2518486_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AWN78421.1|2518742_2519393_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AWN78422.1|2519735_2520266_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	98.1	7.2e-56
AWN78423.1|2521610_2522180_-	type III effector	NA	NA	NA	NA	NA
AWN78424.1|2523309_2523441_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
AWN78425.1|2523463_2523727_-	T3SS effector NleC domain protein	NA	NA	NA	NA	NA
AWN78426.1|2523787_2524768_-	type III secretion system effector NleB	NA	Q8HAB2	Salmonella_phage	49.2	9.4e-86
AWN78427.1|2524944_2525214_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	5.4e-44
AWN78428.1|2525215_2526529_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
AWN81118.1|2526593_2527217_-	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
AWN78429.1|2527285_2530762_-|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	96.3	0.0e+00
AWN78430.1|2530895_2531423_+	superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
AWN78431.1|2531453_2531660_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78432.1|2531613_2532294_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.9	2.4e-112
AWN78433.1|2532191_2532935_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.0	5.9e-149
AWN78434.1|2532940_2533639_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
AWN78435.1|2533638_2533968_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	94.5	2.2e-55
AWN78436.1|2533964_2536544_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.8	0.0e+00
AWN78437.1|2536524_2536938_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
AWN78438.1|2536964_2537396_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
AWN78439.1|2537409_2538162_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
AWN78440.1|2538169_2538565_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
AWN78441.1|2538561_2539095_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
AWN78442.1|2539110_2539464_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	8.7e-42
AWN78443.1|2539456_2539879_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78444.1|2539882_2540911_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
AWN78445.1|2540968_2541316_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
AWN78446.1|2541352_2542858_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	1.0e-99
AWN78447.1|2542847_2544440_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
AWN78448.1|2544436_2544643_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AWN78449.1|2544626_2546555_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	2.7e-262
AWN78450.1|2546526_2547036_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AWN78451.1|2547437_2547662_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
AWN78452.1|2547743_2548058_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWN78453.1|2548300_2548441_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78454.1|2549141_2549357_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78455.1|2549479_2550013_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	94.9	2.6e-98
AWN78456.1|2550063_2550408_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
AWN81119.1|2550412_2550628_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
2550964:2551023	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
AWN78457.1|2551005_2552219_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
AWN78458.1|2552244_2554080_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.0	0.0e+00
AWN78459.1|2554128_2554257_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78460.1|2554558_2554990_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
AWN78461.1|2555440_2556154_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWN78462.1|2556288_2556486_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
AWN78463.1|2556710_2557265_-	antiterminator	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
AWN78464.1|2557273_2557633_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
AWN78465.1|2557645_2558695_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
AWN78466.1|2558696_2558969_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
AWN78467.1|2559090_2559435_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
AWN78468.1|2559554_2559767_-	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
AWN78469.1|2560000_2560558_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
AWN78470.1|2560559_2560778_-	sugar acetyltransferase inhibitor	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
AWN78471.1|2560905_2561217_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
AWN78472.1|2561209_2561437_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
