The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP023714	Rhodococcus ruber strain YC-YT1 chromosome, complete genome	5669852	122000	201355	5669852	transposase,integrase	Enterobacteria_phage(27.78%)	80	165996:166055	168660:168742
AXY49578.1|122000_122315_+|transposase	transposase	transposase	Q9ETV7	Enterobacteria_phage	37.6	1.0e-09
AXY49579.1|122311_123274_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	53.8	3.0e-60
AXY49580.1|123252_124989_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49581.1|125584_126373_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.3	5.7e-33
AXY49582.1|126369_127929_-|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.6	5.6e-16
AXY49583.1|128373_128559_-	cobyrinic acid a,c-diamide synthase	NA	NA	NA	NA	NA
AXY49584.1|129424_129667_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49585.1|130272_130455_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49586.1|130451_130856_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49587.1|130891_131188_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49588.1|131549_133052_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49589.1|133109_133550_+|transposase	transposase	transposase	NA	NA	NA	NA
AXY49590.1|133546_134560_+|transposase	transposase	transposase	NA	NA	NA	NA
AXY49591.1|134661_135576_+	alpha/beta hydrolase fold protein	NA	NA	NA	NA	NA
AXY49592.1|136117_136843_-	aldolase	NA	NA	NA	NA	NA
AXY49593.1|136949_138392_+	Rieske (2Fe-2S) iron-sulfur domain-containing protein	NA	NA	NA	NA	NA
AXY49594.1|138388_138979_+	3-phenylpropionate dioxygenase	NA	NA	NA	NA	NA
AXY49595.1|138975_139299_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49596.1|139295_139490_+	ferredoxin phthalate 3,4-dioxygenase ferredoxin subunit	NA	NA	NA	NA	NA
AXY49597.1|139502_140723_+	FAD-dependent pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AXY49598.1|140855_141563_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AXY49599.1|141588_142428_+	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	37.2	2.5e-50
AXY49600.1|142472_143048_-|transposase	transposase IS4 family protein	transposase	NA	NA	NA	NA
AXY49601.1|143482_143632_-	putative site-specific recombinase	NA	NA	NA	NA	NA
AXY49602.1|143826_144267_+|transposase	transposase	transposase	NA	NA	NA	NA
AXY49603.1|144263_145277_+|transposase	transposase	transposase	NA	NA	NA	NA
AXY49604.1|146024_146804_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	32.1	1.4e-23
AXY49605.1|146800_148351_-|transposase	transposase	transposase	NA	NA	NA	NA
AXY49606.1|148604_149354_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49607.1|149791_150580_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.3	5.7e-33
AXY49608.1|150576_152136_-|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.6	5.6e-16
AXY49609.1|153199_154030_+|transposase	transposase	transposase	NA	NA	NA	NA
AXY49610.1|154023_154437_-	putative LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AXY49611.1|156542_157199_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49612.1|157180_158002_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49613.1|158009_158450_+|transposase	transposase	transposase	NA	NA	NA	NA
AXY49614.1|158446_159460_+|transposase	transposase	transposase	NA	NA	NA	NA
AXY49615.1|159598_160408_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49616.1|160404_161871_+	UBA/THIF-type NAD/FAD binding protein	NA	NA	NA	NA	NA
