The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032359	Lactobacillus plantarum strain ZFM55 chromosome, complete genome	3268766	357377	425412	3268766	bacteriocin,protease,tRNA	Tupanvirus(22.22%)	67	NA	NA
AYA95617.1|357377_358046_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYA95618.1|358042_358216_-|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnK	bacteriocin	NA	NA	NA	NA
AYA95619.1|358246_358414_-|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnJ	bacteriocin	NA	NA	NA	NA
AYA95620.1|359275_359476_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYA95621.1|359603_359771_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AYA95622.1|359888_361088_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AYA95623.1|361118_361865_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYA95624.1|362218_362407_+	pirin	NA	NA	NA	NA	NA
AYA95625.1|362742_362889_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AYA95626.1|363079_364408_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
AYA95627.1|364408_365152_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYA95628.1|365270_366014_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYA95629.1|366318_367092_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYA95630.1|367190_367349_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
AYA95631.1|367373_367544_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
AYA95632.1|367810_369961_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
AYA95633.1|369976_371353_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AYA95634.1|372199_372868_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYA95635.1|372954_373635_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYA95636.1|373728_374415_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYA95637.1|374552_374756_+	hypothetical protein	NA	NA	NA	NA	NA
AYA95638.1|374850_377160_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AYA95639.1|377418_378195_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
AYA95640.1|378633_379650_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AYA95641.1|380057_380768_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYA95642.1|380840_382202_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AYA95643.1|382208_382397_+	hypothetical protein	NA	NA	NA	NA	NA
AYA95644.1|382386_382809_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
AYA98249.1|383031_384387_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AYA95645.1|384404_385841_+	glycosyl hydrolase family protein	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
AYA95646.1|385961_386858_+	ROK family protein	NA	NA	NA	NA	NA
AYA95647.1|387007_387754_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AYA95648.1|387866_388880_+|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
AYA95649.1|389333_390467_+	hypothetical protein	NA	NA	NA	NA	NA
AYA95650.1|390471_391266_+	hypothetical protein	NA	NA	NA	NA	NA
AYA95651.1|391434_392352_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
AYA95652.1|392397_393672_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
AYA95653.1|393664_394624_+	IpaB/EvcA family protein	NA	NA	NA	NA	NA
AYA95654.1|394645_395350_+	NAD-dependent protein deacetylase	NA	NA	NA	NA	NA
AYA95655.1|395349_396192_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
AYA95656.1|396788_397178_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AYA95657.1|397499_399551_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
AYA95658.1|399783_400968_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
AYA95659.1|401090_401867_+	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
AYA95660.1|401853_402417_+	ribonuclease M5	NA	NA	NA	NA	NA
AYA95661.1|402413_403304_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
AYA95662.1|403408_403660_+	hypothetical protein	NA	NA	NA	NA	NA
AYA95663.1|403792_404659_+	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AYA95664.1|404740_404923_-	hypothetical protein	NA	NA	NA	NA	NA
AYA95665.1|404968_405913_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYA95666.1|406179_406878_+	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
AYA95667.1|406864_407668_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AYA95668.1|408746_409289_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AYA95669.1|409303_409567_+	hypothetical protein	NA	NA	NA	NA	NA
