The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032384	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 chromosome, complete genome	4877387	53413	97376	4877387	protease,tail	Escherichia_phage(33.33%)	44	NA	NA
AYB09552.1|53413_54094_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.4	1.6e-84
AYB09553.1|54732_55392_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYB09554.1|55478_55808_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AYB09555.1|55804_56086_-	acylphosphatase	NA	NA	NA	NA	NA
AYB09556.1|56134_56914_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYB09557.1|56939_57488_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AYB09558.1|57702_58914_+	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AYB09559.1|58971_59289_+	heat-shock protein HspQ	NA	NA	NA	NA	NA
AYB09560.1|59333_59750_-	CoA-binding protein	NA	NA	NA	NA	NA
AYB09561.1|59920_60583_+	DUF2057 family protein	NA	NA	NA	NA	NA
AYB09562.1|60677_61136_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AYB09563.1|61171_63226_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYB09564.1|63349_63796_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AYB09565.1|63814_65968_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AYB09566.1|65954_66560_-	DNA transformation protein	NA	NA	NA	NA	NA
AYB09567.1|66776_67286_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AYB13936.1|67642_68695_+	outer membrane protein A	NA	NA	NA	NA	NA
AYB09568.1|68766_69219_-	macrodomain Ter protein	NA	NA	NA	NA	NA
AYB09569.1|69404_71165_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AYB09570.1|71233_71752_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AYB09571.1|71851_72019_-	ribosome modulation factor	NA	NA	NA	NA	NA
AYB09572.1|72274_72838_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AYB09573.1|72834_74475_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AYB09574.1|74479_75733_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
AYB09575.1|75747_77655_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
AYB09576.1|77667_79776_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AYB09577.1|79874_80984_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYB09578.1|80980_81523_-	cell division protein ZapC	NA	NA	NA	NA	NA
AYB09579.1|81688_82699_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AYB09580.1|82906_85519_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
AYB13937.1|85945_86137_+	DinI family protein	NA	S4TNM0	Salmonella_phage	93.7	1.8e-25
AYB09581.1|86407_87094_+	virulence protein	NA	NA	NA	NA	NA
AYB09582.1|87453_88080_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AYB09583.1|88727_89696_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.1	3.3e-192
AYB09584.1|89921_90170_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
AYB09585.1|90173_90755_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AYB09586.1|90754_92464_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
AYB09587.1|92460_93087_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
AYB09588.1|93070_94297_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	63.6	3.2e-147
AYB09589.1|94293_94626_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09590.1|94622_95339_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09591.1|95335_96388_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09592.1|96387_96663_-	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	33.3	1.6e-06
AYB09593.1|96878_97376_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	38.0	8.9e-24
>prophage 2
CP032384	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 chromosome, complete genome	4877387	104318	129952	4877387	holin,terminase	Salmonella_phage(72.41%)	32	NA	NA
AYB09601.1|104318_105350_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.2	2.5e-73
AYB09602.1|105367_106240_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09603.1|106260_107835_-	NUDIX hydrolase	NA	Q6UJ14	Burkholderia_virus	48.6	2.2e-20
AYB09604.1|107835_108711_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	45.5	1.5e-55
AYB09605.1|108682_110113_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.9	2.6e-92
AYB09606.1|110112_111384_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.3	1.1e-83
AYB09607.1|111373_112348_-|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	37.3	1.6e-29
AYB09608.1|112409_112823_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09609.1|112812_113364_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AYB09610.1|113360_113975_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.1	1.2e-107
AYB09611.1|113977_114325_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	1.3e-45
AYB09612.1|114723_115521_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	4.4e-150
AYB09613.1|115510_115657_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AYB09614.1|115653_116265_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
AYB09615.1|116267_116474_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AYB09616.1|116473_117076_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
AYB09617.1|117115_117421_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYB09618.1|117410_117650_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYB09619.1|117805_118072_-	hypothetical protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYB09620.1|118165_118738_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYB09621.1|118741_119215_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	4.7e-67