AXY49617.1|161867_163157_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49618.1|163216_164617_+|transposase	putative transposase	transposase	A0A222ZN33	Mycobacterium_phage	43.4	4.2e-87
AXY49619.1|164793_165306_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49620.1|165338_165467_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49621.1|165746_166079_-|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	34.0	1.2e-08
165996:166055	attL	GATGTCGTCGACGACGATGAGTTCGGCGCGGGTGATGCGGGCGATGACTTTGCTCTGGGA	NA	NA	NA	NA
AXY49622.1|166240_167800_+|integrase	integrase	integrase	NA	NA	NA	NA
AXY49623.1|167796_168540_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	26.5	8.1e-13
AXY49624.1|168656_169193_-|transposase	transposase	transposase	NA	NA	NA	NA
168660:168742	attR	GATGTCGTCGACGACGATGAGTTCGGCGCGGGTGATGCGGGCGATGACTTTGCTCTGGGAGTCGTCCACGGCGGCGCGGGTCA	NA	NA	NA	NA
AXY49625.1|169192_170761_-|transposase	transposase	transposase	NA	NA	NA	NA
AXY49626.1|170932_174034_-	hypothetical protein	NA	Q8V6N5	Halorubrum_phage	31.7	7.3e-15
AXY49627.1|174367_175135_+	putative resolvase	NA	A0A219YB42	Aeromonas_phage	42.0	5.9e-27
AXY49628.1|175409_175991_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49629.1|176017_176182_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49630.1|176249_177866_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49631.1|177937_178708_-	putative insertion element ATP-binding protein	NA	NA	NA	NA	NA
AXY49632.1|178704_180264_-|transposase	transposase	transposase	K4I413	Acidithiobacillus_phage	31.8	1.6e-55
AXY49633.1|180597_180978_+	resolvase	NA	A0A1B0V7I5	Salmonella_phage	50.0	6.1e-25
AXY49634.1|181346_182546_-	3-oxoadipate enol-lactone hydrolase/4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AXY49635.1|182542_183787_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
AXY49636.1|183792_184362_-	protocatechuate 3,4-dioxygenase alpha subunit	NA	NA	NA	NA	NA
AXY49637.1|184358_185126_-	protocatechuate 3,4-dioxygenase beta subunit	NA	NA	NA	NA	NA
AXY49638.1|185196_185952_+	putative IclR family transcriptional regulator	NA	NA	NA	NA	NA
AXY49639.1|186610_187732_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49640.1|187776_188097_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49641.1|188623_189229_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49642.1|189369_190605_-	putative ferredoxin reductase	NA	NA	NA	NA	NA
AXY49643.1|190601_190799_-	putative 3Fe-4S ferredoxin	NA	NA	NA	NA	NA
AXY49644.1|190847_191153_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49645.1|191149_191761_-	putative benzene dioxygenase small subunit	NA	NA	NA	NA	NA
AXY49646.1|191763_193227_-	putative benzene dioxygenase large subunit	NA	NA	NA	NA	NA
AXY49647.1|193365_194127_-	putative aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.5	5.5e-49
AXY49648.1|194300_195443_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49649.1|195548_196205_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49650.1|196256_196631_-	ABC transporter permease	NA	NA	NA	NA	NA
AXY49651.1|197053_197500_-	transporter permease 1	NA	NA	NA	NA	NA
AXY49652.1|197844_198174_-	transporter ATPase	NA	NA	NA	NA	NA
AXY49653.1|198668_199526_-	ABC transporter, substrate binding protein	NA	NA	NA	NA	NA
AXY49654.1|199587_199716_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49655.1|200031_200457_-|transposase	transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	51.1	2.4e-30
AXY49656.1|200453_200573_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49657.1|200689_201355_-|transposase	transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	38.0	1.8e-24