AWN81120.1|2561433_2561715_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	3.9e-29
AWN78473.1|2561747_2562464_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
AWN78474.1|2563187_2564401_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	7.1e-168
AWN78475.1|2565660_2565864_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AWN78476.1|2565863_2566889_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
AWN81121.1|2567124_2567922_+	protein MtfA	NA	NA	NA	NA	NA
AWN78477.1|2568259_2569522_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.3	3.8e-71
AWN78478.1|2570147_2570351_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78479.1|2571977_2572187_+	hypothetical protein	NA	NA	NA	NA	NA
AWN78480.1|2572513_2572786_-	addiction module antidote protein, HigA family	NA	NA	NA	NA	NA
AWN78481.1|2572936_2573191_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	56.7	1.0e-12
AWN78482.1|2573187_2573649_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78483.1|2573984_2575046_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AWN78484.1|2575009_2576869_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AWN78485.1|2577173_2579288_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	23.1	2.2e-23
AWN78486.1|2579292_2579712_+	hypothetical protein	NA	NA	NA	NA	NA
AWN78487.1|2579683_2580952_+	hypothetical protein	NA	NA	NA	NA	NA
AWN78488.1|2581030_2581312_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
AWN81122.1|2585968_2587182_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
2585927:2587236	attR	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCCGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGAGTATGGCCCAGCCTTTCCAGCAATCGTCGATTGTTATACCAGTCCACCCACGTGAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCCGCCATCGCGTTGTCATACGAGTCGCCTGTACTTCCTGTTGATGCCAGTAATCCGGCTTCCTTAAGCCGCTGTGTGTAGGCCAGCGATACATACTGAGAACCTTTATCACTGTGATGGACCGTGCCGGACGGTCGACGGGCCCATAACGCCTGCTCCAGTGCATCCAGCACGAATGTCGTCTCCATGGACGATGAGACCCGCCACCCCACAATGTATCCGGCAAACACATCAATGATGAACGCCACATAGACGAAGCCCTGCCATGTGCTGACGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGTCGTTCTGCCACGAACTGACGGTTTACGCGGTCGCCTGCGGCAACGGCTTTCCGGCTGATGGTCGTACGGACCTTTTTACCCCGGAGAACACCGGCAAGTCCCATAACCGCCATGAGACGTGCCACAGTGCATCTGGCCACTCTGATACCTTCCCGTAACAACTGACGCCAGACTTTACGCACACCGTATACCTTGTGATTTTCATCGTATACGCGCTGTATCTCTTTCTTCAGCCAGTCATCGCGCTGCGCACGGGCACTGCGTTTATCCGGATGATGTCGCTGTTGCTGACAGTGGTAATACGTTGACGGGGCAATATGCAGTTCGCTGCATAGCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCATTTTTTCCAGAGGCGGTCGAACTCCGCCTTCGCAAAATAAGCGGAAGCCTGGCGAAGGATATCGTTACTGCGGCGCAGTTCACGATTTTCACGCTCCAGCTCTTTCAGACGCTGACGTTCAGCGGTGGTGAGCCCTCCATCACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAGAGTCTCCGGCGTACAGCCAATCTTTGGAGCAATGGAACAAATTGTCGCCCATTGTGAGTCATATTCGCCCTGACTTTCCAGAACCATACGGACTGCCCGTTGACGGACTTCAGGGGAAAAACGAGTATTTTTAGTCATCCTGTTTACCTCTTTCTCAGGAAGTTTAGTCTCCAGGATTCCCGGGGCGGTTCA	NA	NA	NA	NA
>prophage 11
CP028379	Escherichia coli O145 str. RM9872 chromosome, complete genome	5385924	2739933	2827632	5385924	transposase,tail,holin,lysis,terminase,head,capsid,tRNA	Enterobacteria_phage(40.0%)	85	NA	NA
AWN78619.1|2739933_2741967_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
AWN78620.1|2742212_2743425_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	2.5e-168
AWN78621.1|2743391_2743538_+	PapI protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.9e-06
AWN78622.1|2744356_2747215_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
AWN78623.1|2747224_2750857_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
AWN78624.1|2750917_2751235_+	hypothetical protein	NA	NA	NA	NA	NA
AWN78625.1|2751541_2752630_+	MoxR family ATPase	NA	NA	NA	NA	NA
AWN78626.1|2752640_2754920_+	hypothetical protein	NA	NA	NA	NA	NA
AWN78627.1|2754912_2756049_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
AWN78628.1|2756045_2758046_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
AWN78629.1|2758170_2758632_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AWN78630.1|2758671_2759142_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AWN78631.1|2759188_2759908_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWN78632.1|2759904_2761590_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWN78633.1|2762104_2762353_+	damage-inducible protein DinI	NA	H6WZN4	Escherichia_phage	100.0	2.4e-38
AWN78634.1|2763496_2764709_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	2.5e-168
AWN78635.1|2764869_2765079_+	avirulence protein	NA	Q6H9S1	Enterobacteria_phage	100.0	1.7e-32
AWN78636.1|2765273_2765462_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78637.1|2765730_2766972_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	84.7	3.2e-216