AYA95670.1|410059_410896_+	pur operon repressor	NA	NA	NA	NA	NA
AYA95671.1|410964_412347_+	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
AYA95672.1|412582_413407_+	serine hydrolase	NA	NA	NA	NA	NA
AYA95673.1|413772_414753_+	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
AYA95674.1|415041_416064_+	YdcF family protein	NA	NA	NA	NA	NA
AYA95675.1|416146_417133_+	lipoprotein	NA	NA	NA	NA	NA
AYA95676.1|417302_418112_-	sugar-phosphatase	NA	NA	NA	NA	NA
AYA95677.1|418131_419484_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.3	2.3e-26
AYA95678.1|419498_420431_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
AYA95679.1|420793_421234_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
AYA95680.1|421278_421887_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
AYA95681.1|422059_423673_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
AYA95682.1|424140_425412_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.4	8.4e-95
>prophage 2
CP032359	Lactobacillus plantarum strain ZFM55 chromosome, complete genome	3268766	1007091	1015605	3268766		Synechococcus_phage(33.33%)	9	NA	NA
AYA96198.1|1007091_1007577_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
AYA96199.1|1007560_1008691_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AYA96200.1|1008693_1009425_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
AYA96201.1|1009426_1009681_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AYA96202.1|1009680_1010361_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYA96203.1|1010353_1012573_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	4.5e-144
AYA96204.1|1012557_1014012_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	1.9e-50
AYA96205.1|1014008_1015034_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	40.7	5.4e-60
AYA96206.1|1015026_1015605_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
>prophage 3
CP032359	Lactobacillus plantarum strain ZFM55 chromosome, complete genome	3268766	1200893	1306085	3268766	portal,tail,head,capsid,protease,terminase,holin,lysis,integrase	Lactobacillus_phage(51.32%)	134	1202230:1202289	1256510:1256581
AYA96369.1|1200893_1202162_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	42.2	8.2e-90
1202230:1202289	attL	AAGCGAGTGACGGGAATCGGACCCGCGACTACAGCTTGGAAGGCTGTCGTTTTACCACTA	NA	NA	NA	NA
AYA96370.1|1202343_1202520_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	53.4	9.1e-08
AYA96371.1|1202760_1203015_-	hypothetical protein	NA	NA	NA	NA	NA
AYA96372.1|1203024_1203816_-	hypothetical protein	NA	NA	NA	NA	NA
AYA96373.1|1203838_1204252_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	31.3	3.4e-05
AYA96374.1|1204263_1204632_-	XRE family transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	44.1	5.7e-20
AYA96375.1|1204781_1205018_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYA96376.1|1205010_1205205_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96377.1|1205268_1205784_+	transcriptional regulator	NA	D6PST4	Lactobacillus_phage	38.6	1.7e-25
AYA96378.1|1205796_1206042_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96379.1|1206099_1206270_+	hypothetical protein	NA	NA	NA	NA	NA
AYA98263.1|1206459_1206861_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96380.1|1206863_1207679_+	recombinase RecT	NA	A8ATY6	Listeria_phage	53.0	7.9e-62
AYA96381.1|1207698_1208460_+	hypothetical protein	NA	E9LUM4	Lactobacillus_phage	40.7	3.5e-48
AYA96382.1|1208539_1209445_+	DnaD domain protein	NA	NA	NA	NA	NA
AYA96383.1|1209458_1209959_+	hypothetical protein	NA	O03915	Lactobacillus_phage	88.6	5.0e-83
AYA96384.1|1209955_1210333_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96385.1|1210329_1210764_+	hypothetical protein	NA	A0A288TZS1	Enterococcus_phage	48.8	3.6e-29
AYA96386.1|1210763_1210994_+	hypothetical protein	NA	O03916	Lactobacillus_phage	61.8	3.5e-23
AYA96387.1|1210996_1211128_+	hypothetical protein	NA	O03917	Lactobacillus_phage	95.3	2.6e-15
AYA96388.1|1211127_1211235_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96389.1|1211453_1211765_+	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	89.3	3.6e-47
AYA96390.1|1212982_1213414_+	hypothetical protein	NA	K4I239	Lactobacillus_phage	60.0	2.1e-37
AYA96391.1|1213410_1213824_+	DUF1642 domain-containing protein	NA	E9LUP3	Lactobacillus_phage	58.7	1.3e-36
AYA96392.1|1213820_1213988_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	91.5	2.8e-14