AYB09622.1|119214_119739_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYB09623.1|119735_120083_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYB09624.1|120093_120843_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYB09625.1|120845_121829_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
AYB09626.1|121913_122288_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYB09627.1|122253_122490_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
AYB09628.1|122619_123024_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYB09629.1|123733_126922_+	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	74.0	0.0e+00
AYB09630.1|128086_128326_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AYB09631.1|128366_128615_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYB09632.1|128659_129952_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.3e-252
>prophage 3
CP032384	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 chromosome, complete genome	4877387	200921	208234	4877387	protease,integrase	Ralstonia_phage(16.67%)	7	195977:195991	206970:206984
195977:195991	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYB09685.1|200921_201299_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
AYB09686.1|201460_201658_+	hypothetical protein	NA	NA	NA	NA	NA
AYB09687.1|201870_204147_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AYB09688.1|204177_204498_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYB09689.1|204821_205043_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYB09690.1|205172_207119_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.9	2.0e-39
206970:206984	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
AYB09691.1|207115_208234_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	8.1e-09
>prophage 4
CP032384	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 chromosome, complete genome	4877387	545677	591314	4877387	protease,coat,integrase,lysis,portal,terminase,tail,holin	Salmonella_phage(71.64%)	68	545344:545384	591332:591372
545344:545384	attL	GCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGA	NA	NA	NA	NA
AYB09986.1|545677_546040_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
AYB09987.1|546036_546963_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	96.7	1.4e-168
AYB09988.1|546943_548596_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	38.0	1.5e-83
AYB09989.1|550079_550442_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
AYB09990.1|550438_551371_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
AYB09991.1|551360_552818_+	hypothetical protein	NA	E7C9N7	Salmonella_phage	99.8	1.7e-240
AYB09992.1|552876_554880_-	endorhamnosidase	NA	E7C9U9	Salmonella_phage	99.9	0.0e+00
AYB09993.1|555015_555267_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
AYB13960.1|555366_555546_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
AYB09994.1|555559_555925_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
AYB09995.1|555955_556285_+	hypothetical protein	NA	NA	NA	NA	NA
AYB09996.1|556302_558216_-	DNA transfer protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
AYB09997.1|558215_559520_-	acyltransferase	NA	E7C9U5	Salmonella_phage	96.3	7.8e-213
AYB09998.1|559530_560220_-	DNA transfer protein	NA	E7C9U4	Salmonella_phage	99.6	1.2e-108
AYB09999.1|560222_560678_-	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
AYB10000.1|560677_561379_-|tail	phage tail protein	tail	B8K1I3	Salmonella_phage	98.3	8.8e-70
AYB10001.1|561382_562801_-	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.3	3.3e-273
AYB10002.1|562760_563261_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.8	5.5e-90
AYB10003.1|563244_563805_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	98.9	1.4e-102
AYB10004.1|563845_565138_-|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.8	1.1e-243
AYB10005.1|565137_566049_-	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	100.0	4.9e-161
AYB10006.1|566062_568240_-|portal	portal protein	portal	I6R968	Salmonella_phage	98.3	0.0e+00
AYB10007.1|568239_569739_-|terminase	terminase	terminase	A8CGE0	Salmonella_phage	99.8	6.9e-306
AYB10008.1|569716_570205_-	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
AYB10009.1|570208_570613_-	Decoration protein	NA	C6ZR73	Salmonella_phage	100.0	5.3e-67
AYB10010.1|570612_571002_-	hypothetical protein	NA	C6ZR72	Salmonella_phage	99.2	1.5e-74
AYB10011.1|571005_571248_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AYB10012.1|571506_572037_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	96.6	4.0e-91
AYB10013.1|571990_572215_-	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	90.3	7.2e-26
AYB10014.1|572249_572720_-|lysis	lysis protein	lysis	H6WRZ5	Salmonella_phage	87.2	1.2e-62
AYB10015.1|572716_573154_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
AYB10016.1|573137_573464_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
AYB10017.1|573599_573797_-	hypothetical protein	NA	C6ZR63	Salmonella_phage	96.2	5.0e-23
AYB10018.1|573843_574332_-	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
AYB10019.1|574401_574605_-	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	94.0	5.7e-30
AYB10020.1|574601_574997_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	96.9	2.9e-70
AYB10021.1|574993_575290_-	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	98.9	7.5e-47
AYB10022.1|575252_575429_-	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	96.6	1.8e-27
AYB10023.1|575425_575608_-	NinE family protein	NA	Q716C5	Shigella_phage	96.7	1.8e-27