AWN78638.1|2767269_2767674_-	type III effector	NA	A5LH48	Enterobacteria_phage	96.3	1.3e-68
AWN78639.1|2767964_2768213_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	93.9	5.4e-38
AWN78640.1|2768234_2769548_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
AWN78641.1|2769612_2770212_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	6.3e-109
AWN78642.1|2770279_2773759_-|tail	phage tail protein	tail	A0A0P0ZBW1	Stx2-converting_phage	88.5	0.0e+00
AWN78643.1|2773999_2774677_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	96.4	6.9e-112
AWN78644.1|2774574_2775318_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	3.6e-146
AWN78645.1|2775328_2776027_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.8e-131
AWN78646.1|2776026_2776368_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
AWN78647.1|2776360_2779603_-|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	99.6	0.0e+00
AWN78648.1|2779654_2779936_-|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AWN78649.1|2779959_2780334_-|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
AWN78650.1|2780339_2781056_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	1.2e-125
AWN78651.1|2781123_2781468_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
AWN78652.1|2781464_2781911_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWN78653.1|2781907_2782258_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
AWN78654.1|2782268_2782595_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AWN78655.1|2785283_2785505_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	95.9	3.2e-34
AWN78656.1|2785549_2787487_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.1	0.0e+00
AWN78657.1|2787550_2789212_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.3	0.0e+00
AWN78658.1|2789208_2789772_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	99.5	5.2e-89
AWN78659.1|2790060_2790426_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
AWN78660.1|2790467_2790668_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
AWN78661.1|2790799_2791126_-	hypothetical protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
AWN78662.1|2791061_2791313_-	hypothetical protein	NA	H6WZK4	Escherichia_phage	95.7	3.2e-30
AWN81138.1|2791234_2791435_-	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	76.9	5.0e-10
AWN81137.1|2791464_2791932_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	94.2	2.0e-73
AWN78663.1|2792160_2792856_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	98.7	3.6e-124
AWN78664.1|2793129_2793663_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	6.2e-100
AWN78665.1|2793713_2794058_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
AWN78666.1|2794062_2794278_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
AWN78667.1|2794276_2794423_+	hypothetical protein	NA	NA	NA	NA	NA
AWN78668.1|2794562_2796413_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	95.6	0.0e+00
AWN78669.1|2796441_2796612_-	hypothetical protein	NA	NA	NA	NA	NA
AWN78670.1|2796899_2797331_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
AWN78671.1|2797520_2797709_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	66.7	7.9e-18
AWN78672.1|2797782_2798995_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
AWN78673.1|2799538_2799646_+	hypothetical protein	NA	NA	NA	NA	NA
AWN78674.1|2799626_2800358_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AWN78675.1|2800362_2801289_-	ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	7.4e-24
AWN78676.1|2801281_2802439_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AWN78677.1|2802445_2803363_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWN78678.1|2803573_2805871_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
AWN78679.1|2806066_2807782_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
AWN78680.1|2807819_2808752_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AWN78681.1|2808925_2809513_-	YIP1 family protein	NA	NA	NA	NA	NA
AWN78682.1|2809682_2810261_+	DedA family protein	NA	NA	NA	NA	NA
AWN78683.1|2810390_2811152_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AWN78684.1|2811204_2812641_-	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
AWN78685.1|2812864_2812948_+	hypothetical protein	NA	NA	NA	NA	NA
AWN81139.1|2813320_2814268_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
AWN78686.1|2814506_2814905_+	hypothetical protein	NA	NA	NA	NA	NA
AWN78687.1|2814901_2815597_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
AWN78688.1|2815726_2816611_+	cytidine deaminase	NA	NA	NA	NA	NA
AWN78689.1|2816760_2817480_+	protein SanA	NA	NA	NA	NA	NA
AWN78690.1|2817482_2817722_+	DUF2542 domain-containing protein	NA	NA	NA	NA	NA