AYA96393.1|1214115_1214577_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	6.9e-39
AYA96394.1|1214942_1215287_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96395.1|1215348_1215594_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96396.1|1215590_1215854_+	hypothetical protein	NA	A0A1S5RCN3	Lactobacillus_phage	69.8	2.4e-28
AYA96397.1|1216461_1217751_+|terminase	PBSX family phage terminase large subunit	terminase	G8FUZ2	Pediococcus_virus	79.9	8.3e-207
AYA98264.1|1217777_1219316_+|portal	phage portal protein	portal	G8FUZ1	Pediococcus_virus	66.0	1.7e-190
AYA96398.1|1219233_1220040_+	hypothetical protein	NA	G8FUZ0	Pediococcus_virus	66.4	6.5e-101
AYA96399.1|1220055_1220277_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96400.1|1220419_1221010_+	DUF4355 domain-containing protein	NA	Q597V6	Lactobacillus_virus	45.7	9.2e-20
AYA96401.1|1221029_1221890_+|capsid	phage capsid protein	capsid	K4I067	Lactobacillus_virus	89.9	1.9e-143
AYA98265.1|1221910_1222165_+	hypothetical protein	NA	G8FUY7	Pediococcus_virus	63.5	1.0e-15
AYA96402.1|1222224_1222563_+	DNA packaging protein	NA	K4I470	Lactobacillus_virus	78.6	3.3e-46
AYA96403.1|1222559_1222838_+	hypothetical protein	NA	G8FUY5	Pediococcus_virus	75.0	3.8e-32
AYA96404.1|1222830_1223205_+	hypothetical protein	NA	G8FUY4	Pediococcus_virus	62.9	4.0e-37
AYA96405.1|1223204_1223558_+	hypothetical protein	NA	K4I072	Lactobacillus_virus	70.9	9.6e-41
AYA96406.1|1223577_1224366_+|tail	phage major tail protein, TP901-1 family	tail	Q597U9	Lactobacillus_virus	92.1	7.8e-99
AYA96407.1|1224386_1224800_+	hypothetical protein	NA	A0A2K9VBY8	Lactobacillus_phage	59.9	6.2e-39
AYA96408.1|1224814_1225117_+	hypothetical protein	NA	A0A2P0ZL20	Lactobacillus_phage	53.6	6.6e-22
AYA96409.1|1225120_1228561_+|tail	phage tail tape measure protein	tail	A0A2P0ZL32	Lactobacillus_phage	53.6	8.6e-17
AYA96410.1|1228573_1229959_+	hypothetical protein	NA	A0A2P0ZL23	Lactobacillus_phage	50.7	1.2e-123
AYA96411.1|1232186_1234196_+	DUF2479 domain-containing protein	NA	A0A2P0ZKZ2	Lactobacillus_phage	73.4	2.5e-72
AYA96412.1|1234208_1234592_+	hypothetical protein	NA	A0A2P0ZLF7	Lactobacillus_phage	92.9	2.3e-64
AYA96413.1|1234594_1234789_+	hypothetical protein	NA	A0A2P0ZLG4	Lactobacillus_phage	92.2	4.2e-22
AYA96414.1|1234788_1235073_+|lysis	lysis protein	lysis	A0A2P0ZLE8	Lactobacillus_phage	94.7	6.6e-40
AYA96415.1|1235072_1236143_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P0ZLG2	Lactobacillus_phage	77.1	3.1e-98
AYA96416.1|1236330_1237245_-	glycosyl transferase	NA	NA	NA	NA	NA
AYA96417.1|1238036_1238228_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96418.1|1238632_1240627_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.3	7.2e-32
AYA96419.1|1240644_1242222_+	glycosyltransferase	NA	NA	NA	NA	NA
AYA96420.1|1242193_1243957_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	40.9	4.8e-96
AYA96421.1|1244593_1244725_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96422.1|1244896_1245040_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96423.1|1245070_1245202_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96424.1|1245234_1245366_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96425.1|1245562_1245706_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96426.1|1245737_1245869_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96427.1|1245947_1246079_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96428.1|1246108_1246240_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96429.1|1246393_1249120_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AYA96430.1|1249219_1251196_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96431.1|1251250_1251736_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYA96432.1|1251784_1252057_-	hypothetical protein	NA	NA	NA	NA	NA
AYA96433.1|1252081_1252315_-	hypothetical protein	NA	NA	NA	NA	NA
AYA96434.1|1252727_1252934_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96435.1|1253285_1254407_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.1	8.4e-46
AYA96436.1|1254584_1255448_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AYA96437.1|1255414_1256455_-	hypothetical protein	NA	NA	NA	NA	NA
AYA96438.1|1257190_1257472_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
1256510:1256581	attR	AAGCGAGTGACGGGAATCGGACCCGCGACTACAGCTTGGAAGGCTGTCGTTTTACCACTAAACTACACTCGC	NA	NA	NA	NA