>prophage 2
CP023714	Rhodococcus ruber strain YC-YT1 chromosome, complete genome	5669852	2198175	2241103	5669852	transposase,terminase,portal,protease,head,integrase	Microbacterium_phage(25.0%)	44	2223867:2223903	2244356:2244392
AXY51618.1|2198175_2198553_+|protease	ATP-dependent Clp protease ClpS	protease	NA	NA	NA	NA
AXY51619.1|2198608_2199187_+	hypothetical protein	NA	NA	NA	NA	NA
AXY51620.1|2199183_2200290_+	hypothetical protein	NA	NA	NA	NA	NA
AXY51621.1|2200295_2200448_-	hypothetical protein	NA	NA	NA	NA	NA
AXY51622.1|2200604_2201231_+	hypothetical protein	NA	NA	NA	NA	NA
AXY51623.1|2201361_2202117_+	hypothetical protein	NA	NA	NA	NA	NA
AXY51624.1|2202130_2202919_+	ribonuclease PH	NA	NA	NA	NA	NA
AXY51625.1|2202911_2203538_+	nucleoside-triphosphate diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	31.6	3.0e-08
AXY51626.1|2203679_2204066_-	membrane protein	NA	NA	NA	NA	NA
AXY51627.1|2204062_2204482_-	hypothetical protein	NA	NA	NA	NA	NA
AXY51628.1|2204730_2204898_+	hypothetical protein	NA	NA	NA	NA	NA
AXY51629.1|2205574_2214829_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
AXY51630.1|2214869_2215271_+	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AXY51631.1|2215282_2215999_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXY51632.1|2216167_2217043_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXY51633.1|2217215_2218565_+	hypothetical protein	NA	NA	NA	NA	NA
AXY51634.1|2218573_2219050_-	peroxiredoxin	NA	NA	NA	NA	NA
AXY51635.1|2219124_2219346_+	hypothetical protein	NA	NA	NA	NA	NA
AXY51636.1|2219581_2220349_+	membrane protein	NA	NA	NA	NA	NA
AXY51637.1|2220389_2221226_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AXY51638.1|2221481_2222654_+|transposase	transposase IS891	transposase	A0A1D8ETH9	Propionibacterium_phage	61.6	3.2e-125
AXY51639.1|2222684_2223500_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXY51640.1|2223716_2223908_+	hypothetical protein	NA	NA	NA	NA	NA
2223867:2223903	attL	CTGTGCGCCATCAGGGACTCGAACCCCGAACCCGCTG	NA	NA	NA	NA
AXY51641.1|2223983_2224799_+|integrase	integrase	integrase	A0A1B1SGM4	Mycobacterium_phage	48.7	1.0e-61
AXY51642.1|2224836_2225055_+	hypothetical protein	NA	NA	NA	NA	NA
AXY51643.1|2225061_2225550_-	hypothetical protein	NA	NA	NA	NA	NA
AXY51644.1|2225549_2226482_-	structural protein	NA	M9MUD6	Rhodococcus_phage	51.7	5.5e-27
AXY51645.1|2226495_2229375_-	hypothetical protein	NA	NA	NA	NA	NA
AXY51646.1|2229400_2232199_-	hypothetical protein	NA	NA	NA	NA	NA
AXY51647.1|2232202_2232496_-	hypothetical protein	NA	NA	NA	NA	NA
AXY51648.1|2232492_2232789_-	hypothetical protein	NA	A0A142KBV7	Gordonia_phage	50.6	2.3e-19
AXY51649.1|2232785_2233559_-	hypothetical protein	NA	A0A2H4J9K9	uncultured_Caudovirales_phage	82.0	1.2e-91
AXY51650.1|2233653_2233905_-	hypothetical protein	NA	NA	NA	NA	NA
AXY51651.1|2233909_2234302_-	hypothetical protein	NA	NA	NA	NA	NA
AXY51652.1|2234301_2234721_-	hypothetical protein	NA	A0A2R3ZZJ6	Microbacterium_phage	45.4	1.8e-22
AXY51653.1|2234723_2235137_-	hypothetical protein	NA	NA	NA	NA	NA
AXY51654.1|2235118_2235454_-	hypothetical protein	NA	NA	NA	NA	NA
AXY51655.1|2235456_2237040_-	hypothetical protein	NA	A0A2R4A075	Microbacterium_phage	35.3	2.9e-60
AXY51656.1|2237036_2237444_-|head,protease	phage prohead protease	head,protease	A0A160DHT4	Gordonia_phage	45.7	1.7e-20
AXY51657.1|2237440_2238622_-|portal	phage portal protein	portal	D2JLE6	Staphylococcus_phage	28.9	2.6e-05