AWN78691.1|2817915_2819154_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWN78692.1|2819147_2820383_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
AWN78693.1|2820625_2821636_-	galactoside ABC transporter permease	NA	NA	NA	NA	NA
AWN78694.1|2821651_2823172_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
AWN78695.1|2823232_2824231_-	galactose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWN78696.1|2824510_2825551_-	transcriptional regulator	NA	NA	NA	NA	NA
AWN81140.1|2825540_2825744_+	hypothetical protein	NA	NA	NA	NA	NA
AWN78697.1|2825692_2826850_-	DUF418 family protein	NA	NA	NA	NA	NA
AWN78698.1|2826866_2827535_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
AWN78699.1|2827518_2827632_-|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
>prophage 12
CP028379	Escherichia coli O145 str. RM9872 chromosome, complete genome	5385924	3313002	3323918	5385924	tail	Stx2-converting_phage(50.0%)	10	NA	NA
AWN79118.1|3313002_3313485_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AWN79119.1|3314333_3314582_+	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
AWN81156.1|3315454_3315826_+	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	99.2	1.7e-67
AWN79120.1|3316050_3316926_-	secretion protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	97.6	2.8e-158
AWN79121.1|3317066_3317336_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
AWN79122.1|3317337_3318651_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.6	1.8e-76
AWN79123.1|3318715_3319315_-	Ail/Lom family protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
AWN79124.1|3319381_3320863_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.0	4.8e-267
AWN79125.1|3322605_3323283_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	96.4	1.5e-111
AWN79126.1|3323180_3323918_-|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
>prophage 13
CP028379	Escherichia coli O145 str. RM9872 chromosome, complete genome	5385924	3618473	3629062	5385924		Enterobacteria_phage(88.89%)	13	NA	NA
AWN79369.1|3618473_3620807_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
AWN79370.1|3620821_3621142_-	hypothetical protein	NA	NA	NA	NA	NA
AWN79371.1|3621277_3621733_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
AWN79372.1|3621725_3622013_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AWN79373.1|3622005_3622596_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	97.0	4.5e-67
AWN79374.1|3622592_3622859_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AWN79375.1|3622871_3623063_-	hypothetical protein	NA	NA	NA	NA	NA
AWN79376.1|3623410_3624145_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	99.2	2.7e-130
AWN79377.1|3624141_3624642_+	transactivation protein	NA	NA	NA	NA	NA
AWN79378.1|3624715_3625288_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	3.8e-95
AWN79379.1|3625598_3626021_-	hypothetical protein	NA	NA	NA	NA	NA
AWN79380.1|3626017_3627889_-	helicase	NA	A0A097BY72	Enterococcus_phage	21.7	5.3e-13
AWN79381.1|3627898_3629062_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	88.9	2.9e-203
>prophage 14
CP028379	Escherichia coli O145 str. RM9872 chromosome, complete genome	5385924	4411232	4421623	5385924		Enterobacteria_phage(100.0%)	11	NA	NA
AWN80136.1|4411232_4412408_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	93.0	1.3e-211
AWN80137.1|4412412_4413321_+	hypothetical protein	NA	NA	NA	NA	NA
AWN80138.1|4414800_4415373_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	3.8e-95
AWN80139.1|4415446_4415947_-	transactivation protein	NA	NA	NA	NA	NA
AWN80140.1|4415943_4416678_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	99.2	2.7e-130
AWN80141.1|4417228_4417495_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AWN80142.1|4417491_4418091_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	89.1	3.0e-58
AWN80143.1|4418083_4418371_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AWN80144.1|4418363_4418819_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
AWN80145.1|4418954_4419275_+	hypothetical protein	NA	NA	NA	NA	NA
AWN80146.1|4419289_4421623_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
>prophage 15
CP028379	Escherichia coli O145 str. RM9872 chromosome, complete genome	5385924	4691683	4757989	5385924	tail,holin,lysis,portal,plate,integrase,terminase,head,capsid,tRNA	Escherichia_phage(33.33%)	77	4724682:4724728	4758100:4758146
AWN80393.1|4691683_4692121_+|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AWN80394.1|4692117_4693107_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWN80395.1|4695380_4695482_+	hypothetical protein	NA	NA	NA	NA	NA
AWN80396.1|4695505_4695724_-	hypothetical protein	NA	NA	NA	NA	NA