AYA96439.1|1257502_1257862_-	hypothetical protein	NA	NA	NA	NA	NA
AYA96440.1|1257888_1258266_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
AYA96441.1|1259310_1260390_-	hypothetical protein	NA	NA	NA	NA	NA
AYA96442.1|1261074_1261794_-	hypothetical protein	NA	NA	NA	NA	NA
AYA96443.1|1261900_1262323_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	34.4	1.1e-11
AYA96444.1|1262337_1262841_-	XRE family transcriptional regulator	NA	S6C481	Thermus_phage	42.6	1.7e-22
AYA98266.1|1262986_1263241_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYA96445.1|1263297_1263612_-	hypothetical protein	NA	NA	NA	NA	NA
AYA96446.1|1263649_1263886_-	XRE family transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	30.7	8.5e-09
AYA96447.1|1264032_1264233_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYA96448.1|1264573_1264879_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
AYA96449.1|1264946_1265459_+	XRE family transcriptional regulator	NA	D6PST4	Lactobacillus_phage	39.4	2.0e-23
AYA96450.1|1265526_1265697_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96451.1|1265829_1266210_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96452.1|1266212_1267100_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	53.7	2.0e-63
AYA96453.1|1267023_1267884_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	48.9	1.3e-75
AYA96454.1|1267962_1268871_+	DnaD domain protein	NA	NA	NA	NA	NA
AYA96455.1|1268867_1269155_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96456.1|1269151_1269682_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96457.1|1269678_1270197_+	hypothetical protein	NA	O03915	Lactobacillus_phage	69.1	4.5e-55
AYA96458.1|1270193_1270574_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96459.1|1270658_1271150_+	methyltransferase domain-containing protein	NA	O03918	Lactobacillus_phage	93.1	2.5e-87
AYA96460.1|1271393_1271612_+	hypothetical protein	NA	A0A2P0ZLC3	Lactobacillus_phage	87.8	2.3e-13
AYA96461.1|1271604_1272030_+	hypothetical protein	NA	K4I239	Lactobacillus_phage	95.7	4.2e-75
AYA96462.1|1272032_1272413_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96463.1|1272409_1272856_+	hypothetical protein	NA	A0A2P0ZLB8	Lactobacillus_phage	39.4	9.7e-22
AYA96464.1|1272970_1273138_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	76.6	4.1e-10
AYA96465.1|1273264_1273726_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	56.3	9.0e-39
AYA96466.1|1273948_1274116_+	BC1881 family protein	NA	NA	NA	NA	NA
AYA96467.1|1274112_1274322_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
AYA96468.1|1274612_1275389_-	hypothetical protein	NA	NA	NA	NA	NA
AYA96469.1|1275956_1276484_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	75.7	4.5e-58
AYA96470.1|1276473_1277712_+|terminase	PBSX family phage terminase large subunit	terminase	M1PG09	Streptococcus_phage	61.3	1.9e-139
AYA96471.1|1277723_1279232_+|portal	phage portal protein	portal	V5US18	Oenococcus_phage	52.0	1.8e-136
AYA96472.1|1279161_1279458_+|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	40.2	1.1e-10
AYA96473.1|1279604_1281290_+|head	phage head morphogenesis protein	head	V5US81	Oenococcus_phage	58.0	6.5e-119
AYA96474.1|1281342_1281543_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96475.1|1281594_1281801_+	hypothetical protein	NA	NA	NA	NA	NA
AYA96476.1|1281973_1282651_+	DUF4355 domain-containing protein	NA	Q6SE80	Lactobacillus_prophage	32.1	6.0e-15
AYA96477.1|1282665_1283013_+	hypothetical protein	NA	V5UTH9	Oenococcus_phage	63.8	4.4e-30
AYA96478.1|1283032_1284055_+|capsid	minor capsid protein E	capsid	V5US24	Oenococcus_phage	62.5	3.7e-117
AYA96479.1|1284067_1284244_+	conjugal transfer protein	NA	NA	NA	NA	NA
AYA96480.1|1284255_1284588_+	hypothetical protein	NA	V9QJ97	Oenococcus_phage	45.3	1.8e-12
AYA96481.1|1284587_1284935_+	hypothetical protein	NA	V5US85	Oenococcus_phage	62.3	3.2e-36
AYA96482.1|1284936_1285488_+	HK97 gp10 family phage protein	NA	V5URV0	Oenococcus_phage	62.3	2.0e-64
AYA96483.1|1285487_1285853_+	hypothetical protein	NA	V5UQS4	Oenococcus_phage	53.4	3.0e-29
AYA98267.1|1285954_1286338_+|tail	phage tail protein	tail	V5USQ9	Oenococcus_phage	58.4	1.8e-37
AYA96484.1|1286437_1286836_+	hypothetical protein	NA	V9QJA0	Oenococcus_phage	74.8	3.0e-46
AYA98268.1|1286943_1287207_+	hypothetical protein	NA	V9QKH3	Oenococcus_phage	65.4	2.3e-23