AYB10024.1|575574_575748_-	protein ninD	NA	C6ZR56	Salmonella_phage	93.0	7.0e-29
AYB10025.1|575744_576617_-	hypothetical protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
AYB10026.1|576613_577072_-	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	98.6	3.0e-79
AYB10027.1|577127_578504_-	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	99.3	4.8e-253
AYB10028.1|579312_579459_-	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AYB10029.1|579493_579775_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
AYB10030.1|579885_580101_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
AYB10031.1|580211_580901_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
AYB10032.1|580989_581913_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	100.0	1.5e-181
AYB10033.1|581948_582158_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	5.5e-28
AYB10034.1|582521_582854_+	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	100.0	2.2e-55
AYB10035.1|582932_583133_+	restriction endonuclease	NA	A0A1R3Y5S4	Salmonella_virus	100.0	1.0e-31
AYB10036.1|583172_583472_+	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	99.0	3.3e-50
AYB10037.1|583795_583936_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	2.0e-18
AYB10038.1|583928_584042_+	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
AYB10039.1|584038_584227_+	hypothetical protein	NA	C6ZR38	Salmonella_phage	100.0	1.3e-28
AYB10040.1|584235_584943_+	recombinase	NA	E7C9Q0	Salmonella_phage	89.8	9.7e-125
AYB10041.1|584943_585450_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	98.8	3.8e-91
AYB10042.1|585458_586007_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
AYB10043.1|586022_586316_+	DUF2856 family protein	NA	A0A1V0E5L7	Salmonella_phage	100.0	5.5e-50
AYB10044.1|586326_586497_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AYB10045.1|586493_587075_+	Eae-like protein	NA	A0A0N6WGF1	Salmonella_phage	71.5	5.2e-68
AYB10046.1|587459_587753_+	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	99.0	4.2e-50
AYB10047.1|587749_588832_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.2	6.5e-80
AYB10048.1|588776_589106_+	ASCH domain-containing protein	NA	Q9XJG9	Enterobacteria_phage	94.2	1.0e-52
AYB10049.1|589187_589499_+	hypothetical protein	NA	A0A1I9LJL8	Stx_converting_phage	99.0	7.9e-55
AYB13961.1|589576_589921_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	97.4	1.1e-57
AYB10050.1|589923_590295_+	DNA-binding protein	NA	B9UDM0	Salmonella_phage	80.5	2.1e-46
AYB10051.1|590150_591314_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	97.1	1.0e-219
591332:591372	attR	GCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGA	NA	NA	NA	NA
>prophage 5
CP032384	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 chromosome, complete genome	4877387	3124537	3190310	4877387	transposase,capsid,plate,integrase,lysis,portal,head,tail,tRNA	Salmonella_phage(87.8%)	64	3127574:3127589	3140841:3140856
AYB12287.1|3124537_3125648_+|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
AYB12288.1|3126444_3127248_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
3127574:3127589	attL	TCAGCCAGCAGGCTTT	NA	NA	NA	NA
AYB12289.1|3127646_3128240_-	hypothetical protein	NA	NA	NA	NA	NA
AYB12290.1|3128499_3129525_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	99.1	9.2e-201
AYB12291.1|3129528_3130161_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.1e-66
AYB12292.1|3130277_3130517_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
AYB12293.1|3131070_3131304_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
AYB12294.1|3131251_3131710_-	hypothetical protein	NA	NA	NA	NA	NA
AYB12295.1|3131929_3132271_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
AYB12296.1|3132338_3132572_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
AYB12297.1|3132571_3132799_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
AYB12298.1|3132795_3133653_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	99.6	1.5e-164
AYB12299.1|3133649_3136046_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.9	0.0e+00
AYB12300.1|3136201_3136390_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
AYB12301.1|3136458_3136758_-	hypothetical protein	NA	NA	NA	NA	NA
AYB12302.1|3136868_3137675_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.8	6.2e-51
AYB12303.1|3138167_3139322_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYB12304.1|3140101_3141133_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.0	5.0e-170
3140841:3140856	attR	AAAGCCTGCTGGCTGA	NA	NA	NA	NA
AYB12305.1|3141132_3142899_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
AYB12306.1|3143041_3143875_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	84.5	5.9e-121
AYB12307.1|3143891_3144950_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	4.9e-181
AYB12308.1|3144953_3145604_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYB12309.1|3145699_3146164_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
AYB12310.1|3146163_3146367_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYB12311.1|3146370_3146586_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYB14066.1|3146605_3147079_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYB12312.1|3147080_3147458_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	5.1e-16
AYB12313.1|3147454_3147883_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.1	1.3e-47
AYB12314.1|3147812_3148016_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	73.1	8.9e-23