AWN81203.1|4696013_4696226_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWN80397.1|4696466_4696685_+	hypothetical protein	NA	NA	NA	NA	NA
AWN80398.1|4696678_4696867_+	hypothetical protein	NA	NA	NA	NA	NA
AWN80399.1|4697014_4697944_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
AWN80400.1|4697940_4698576_-	formate dehydrogenase cytochrome b556(fdo) subunit	NA	NA	NA	NA	NA
AWN80401.1|4698572_4699475_-	formate dehydrogenase-O iron-sulfur subunit	NA	NA	NA	NA	NA
AWN80402.1|4699487_4702538_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
AWN80403.1|4702541_4702796_+	hypothetical protein	NA	NA	NA	NA	NA
AWN80404.1|4702731_4703565_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
AWN80405.1|4703717_4704773_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
AWN80406.1|4704822_4706571_-	HTH domain-containing protein	NA	NA	NA	NA	NA
AWN80407.1|4706570_4707641_-	peptidase	NA	NA	NA	NA	NA
AWN80408.1|4707630_4709082_-	fructose-like PTS system EIIBC component	NA	NA	NA	NA	NA
AWN80409.1|4709092_4709539_-	fructose-like phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AWN80410.1|4710016_4711411_+	porin	NA	NA	NA	NA	NA
AWN80411.1|4711451_4711766_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
AWN80412.1|4711775_4712600_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
AWN80413.1|4713050_4714310_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
AWN80414.1|4714306_4715776_-	rhamnulokinase	NA	NA	NA	NA	NA
AWN80415.1|4716063_4716900_+	transcriptional activator RhaS	NA	NA	NA	NA	NA
AWN80416.1|4716883_4717822_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
AWN80417.1|4717818_4718853_-	rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
AWN80418.1|4719137_4719758_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
AWN80419.1|4719932_4720040_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AWN80420.1|4720017_4721001_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AWN80421.1|4721149_4721824_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AWN80422.1|4721939_4723313_-	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.2	3.8e-16
AWN80423.1|4723309_4724008_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AWN81204.1|4724157_4724658_+	periplasmic protein CpxP	NA	NA	NA	NA	NA
4724682:4724728	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
AWN80424.1|4724843_4725824_-|integrase	integrase	integrase	U5N0A8	Enterobacteria_phage	100.0	4.7e-186
AWN80425.1|4725893_4726187_-	transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
AWN80426.1|4726339_4726612_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
AWN81205.1|4726781_4727282_+	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AWN80427.1|4727345_4727570_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AWN80428.1|4727569_4727869_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
AWN80429.1|4727871_4728096_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AWN80430.1|4728092_4728368_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	98.9	8.6e-45
AWN80431.1|4728357_4730664_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.4	0.0e+00
AWN80432.1|4730642_4731095_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.0	3.0e-79
AWN80433.1|4731094_4731328_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	82.0	3.0e-22
AWN80434.1|4731579_4732518_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	97.8	7.2e-184
AWN80435.1|4732518_4733511_-	hypothetical protein	NA	NA	NA	NA	NA
AWN80436.1|4733497_4734616_-	chromosome partitioning protein ParB	NA	Q858T2	Yersinia_virus	99.7	5.8e-172
AWN80437.1|4734991_4736026_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	9.3e-201
AWN80438.1|4736025_4737798_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
AWN80439.1|4737971_4738826_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.8	3.4e-140
AWN80440.1|4738884_4739958_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	1.5e-201
AWN80441.1|4739961_4740705_+|terminase	terminase	terminase	Q858W5	Yersinia_virus	97.2	1.9e-123
AWN80442.1|4740804_4741314_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AWN80443.1|4741313_4741517_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AWN80444.1|4741520_4741802_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
AWN80445.1|4741801_4742299_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AWN80446.1|4742313_4742739_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	96.5	2.5e-59
AWN80447.1|4742726_4743170_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.0	4.1e-65
AWN80448.1|4743123_4743297_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AWN80449.1|4743259_4743727_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	3.3e-81
AWN80450.1|4743719_4744172_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.7	9.1e-76