AYA96485.1|1287222_1293054_+|tail	phage tail protein	tail	V5URV5	Oenococcus_phage	40.9	6.6e-227
AYA96486.1|1293067_1293430_+	hypothetical protein	NA	V5UQS8	Oenococcus_phage	70.3	3.3e-44
AYA96487.1|1293444_1298715_+	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	59.4	3.7e-144
AYA96488.1|1298721_1299171_+	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	40.5	6.1e-24
AYA96489.1|1299173_1299608_+	hypothetical protein	NA	NA	NA	NA	NA
AYA98269.1|1299786_1300902_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	64.2	1.7e-46
AYA96490.1|1300902_1301199_+	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	77.6	4.4e-39
AYA96491.1|1301185_1301569_+|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	85.4	2.9e-14
AYA96492.1|1302509_1302668_+	cytochrome D ubiquinol oxidase	NA	NA	NA	NA	NA
AYA96493.1|1302664_1303516_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AYA96494.1|1303738_1304131_+	YxeA family protein	NA	NA	NA	NA	NA
AYA96495.1|1304354_1306085_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	2.6e-46
>prophage 4
CP032359	Lactobacillus plantarum strain ZFM55 chromosome, complete genome	3268766	2136090	2148868	3268766		Lactobacillus_phage(70.0%)	13	NA	NA
AYA97267.1|2136090_2137035_-	glycosyltransferase	NA	V5USA4	Oenococcus_phage	45.5	2.0e-72
AYA97268.1|2137059_2137725_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AYA97269.1|2138434_2139127_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.6	5.3e-35
AYA97270.1|2139110_2140487_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	3.4e-25
AYA97271.1|2140644_2140782_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AYA97272.1|2140877_2141318_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	97.9	1.2e-75
AYA97273.1|2141388_2141949_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	98.4	6.5e-100
AYA97274.1|2142036_2144475_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.6	0.0e+00
AYA97275.1|2144477_2145092_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
AYA97276.1|2145144_2145474_+	hypothetical protein	NA	NA	NA	NA	NA
AYA97277.1|2145434_2146382_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
AYA97278.1|2146567_2147539_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	98.5	3.5e-181
AYA97279.1|2147629_2148868_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	98.7	2.4e-219
>prophage 5
CP032359	Lactobacillus plantarum strain ZFM55 chromosome, complete genome	3268766	2560612	2619864	3268766	transposase,integrase,protease,tRNA	Lactobacillus_phage(40.0%)	50	2575613:2575628	2631939:2631954
AYA97635.1|2560612_2561908_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.0	2.7e-56
AYA97636.1|2562077_2562707_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AYA97637.1|2562815_2563289_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYA97638.1|2563564_2565454_-	FAD-binding dehydrogenase	NA	A0A2P0ZL82	Lactobacillus_phage	26.2	5.2e-16
AYA97639.1|2565640_2566567_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.1	1.9e-19
AYA97640.1|2566637_2567189_-	helix-turn-helix domain-containing protein	NA	X2CXD8	Lactobacillus_phage	48.4	4.9e-07
AYA97641.1|2567288_2568041_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYA97642.1|2568109_2568604_-	hypothetical protein	NA	NA	NA	NA	NA
AYA97643.1|2568692_2568815_-	hypothetical protein	NA	NA	NA	NA	NA
AYA97644.1|2569020_2572794_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AYA97645.1|2572908_2573439_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AYA97646.1|2573742_2574315_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AYA97647.1|2574313_2574862_+	hypothetical protein	NA	NA	NA	NA	NA
AYA97648.1|2574872_2575790_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	45.0	2.7e-74
2575613:2575628	attL	TGAGCAATTGCTGATA	NA	NA	NA	NA
AYA97649.1|2575940_2577125_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	25.3	1.6e-15
AYA97650.1|2578344_2579144_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AYA97651.1|2579604_2582478_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
AYA97652.1|2582700_2585235_-	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.3	1.2e-68
AYA97653.1|2585416_2585989_-	alpha-L-rhamnosidase	NA	NA	NA	NA	NA
AYA97654.1|2586093_2586426_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AYA97655.1|2586787_2587798_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
AYA97656.1|2587929_2588760_-	FAA hydrolase family protein	NA	NA	NA	NA	NA