AYB12315.1|3147978_3148410_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
AYB12316.1|3148402_3148849_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.1	3.1e-60
AYB12317.1|3148875_3149742_-	hypothetical protein	NA	NA	NA	NA	NA
AYB12318.1|3149837_3150416_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.8e-92
AYB12319.1|3150412_3150772_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	91.5	3.5e-54
AYB12320.1|3150758_3151667_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	98.0	7.2e-157
AYB12321.1|3151659_3152265_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
AYB12322.1|3152261_3153947_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	50.6	3.5e-128
AYB12323.1|3153949_3154477_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
AYB12324.1|3154607_3155780_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	1.3e-222
AYB12325.1|3155789_3156305_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYB12326.1|3156359_3156662_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
AYB12327.1|3156676_3156796_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
AYB12328.1|3156788_3159596_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.0	0.0e+00
AYB12329.1|3159592_3160078_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
AYB12330.1|3160074_3161175_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.6	9.0e-194
AYB14067.1|3161243_3161462_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
AYB14068.1|3162013_3163177_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYB12331.1|3165356_3166766_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AYB12332.1|3166830_3178050_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AYB14069.1|3178664_3179147_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AYB12333.1|3179296_3179773_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYB12334.1|3179762_3180053_+	RnfH family protein	NA	NA	NA	NA	NA
AYB12335.1|3180218_3180557_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYB12336.1|3180705_3182367_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AYB14071.1|3182452_3183331_-	NAD(+) kinase	NA	NA	NA	NA	NA
AYB14070.1|3183454_3184045_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYB12337.1|3184079_3184685_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYB12338.1|3184805_3186047_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYB12339.1|3186111_3186903_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYB12340.1|3186848_3187145_-	hypothetical protein	NA	NA	NA	NA	NA
AYB12341.1|3187068_3188430_+	signal recognition particle protein	NA	NA	NA	NA	NA
AYB12342.1|3188682_3188931_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYB12343.1|3188949_3189498_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYB12344.1|3189542_3190310_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 6
CP032384	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 chromosome, complete genome	4877387	3453416	3459455	4877387		Salmonella_virus(50.0%)	6	NA	NA
AYB12559.1|3453416_3453647_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	5.4e-08
AYB12560.1|3453585_3453729_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
AYB12561.1|3454718_3456641_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	76.9	8.1e-299
AYB12562.1|3456658_3456913_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
AYB14079.1|3456881_3457271_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
AYB12563.1|3458513_3459455_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 7
CP032384	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 chromosome, complete genome	4877387	3695652	3704823	4877387	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYB12780.1|3695652_3696600_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AYB12781.1|3696583_3697315_+	ABC transporter permease	NA	NA	NA	NA	NA
AYB12782.1|3697295_3697403_-	protein YohO	NA	NA	NA	NA	NA
AYB12783.1|3697462_3698194_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	2.2e-100
AYB12784.1|3698416_3700102_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.4e-278
AYB12785.1|3700098_3700818_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYB12786.1|3700864_3701332_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	8.8e-74
AYB12787.1|3701388_3701919_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AYB12788.1|3702090_3702549_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	71.2	7.1e-52
AYB12789.1|3702789_3704823_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	2.1e-55
>prophage 8
CP032384	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 chromosome, complete genome	4877387	3772020	3782527	4877387		Enterobacteria_phage(37.5%)	10	NA	NA
AYB12841.1|3772020_3773424_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
AYB12842.1|3773601_3774495_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYB12843.1|3774871_3775957_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYB12844.1|3775956_3776856_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AYB12845.1|3776903_3777782_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
AYB12846.1|3777782_3778334_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
AYB12847.1|3778339_3779314_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AYB12848.1|3779329_3780103_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYB12849.1|3780107_3781187_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
AYB12850.1|3781213_3782527_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 9