AWN80451.1|4744243_4745029_-	hypothetical protein	NA	NA	NA	NA	NA
AWN80452.1|4745112_4745748_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
AWN80453.1|4745744_4746092_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
AWN80454.1|4746096_4747005_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	4.8e-161
AWN80455.1|4746997_4747528_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	100.0	1.0e-102
AWN80456.1|4747538_4749203_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	69.4	4.5e-229
AWN80457.1|4749171_4749735_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	93.6	1.9e-86
AWN80458.1|4749986_4751054_-	hypothetical protein	NA	NA	NA	NA	NA
AWN80459.1|4751387_4752578_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	1.7e-222
AWN80460.1|4752590_4753109_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AWN80461.1|4753165_4753441_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AWN81206.1|4753473_4753593_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AWN80462.1|4753585_4756033_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.1	0.0e+00
AWN80463.1|4756047_4756527_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	4.3e-84
AWN80464.1|4756526_4757690_+	phage late control D family protein	NA	Q858U5	Yersinia_virus	98.7	2.0e-204
AWN80465.1|4757689_4757989_+	transcriptional regulator	NA	Q858U4	Yersinia_virus	98.0	5.4e-53
4758100:4758146	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
>prophage 16
CP028379	Escherichia coli O145 str. RM9872 chromosome, complete genome	5385924	5009090	5069896	5385924	tRNA,transposase	Enterobacteria_phage(33.33%)	55	NA	NA
AWN80679.1|5009090_5010304_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
AWN80680.1|5010341_5011664_+	melibiose:sodium transporter MelB	NA	NA	NA	NA	NA
AWN80681.1|5011618_5011798_-	hypothetical protein	NA	NA	NA	NA	NA
AWN80682.1|5011802_5012432_-	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
AWN80683.1|5012554_5014201_-	fumarate hydratase class I, anaerobic	NA	NA	NA	NA	NA
AWN80684.1|5014278_5015619_-	anaerobic C4-dicarboxylate transporter DcuB	NA	NA	NA	NA	NA
AWN80685.1|5016189_5016909_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
AWN80686.1|5016905_5018537_-	sensor histidine kinase	NA	NA	NA	NA	NA
AWN80687.1|5018717_5018948_+	4Fe-4S mono-cluster protein YjdI	NA	NA	NA	NA	NA
AWN80688.1|5018959_5019232_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWN80689.1|5019458_5019755_+	hypothetical protein	NA	NA	NA	NA	NA
AWN80690.1|5019782_5019956_+	DUF2566 domain-containing protein	NA	NA	NA	NA	NA
AWN80691.1|5020074_5021592_-|tRNA	lysine--tRNA ligase heat inducible	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
AWN80692.1|5021828_5023286_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.4	1.5e-47
AWN80693.1|5023344_5025492_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
AWN80694.1|5025571_5026906_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
AWN80695.1|5027135_5027381_+	hypothetical protein	NA	NA	NA	NA	NA
AWN80696.1|5027271_5028810_-	transcriptional regulator	NA	NA	NA	NA	NA
AWN80697.1|5029096_5029315_+	hypothetical protein	NA	NA	NA	NA	NA
AWN80698.1|5029475_5029676_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	92.9	8.8e-07
AWN80699.1|5029641_5030855_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
AWN80700.1|5031079_5033596_-	hypothetical protein	NA	NA	NA	NA	NA
AWN80701.1|5033716_5036836_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
AWN80702.1|5037163_5038036_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
AWN80703.1|5038362_5038587_-	hypothetical protein	NA	NA	NA	NA	NA
AWN80704.1|5039190_5040744_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AWN80705.1|5040843_5041029_-	hypothetical protein	NA	NA	NA	NA	NA
AWN81216.1|5040959_5041160_+	hypothetical protein	NA	NA	NA	NA	NA
AWN80706.1|5041065_5041683_-	hypothetical protein	NA	NA	NA	NA	NA
AWN80707.1|5041754_5042033_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AWN80708.1|5042399_5043613_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
AWN80709.1|5043973_5044123_+	hemolysin activation protein	NA	NA	NA	NA	NA
AWN81217.1|5044099_5044285_-	hypothetical protein	NA	NA	NA	NA	NA
AWN80710.1|5044537_5044738_-	hypothetical protein	NA	NA	NA	NA	NA
AWN80711.1|5044941_5045511_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AWN80712.1|5045763_5046171_+	hypothetical protein	NA	NA	NA	NA	NA
AWN80713.1|5046071_5046593_+	hypothetical protein	NA	NA	NA	NA	NA
AWN80714.1|5046906_5047101_-	hypothetical protein	NA	NA	NA	NA	NA
AWN80715.1|5047576_5047918_-	hypothetical protein	NA	NA	NA	NA	NA
AWN81218.1|5047980_5049138_-	hypothetical protein	NA	NA	NA	NA	NA