AXY51658.1|2238670_2240155_-|terminase	phage terminase family protein	terminase	A0A2R4A0B0	Microbacterium_phage	33.9	4.6e-60
AXY51660.1|2240151_2240484_-	hypothetical protein	NA	NA	NA	NA	NA
AXY51659.1|2240476_2240602_+	hypothetical protein	NA	NA	NA	NA	NA
AXY51661.1|2240830_2241103_-	hypothetical protein	NA	A0A2D1GAC4	Mycobacterium_phage	43.5	3.7e-08
2244356:2244392	attR	CTGTGCGCCATCAGGGACTCGAACCCCGAACCCGCTG	NA	NA	NA	NA
>prophage 3
CP023714	Rhodococcus ruber strain YC-YT1 chromosome, complete genome	5669852	2845658	2853843	5669852		Mycobacterium_phage(33.33%)	9	NA	NA
AXY52258.1|2845658_2846456_+	iron ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	9.3e-07
AXY52259.1|2846470_2847724_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	45.4	4.3e-99
AXY52260.1|2847723_2848212_+	nitrogen fixation protein NifU	NA	A0A0K1LSF9	Mycobacterium_phage	44.4	2.4e-21
AXY52261.1|2848211_2848592_+	hypothetical protein	NA	NA	NA	NA	NA
AXY52262.1|2848675_2849101_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXY52263.1|2849145_2850120_-	DNA repair protein	NA	A0A249XRB2	Mycobacterium_phage	43.2	1.4e-52
AXY52264.1|2850172_2851297_-	lycopene cyclase	NA	NA	NA	NA	NA
AXY52265.1|2851300_2852032_-	3-ketoacyl-ACP reductase	NA	A0A0M4JSW6	Mollivirus	33.9	2.6e-08
AXY52266.1|2852214_2853843_+	ABC transporter	NA	A0A2K9L0W2	Tupanvirus	27.5	2.5e-38
>prophage 1
CP023712	Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence	159746	27507	31616	159746	integrase,protease	Gordonia_phage(66.67%)	7	26579:26592	32099:32112
26579:26592	attL	GGGGACGGTGCCCG	NA	NA	NA	NA
AXY49237.1|27507_28197_+|integrase	integrase catalytic subunit	integrase	A0A059NT83	Lactococcus_phage	28.6	2.9e-09
AXY49238.1|28219_28570_+	hypothetical protein	NA	A0A1B3AZF8	Gordonia_phage	60.6	2.7e-19
AXY49239.1|28566_29484_+	Mobile element protein	NA	A0A1B3AZE5	Gordonia_phage	56.1	6.1e-87
AXY49240.1|29607_29760_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49241.1|29864_30215_+	hypothetical protein	NA	A0A1B3AZF8	Gordonia_phage	60.6	2.7e-19
AXY49242.1|30211_31129_+	Mobile element protein	NA	A0A1B3AZE5	Gordonia_phage	56.1	6.1e-87
AXY49243.1|31181_31616_-|protease	ATP-binding protease	protease	A0A249XSS8	Mycobacterium_phage	45.8	4.1e-17
32099:32112	attR	CGGGCACCGTCCCC	NA	NA	NA	NA
>prophage 1
CP023713	Rhodococcus ruber strain YC-YT1 plasmid unnamed2, complete sequence	78337	3579	47099	78337	integrase,transposase	Acidithiobacillus_phage(36.36%)	55	8262:8321	12466:12627
AXY49378.1|3579_5130_-|transposase	transposase	transposase	NA	NA	NA	NA
AXY49379.1|5348_5471_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49380.1|5493_5853_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49381.1|5961_6705_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	34.7	1.0e-28
AXY49382.1|6701_8261_-|integrase	integrase	integrase	K4I413	Acidithiobacillus_phage	35.1	5.2e-70
8262:8321	attL	TGGGAACCGCTCCTTCCGCCAGGTGCCCGTTACACCCAGCGGGAGGAGCCTAAGAAGGTG	NA	NA	NA	NA
AXY49383.1|8318_8549_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49384.1|8922_9429_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49385.1|9669_10104_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49386.1|10165_10909_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	34.7	1.0e-28
AXY49387.1|10905_12465_-|integrase	integrase	integrase	K4I413	Acidithiobacillus_phage	35.1	5.2e-70
AXY49388.1|12522_12894_+	hypothetical protein	NA	NA	NA	NA	NA