CP032384	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 chromosome, complete genome	4877387	3895454	3941665	4877387	transposase,capsid,plate,integrase,head,terminase,tail,holin	Salmonella_phage(84.91%)	64	3893426:3893440	3913746:3913760
3893426:3893440	attL	TTATCAATGACATCT	NA	NA	NA	NA
AYB14095.1|3895454_3896729_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.1	8.2e-74
AYB12960.1|3897084_3897882_-	protein MtfA	NA	NA	NA	NA	NA
AYB12961.1|3898173_3899163_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
AYB12962.1|3899164_3899407_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	98.8	2.1e-39
AYB12963.1|3899431_3900001_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	91.0	5.8e-104
AYB12964.1|3899997_3900747_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	83.6	1.1e-46
AYB12965.1|3900750_3901224_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.3	5.0e-69
AYB12966.1|3901223_3901961_-	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	86.3	1.8e-52
AYB12967.1|3902031_3902571_-	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
AYB12968.1|3902707_3903535_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	97.5	1.0e-149
AYB12969.1|3903592_3903964_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
AYB12970.1|3904500_3904746_+	hypothetical protein	NA	NA	NA	NA	NA
AYB12971.1|3904663_3904960_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	98.0	1.1e-50
AYB12972.1|3904940_3905192_-	hypothetical protein	NA	NA	NA	NA	NA
AYB12973.1|3905119_3905305_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
AYB12974.1|3905509_3906205_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
AYB12975.1|3906178_3906364_+	amino acid permease	NA	NA	NA	NA	NA
AYB12976.1|3906302_3906527_+	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AYB12977.1|3906555_3907110_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	5.9e-101
AYB12978.1|3907106_3908249_+	peptidase	NA	A0A1C9IHV9	Salmonella_phage	87.6	1.6e-182
AYB12979.1|3908245_3908470_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AYB12980.1|3908466_3909441_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	98.1	1.2e-165
AYB12981.1|3909437_3909911_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	93.8	6.6e-53
AYB12982.1|3909907_3910789_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	1.1e-170
AYB12983.1|3910797_3911187_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
AYB12984.1|3911158_3912064_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.0	2.8e-161
AYB14096.1|3912071_3913061_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	3.0e-188
AYB12985.1|3913074_3913827_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	2.4e-134
3913746:3913760	attR	AGATGTCATTGATAA	NA	NA	NA	NA
AYB12986.1|3913858_3914047_+	hypothetical protein	NA	NA	NA	NA	NA
AYB12987.1|3914115_3914358_+	hypothetical protein	NA	NA	NA	NA	NA
AYB12988.1|3914489_3914843_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	88.7	1.0e-50
AYB12989.1|3914846_3915323_+	lysozyme	NA	Q8SBE0	Shigella_phage	96.8	1.7e-85
AYB12990.1|3915306_3915699_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	92.3	1.6e-57
AYB12991.1|3915583_3915856_+	peptidase	NA	Q8SBD8	Shigella_phage	77.6	3.8e-29
AYB12992.1|3916224_3916659_+	hypothetical protein	NA	NA	NA	NA	NA
AYB12993.1|3916786_3917137_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	8.0e-64
AYB12994.1|3917254_3917758_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	3.6e-89
AYB12995.1|3917754_3919488_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.8	0.0e+00
AYB12996.1|3919499_3919682_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
AYB12997.1|3921564_3922770_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
AYB12998.1|3922820_3923021_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
AYB12999.1|3923023_3923347_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
AYB13000.1|3923343_3923748_+|head,tail	head-tail adaptor protein	head,tail	A0A192Y6C2	Salmonella_phage	99.3	5.4e-72
AYB13001.1|3923719_3924232_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
AYB13002.1|3924228_3924789_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	99.5	8.8e-105
AYB13003.1|3924792_3924957_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
AYB13004.1|3924946_3926443_+|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	99.8	6.1e-278
AYB13005.1|3926442_3926799_+|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
AYB13006.1|3926795_3927122_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
AYB13007.1|3927206_3929135_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.7	0.0e+00
AYB13008.1|3929168_3930509_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
AYB13009.1|3930505_3931570_+|plate	baseplate protein	plate	Q8HAC0	Salmonella_phage	95.1	4.2e-188
AYB13010.1|3931562_3932096_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
AYB13011.1|3932100_3932514_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
AYB13012.1|3932506_3933586_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.7	2.5e-204
AYB13013.1|3933588_3934176_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
AYB13014.1|3934162_3935725_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	100.0	2.6e-287
AYB13015.1|3935724_3936294_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
AYB13016.1|3936578_3937586_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
AYB13017.1|3937798_3938020_+	DNA-binding protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