AWN80716.1|5049852_5051046_-	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
AWN80717.1|5051060_5051705_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
AWN80718.1|5051713_5052415_-	FAA hydrolase family protein	NA	NA	NA	NA	NA
AWN80719.1|5052430_5053459_-	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
AWN80720.1|5053470_5054829_-	MFS transporter	NA	NA	NA	NA	NA
AWN80721.1|5054955_5055864_+	transcriptional regulator	NA	NA	NA	NA	NA
AWN81220.1|5057050_5057380_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AWN81219.1|5057366_5057759_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AWN80722.1|5058813_5060026_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
AWN80723.1|5061077_5061752_-	T3SS effector protein NleE	NA	NA	NA	NA	NA
AWN80724.1|5061800_5062790_-	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	58.5	6.3e-98
AWN80725.1|5063396_5065046_-	enterotoxin	NA	NA	NA	NA	NA
AWN80726.1|5065126_5065321_+	hypothetical protein	NA	NA	NA	NA	NA
AWN80727.1|5066708_5068328_+|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
AWN80728.1|5068324_5069896_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	5.8e-295
>prophage 17
CP028379	Escherichia coli O145 str. RM9872 chromosome, complete genome	5385924	5321238	5353685	5385924	transposase,tail,portal,terminase,integrase	Enterobacteria_phage(71.43%)	31	5320440:5320454	5333370:5333384
5320440:5320454	attL	GCGATGGCGGAAATC	NA	NA	NA	NA
AWN80938.1|5321238_5322462_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.5	1.2e-234
AWN80939.1|5322562_5323015_+	hypothetical protein	NA	NA	NA	NA	NA
AWN80940.1|5323056_5323539_+	hypothetical protein	NA	NA	NA	NA	NA
AWN80941.1|5323634_5323829_-	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	98.4	5.8e-32
AWN81230.1|5323828_5324425_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	93.4	6.1e-112
AWN80942.1|5324494_5325707_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	2.5e-168
AWN80943.1|5325953_5328056_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.6	0.0e+00
AWN80944.1|5328052_5328265_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AWN80945.1|5328264_5329773_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
AWN80946.1|5329621_5331745_+	peptidase S14	NA	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
AWN80947.1|5331786_5332155_+	DUF2190 domain-containing protein	NA	K7PLV6	Enterobacteria_phage	98.1	3.7e-51
AWN80948.1|5332147_5332423_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AWN80949.1|5332434_5333013_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
AWN81232.1|5333009_5333411_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	98.5	5.4e-72
5333370:5333384	attR	GCGATGGCGGAAATC	NA	NA	NA	NA
AWN80950.1|5333421_5334165_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	100.0	1.6e-133
AWN81231.1|5334225_5334612_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	100.0	4.3e-66
AWN80951.1|5334620_5334950_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AWN80952.1|5334921_5337987_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	97.0	0.0e+00
AWN80953.1|5337986_5338316_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.5e-59
AWN80954.1|5339029_5339773_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.7e-149
AWN80955.1|5339670_5340318_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.5e-111
AWN80956.1|5340378_5343777_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
AWN80957.1|5343843_5344443_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	2.8e-109
AWN81233.1|5344507_5347861_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	37.3	2.1e-12
AWN80958.1|5347860_5348436_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	5.0e-103
AWN80959.1|5348533_5349124_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AWN80960.1|5349502_5349736_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
AWN80961.1|5350344_5350593_-	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
AWN80962.1|5350812_5352399_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
AWN80963.1|5352791_5353397_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
AWN80964.1|5353505_5353685_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
>prophage 1
CP028380	Escherichia coli O145 str. RM9872 plasmid pRM9872-1, complete sequence	89518	7322	81008	89518	integrase,protease,transposase	Stx2-converting_phage(46.15%)	67	41508:41522	86631:86645
AWN81242.1|7322_8861_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	1.9e-295
AWN81243.1|8910_9258_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AWN81244.1|9494_9860_+|transposase	transposase	transposase	NA	NA	NA	NA