AYA97657.1|2588933_2589374_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AYA97658.1|2589434_2589857_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AYA97659.1|2589871_2590054_-	hypothetical protein	NA	NA	NA	NA	NA
AYA97660.1|2590066_2590612_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
AYA97661.1|2590623_2590878_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AYA97662.1|2591118_2592966_-	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.3	4.5e-20
AYA97663.1|2592955_2593339_-	hypothetical protein	NA	NA	NA	NA	NA
AYA97664.1|2593933_2594290_-	hypothetical protein	NA	NA	NA	NA	NA
AYA97665.1|2594356_2595424_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
AYA97666.1|2595423_2596014_-	hypothetical protein	NA	NA	NA	NA	NA
AYA97667.1|2596048_2598760_-	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
AYA97668.1|2598922_2599237_+	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	36.0	3.3e-08
AYA97669.1|2599368_2601873_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AYA97670.1|2602146_2603445_+	MFS transporter	NA	NA	NA	NA	NA
AYA97671.1|2603576_2603921_-	transcriptional regulator	NA	NA	NA	NA	NA
AYA97672.1|2604140_2604833_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYA97673.1|2605134_2608098_-	DNA helicase	NA	NA	NA	NA	NA
AYA97674.1|2608635_2609004_+	XRE family transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	42.7	5.9e-17
AYA97675.1|2609237_2609606_+	hypothetical protein	NA	NA	NA	NA	NA
AYA97676.1|2610082_2610676_-	abortive infection protein	NA	NA	NA	NA	NA
AYA97677.1|2610914_2612162_+|transposase	ISL3-like element ISP1 family transposase	transposase	NA	NA	NA	NA
AYA97678.1|2612112_2612328_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYA97679.1|2612492_2612834_+	XRE family transcriptional regulator	NA	A0A059T669	Listeria_phage	53.9	6.9e-20
AYA97680.1|2613267_2614419_+	DUF4428 domain-containing protein	NA	O48432	Lactobacillus_phage	26.3	4.2e-16
AYA97681.1|2614455_2615385_+	DUF4428 domain-containing protein	NA	O48432	Lactobacillus_phage	31.2	3.1e-22
AYA97682.1|2616624_2616810_+	hypothetical protein	NA	NA	NA	NA	NA
AYA97683.1|2616815_2617991_+|integrase	integrase	integrase	A0A1X9I5C3	Streptococcus_phage	30.5	2.6e-37
AYA97684.1|2618172_2619864_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	6.2e-93
2631939:2631954	attR	TATCAGCAATTGCTCA	NA	NA	NA	NA
>prophage 6
CP032359	Lactobacillus plantarum strain ZFM55 chromosome, complete genome	3268766	2825795	2834419	3268766		Streptococcus_phage(66.67%)	11	NA	NA
AYA97857.1|2825795_2826791_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.5	2.0e-51
AYA97858.1|2826929_2827715_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
AYA97859.1|2827718_2828615_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	4.4e-82
AYA97860.1|2828713_2829061_-	initiation-control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
AYA97861.1|2829085_2830105_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
AYA97862.1|2830121_2830451_-	hypothetical protein	NA	NA	NA	NA	NA
AYA97863.1|2830447_2831113_-	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
AYA97864.1|2831510_2831762_-	DUF2508 family protein	NA	NA	NA	NA	NA
AYA97865.1|2831776_2832376_-	recombination protein RecR	NA	NA	NA	NA	NA
AYA97866.1|2832391_2832700_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AYA97867.1|2832721_2834419_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.0e-55
>prophage 1
CP032361	Lactobacillus plantarum strain ZFM55 plasmid unnamed2, complete sequence	48575	27278	37367	48575	transposase	Enterococcus_phage(25.0%)	9	NA	NA
AYA98400.1|27278_29426_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.3	9.4e-256
AYA98384.1|29532_30459_+	ribonucleoside-diphosphate reductase	NA	A0A2H4P8A9	Corynebacterium_phage	32.1	5.9e-37
AYA98385.1|30473_31424_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	54.3	1.2e-98
AYA98386.1|31551_32364_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	29.5	6.3e-11
AYA98387.1|32477_33110_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	33.2	3.6e-14
AYA98388.1|33196_34099_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.3	6.3e-52
AYA98389.1|34206_34981_+|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
AYA98390.1|35352_36507_+	cation:proton antiporter	NA	NA	NA	NA	NA
AYA98391.1|36591_37367_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