AYB13018.1|3938383_3938566_+	hypothetical protein	NA	NA	NA	NA	NA
AYB13019.1|3938958_3939336_+	hypothetical protein	NA	NA	NA	NA	NA
AYB13020.1|3939362_3940181_+	hypothetical protein	NA	NA	NA	NA	NA
AYB13021.1|3940642_3941665_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
>prophage 10
CP032384	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 chromosome, complete genome	4877387	4633863	4690768	4877387	protease,integrase,tRNA,tail	Moraxella_phage(16.67%)	58	4663646:4663661	4689250:4689265
AYB13692.1|4633863_4634559_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AYB13693.1|4634616_4636527_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
AYB13694.1|4636657_4637002_+	RidA family protein	NA	NA	NA	NA	NA
AYB13695.1|4637007_4637187_-	YoaH family protein	NA	NA	NA	NA	NA
AYB13696.1|4637267_4638632_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	34.5	3.6e-43
AYB13697.1|4638635_4639214_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AYB13698.1|4639477_4640842_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AYB13699.1|4640979_4642581_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AYB13700.1|4642602_4644162_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
AYB13701.1|4644149_4644485_-	hypothetical protein	NA	NA	NA	NA	NA
AYB13702.1|4644634_4645603_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AYB13703.1|4645655_4646456_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AYB13704.1|4646468_4647320_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AYB13705.1|4647378_4647837_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AYB14125.1|4648192_4648813_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
AYB13706.1|4648809_4649619_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AYB13707.1|4649684_4651430_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
AYB13708.1|4651649_4651859_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AYB13709.1|4651871_4652015_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AYB13710.1|4652663_4652951_-	hypothetical protein	NA	NA	NA	NA	NA
AYB13711.1|4653021_4653165_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AYB13712.1|4653322_4653562_+	hypothetical protein	NA	NA	NA	NA	NA
AYB13713.1|4653773_4654565_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AYB13714.1|4654740_4656114_+	MFS transporter	NA	NA	NA	NA	NA
AYB13715.1|4656161_4657043_-|protease	protease HtpX	protease	NA	NA	NA	NA
AYB13716.1|4657235_4659284_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AYB13717.1|4659303_4659990_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYB13718.1|4660087_4660672_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AYB13719.1|4660713_4661997_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYB13720.1|4661959_4664599_+	PqiB family protein	NA	NA	NA	NA	NA
4663646:4663661	attL	CCGGAATATCGCCACC	NA	NA	NA	NA
AYB14126.1|4664676_4666116_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AYB13721.1|4666230_4666470_+	DUF1480 family protein	NA	NA	NA	NA	NA
AYB13722.1|4666580_4666772_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYB13723.1|4666790_4667441_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
AYB13724.1|4667664_4667829_-	hypothetical protein	NA	NA	NA	NA	NA
AYB13725.1|4668113_4668836_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AYB13726.1|4669519_4669861_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AYB13727.1|4670242_4670719_+	hypothetical protein	NA	NA	NA	NA	NA
AYB13728.1|4671091_4671511_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYB13729.1|4671639_4671834_-	hypothetical protein	NA	NA	NA	NA	NA
AYB13730.1|4671880_4672150_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
AYB13731.1|4672315_4672456_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14127.1|4674764_4674965_-	hypothetical protein	NA	NA	NA	NA	NA
AYB13732.1|4676631_4676790_+	hypothetical protein	NA	NA	NA	NA	NA
AYB13733.1|4676799_4677414_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
AYB13734.1|4678166_4678433_-	hypothetical protein	NA	NA	NA	NA	NA
AYB13735.1|4678561_4678687_-	arsenic transporter	NA	NA	NA	NA	NA
AYB13736.1|4678948_4679053_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYB13737.1|4679254_4679455_+	phage virulence factor	NA	NA	NA	NA	NA
AYB13738.1|4680913_4681105_+	hypothetical protein	NA	NA	NA	NA	NA
AYB13739.1|4681169_4681337_+	lytic enzyme	NA	NA	NA	NA	NA
AYB13740.1|4681593_4682127_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	3.2e-11
AYB13741.1|4682123_4682411_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.9	1.6e-38
AYB13742.1|4683544_4684624_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	1.1e-98
AYB13743.1|4685577_4686378_+	hypothetical protein	NA	NA	NA	NA	NA
AYB13744.1|4686857_4687580_+	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AYB13745.1|4687781_4688351_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	90.5	3.4e-96
AYB13746.1|4688350_4690768_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.8	4.7e-86
4689250:4689265	attR	CCGGAATATCGCCACC	NA	NA	NA	NA
>prophage 11
CP032384	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 chromosome, complete genome	4877387	4694526	4732397	4877387	protease,integrase,lysis,portal,terminase,tail,holin	Enterobacteria_phage(29.73%)	48	4684625:4684684	4732398:4732562
4684625:4684684	attL	TACTCCAATTTTCGTTGTGAAATAAATGTTAAATTTAATTTGATTGTGATATAACCAAAA	NA	NA	NA	NA
AYB13749.1|4694526_4695231_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
AYB13750.1|4695134_4695866_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	1.0e-113