12466:12627	attR	TGGGAACCGCTCCTTCCGCCAGGTGCCCGTTACACCCAGCGGGAGGAGCCTAAGAAGGTGGCTCTGAAGCCGAATAACGGTGGCTCCGACGGCGTCCAACGCGTCAAGCCGCCGCTGGCTCCCAGGCCCGATATGACTGGCCCTCAGAAGAGCGAATACTCA	NA	NA	NA	NA
AXY49389.1|12975_13119_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49390.1|13183_14908_-	DNA methylase N-4/N-6	NA	A0A0H3UZ66	Geobacillus_virus	29.1	5.8e-06
AXY49391.1|15004_15445_+|transposase	transposase	transposase	NA	NA	NA	NA
AXY49392.1|15441_16455_+|transposase	transposase	transposase	NA	NA	NA	NA
AXY49393.1|16467_17484_-	DNA methylase N-4/N-6	NA	A0A2R3ZYF2	Campylobacter_phage	30.1	1.4e-15
AXY49394.1|17498_20678_-	restriction endonuclease	NA	NA	NA	NA	NA
AXY49395.1|20984_21806_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49396.1|22119_22458_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49397.1|22659_22884_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49398.1|23067_23292_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49399.1|23438_25355_-	cell filamentation protein	NA	NA	NA	NA	NA
AXY49400.1|25351_25576_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49401.1|25641_26199_-	replicative DNA helicase	NA	NA	NA	NA	NA
AXY49402.1|26195_26468_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49403.1|26558_26723_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49404.1|26734_28204_-	putative transcriptional regulator	NA	A0A2P1N496	Mycobacterium_phage	29.5	2.6e-31
AXY49405.1|28352_28820_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49406.1|28824_29025_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49407.1|29269_29611_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49408.1|29607_30429_-	cobyrinic acid ac-diamide synthase	NA	V5UP47	Mycobacterium_phage	28.7	1.4e-18
AXY49409.1|30889_31285_-	hypothetical protein	NA	A0A2P1CGB9	Mycobacterium_phage	40.9	6.8e-19
AXY49410.1|31348_32290_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49411.1|32369_32585_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49412.1|32611_32803_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49413.1|32837_33146_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49414.1|33514_34378_-	Protein of unknown function DUF2637	NA	A0A0N9RS70	Mycobacterium_phage	40.0	2.5e-13
AXY49416.1|34544_34667_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49415.1|34649_34925_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49417.1|35009_35540_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49419.1|35629_35995_-|transposase	transposase IS6	transposase	NA	NA	NA	NA
AXY49418.1|35983_36592_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49420.1|37372_37498_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49421.1|37536_37698_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49422.1|38187_38379_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49423.1|38469_38727_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49424.1|38723_38996_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49425.1|39074_40214_-	hypothetical protein	NA	NA	NA	NA	NA
AXY49426.1|40302_41040_+	hypothetical protein	NA	NA	NA	NA	NA
AXY49427.1|41055_42057_-	Mobile element protein	NA	NA	NA	NA	NA
AXY49428.1|42238_43351_-	alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.7	2.3e-35
AXY49429.1|43565_43874_+|transposase	transposase	transposase	NA	NA	NA	NA
AXY49430.1|43883_45440_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AXY49431.1|45642_46635_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXY49433.1|46685_47099_-|transposase	transposase	transposase	NA	NA	NA	NA