AWN81245.1|9859_11047_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWN81246.1|11325_12894_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
AWN81247.1|12897_13245_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWN81248.1|13241_13916_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWN81249.1|15203_19106_+|protease	serine protease EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
AWN81250.1|19410_19593_+	hypothetical protein	NA	NA	NA	NA	NA
AWN81251.1|19909_20254_-	DUF1449 domain-containing protein	NA	NA	NA	NA	NA
AWN81252.1|20153_20360_-	hypothetical protein	NA	NA	NA	NA	NA
AWN81253.1|20321_21534_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	7.1e-168
AWN81254.1|22101_22422_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
AWN81255.1|22642_25363_-	relaxase NikB	NA	NA	NA	NA	NA
AWN81256.1|25374_25707_-	nikA protein	NA	NA	NA	NA	NA
AWN81257.1|25938_26274_+	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
AWN81307.1|26359_27208_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AWN81258.1|27786_28038_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWN81308.1|28068_28290_-	hypothetical protein	NA	NA	NA	NA	NA
AWN81259.1|28313_29204_-|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	53.8	4.4e-66
AWN81260.1|29268_29535_-	hypothetical protein	NA	NA	NA	NA	NA
AWN81261.1|29627_30062_-	post-segregation killing protein PndC	NA	NA	NA	NA	NA
AWN81262.1|30058_30274_-	hypothetical protein	NA	NA	NA	NA	NA
AWN81309.1|31751_32069_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
AWN81263.1|32345_33065_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AWN81264.1|33061_33544_-	recombinase	NA	NA	NA	NA	NA
AWN81265.1|33588_34023_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWN81310.1|34034_34253_-	hypothetical protein	NA	NA	NA	NA	NA
AWN81266.1|34252_34936_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.3e-28
AWN81311.1|35319_36222_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AWN81267.1|36494_37454_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
AWN81268.1|37453_37849_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AWN81269.1|38809_39199_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
AWN81270.1|39242_41453_-	Catalase-peroxidase 2	NA	NA	NA	NA	NA
41508:41522	attL	ATTGATGCAACAGGA	NA	NA	NA	NA
AWN81271.1|41561_41660_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.5e-07
AWN81272.1|41625_42839_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
AWN81273.1|43644_44622_+	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
AWN81274.1|44784_45012_+	hypothetical protein	NA	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
AWN81275.1|45065_45740_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWN81276.1|45736_46084_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWN81277.1|46087_47656_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
AWN81278.1|48168_48552_+	hypothetical protein	NA	NA	NA	NA	NA
AWN81279.1|48479_48845_+|transposase	transposase	transposase	NA	NA	NA	NA
AWN81280.1|48844_50032_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWN81281.1|54018_54495_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
AWN81282.1|57621_57852_+|transposase	transposase	transposase	NA	NA	NA	NA
AWN81283.1|68425_69457_-	replication initiation protein	NA	NA	NA	NA	NA
AWN81284.1|69444_69534_-	positive regulator for repZ translation	NA	NA	NA	NA	NA
AWN81285.1|69641_69872_-	hypothetical protein	NA	NA	NA	NA	NA
AWN81286.1|70165_70807_+	transcription termination factor NusG	NA	NA	NA	NA	NA
AWN81287.1|70947_71613_+	traC	NA	NA	NA	NA	NA
AWN81288.1|71576_71726_+	conjugal transfer protein TraC	NA	NA	NA	NA	NA
AWN81289.1|72272_73841_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
AWN81290.1|73844_74192_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWN81291.1|74188_74863_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWN81292.1|74916_75303_-	recombinase	NA	NA	NA	NA	NA
AWN81293.1|75430_76291_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
AWN81294.1|76331_76571_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.3e-06
AWN81295.1|76536_77750_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
AWN81296.1|77900_78446_+	hypothetical protein	NA	NA	NA	NA	NA
AWN81297.1|78607_79024_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AWN81298.1|79020_79251_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AWN81299.1|79228_79366_-	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
AWN81312.1|79338_79542_+	hypothetical protein	NA	NA	NA	NA	NA
AWN81300.1|79502_79697_-	hypothetical protein	NA	NA	NA	NA	NA
AWN81301.1|79810_80224_+	hypothetical protein	NA	NA	NA	NA	NA
AWN81302.1|80225_81008_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
86631:86645	attR	TCCTGTTGCATCAAT	NA	NA	NA	NA