AYB13751.1|4695875_4696571_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
AYB13752.1|4696660_4697194_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AYB13753.1|4697310_4697808_-	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	35.9	1.4e-16
AYB13754.1|4697906_4698239_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
AYB14128.1|4698235_4701223_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	2.8e-266
AYB13755.1|4701302_4701632_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AYB13756.1|4701628_4702027_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AYB13757.1|4702072_4702822_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	4.8e-90
AYB13758.1|4702833_4703235_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
AYB13759.1|4703231_4703798_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
AYB13760.1|4703778_4704078_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AYB13761.1|4704070_4704394_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AYB14130.1|4704484_4706566_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
AYB14129.1|4706489_4708007_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.7	4.9e-174
AYB13762.1|4708033_4708240_-	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AYB13763.1|4708236_4710375_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
AYB13764.1|4710331_4710865_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	7.8e-34
AYB14132.1|4711072_4711552_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AYB13765.1|4711569_4712022_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AYB14131.1|4712005_4712335_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AYB13766.1|4712610_4713297_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
AYB13767.1|4713657_4714107_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14133.1|4714480_4715005_-	hypothetical protein	NA	NA	NA	NA	NA
AYB13768.1|4715101_4715791_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
AYB13769.1|4715920_4716148_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
AYB13770.1|4716144_4716744_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
AYB13771.1|4716807_4717113_-	hypothetical protein	NA	NA	NA	NA	NA
AYB13772.1|4717535_4717727_+	hypothetical protein	NA	NA	NA	NA	NA
AYB13773.1|4717744_4719724_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
AYB13774.1|4720120_4721251_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AYB13775.1|4721537_4721933_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	9.8e-18
AYB13776.1|4721945_4722407_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	75.5	3.5e-67
AYB13777.1|4722399_4723398_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.3	4.1e-121
AYB13778.1|4723444_4723939_-	hypothetical protein	NA	NA	NA	NA	NA
AYB13779.1|4723925_4724180_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
AYB13780.1|4724278_4724677_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
AYB13781.1|4725079_4725346_+	hypothetical protein	NA	NA	NA	NA	NA
AYB13782.1|4725694_4725970_+	hypothetical protein	NA	NA	NA	NA	NA
AYB13783.1|4725973_4726180_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
AYB13784.1|4726255_4726591_+	hypothetical protein	NA	NA	NA	NA	NA
AYB13785.1|4726731_4729422_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	72.8	4.0e-118
AYB13786.1|4729414_4730245_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	2.5e-103
AYB13787.1|4730291_4730477_+	DUF1187 family protein	NA	NA	NA	NA	NA
AYB14134.1|4730767_4731004_+	hypothetical protein	NA	NA	NA	NA	NA
AYB13788.1|4731064_4731343_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.8e-10
AYB13789.1|4731317_4732397_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	1.5e-100
4732398:4732562	attR	TACTCCAATTTTCGTTGTGAAATAAATGTTAAATTTAATTTGATTGTGATATAACCAAAAAGACCGGAATACAGAAATTCGGAAAAATTTCGGAAAATTTCGGAAAACGGATCGTAAGCGACTGTTTTATAAGAAAAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 12
CP032384	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 chromosome, complete genome	4877387	4834496	4844204	4877387		Burkholderia_phage(28.57%)	12	NA	NA
AYB13898.1|4834496_4836209_-	cellulose synthesis regulatory protein	NA	A0A127AWB9	Bacillus_phage	37.4	1.6e-19
AYB13899.1|4836373_4836619_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AYB13900.1|4836635_4837553_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AYB13901.1|4837722_4838643_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AYB13902.1|4838631_4839102_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
AYB13903.1|4839082_4840513_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
AYB13904.1|4840586_4841282_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AYB13905.1|4841361_4841673_-	hypothetical protein	NA	NA	NA	NA	NA
AYB13906.1|4842322_4842880_+	porin	NA	Q1MVN1	Enterobacteria_phage	68.4	2.0e-64
AYB13907.1|4843135_4843534_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	55.0	2.7e-31
AYB14139.1|4843792_4843981_-	cold-shock protein	NA	NA	NA	NA	NA
AYB13908.1|4843991_4844204_-	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
>prophage 1
CP032385	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_1, complete sequence	103514	0	59464	103514	tail,integrase,head,transposase	Escherichia_phage(17.65%)	70	4686:4701	37071:37086
AYB14141.1|133_412_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14142.1|411_1452_-	DNA-binding protein	NA	NA	NA	NA	NA
AYB14143.1|1605_2481_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
AYB14144.1|2807_3299_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14145.1|3295_4165_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
AYB14146.1|4169_5180_-|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
4686:4701	attL	ACTTTCACATGTGAAA	NA	NA	NA	NA
AYB14147.1|5182_5719_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14148.1|5711_5999_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14149.1|6017_6338_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14150.1|6568_7171_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14151.1|7809_8250_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14152.1|8221_12475_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
AYB14264.1|12429_12633_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14153.1|12607_13333_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14154.1|13446_13848_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14155.1|14463_15468_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AYB14156.1|15567_16002_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AYB14157.1|16073_16424_+	mercuric transporter	NA	NA	NA	NA	NA
AYB14158.1|16439_16715_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AYB14159.1|16786_18472_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
AYB14160.1|18486_19125_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
AYB14161.1|19236_19602_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AYB14162.1|19598_19835_+	mercury resistance protein	NA	NA	NA	NA	NA
AYB14163.1|19831_20821_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AYB14164.1|21030_21735_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYB14165.1|21774_22611_+	TEM family class A beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	9.0e-154
AYB14166.1|23286_23649_+	transcriptional regulator	NA	NA	NA	NA	NA
AYB14167.1|23645_23882_+	mercury resistance protein	NA	NA	NA	NA	NA
AYB14168.1|23878_24586_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYB14169.1|24624_25929_+|integrase	integrase	integrase	NA	NA	NA	NA
AYB14170.1|25975_26680_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB14171.1|26869_27685_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AYB14172.1|27837_28542_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB14173.1|29162_30308_-	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
AYB14174.1|30631_31894_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AYB14175.1|32178_32571_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
AYB14176.1|32574_33153_-	type IV conjugative transfer system protein TraV	NA	NA	NA	NA	NA
AYB14177.1|33149_34466_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AYB14178.1|34462_35380_-	conjugal transfer protein TraK	NA	NA	NA	NA	NA
AYB14179.1|35363_35990_-	pilus assembly protein	NA	NA	NA	NA	NA
AYB14180.1|35986_36268_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AYB14181.1|36412_36790_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14182.1|37113_37776_-	hypothetical protein	NA	NA	NA	NA	NA
37071:37086	attR	ACTTTCACATGTGAAA	NA	NA	NA	NA
AYB14183.1|37775_38153_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14184.1|38162_38609_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14185.1|38618_39248_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
AYB14186.1|39204_39789_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14187.1|39799_41665_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
AYB14188.1|41661_44634_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AYB14189.1|44801_45419_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14190.1|45400_45634_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14191.1|45633_47826_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	9.9e-43
AYB14192.1|47840_48329_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14193.1|48419_48719_-	ASCH domain-containing protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
AYB14194.1|48723_48930_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14195.1|48930_49548_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AYB14196.1|49603_50260_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14197.1|50259_51687_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
AYB14198.1|51690_52191_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
AYB14199.1|52199_52532_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14265.1|52516_52948_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14200.1|53015_53690_-	thymidylate kinase	NA	NA	NA	NA	NA
AYB14201.1|53664_53946_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14202.1|53938_54316_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
AYB14203.1|54877_55513_+	restriction endonuclease subunit M	NA	NA	NA	NA	NA
AYB14204.1|55565_55838_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14205.1|55886_57068_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
AYB14206.1|57071_57857_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
AYB14207.1|58030_58342_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14208.1|58648_59464_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
>prophage 2
CP032385	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_1, complete sequence	103514	64298	65513	103514		Salmonella_phage(100.0%)	1	NA	NA
AYB14215.1|64298_65513_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
>prophage 3
CP032385	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_1, complete sequence	103514	69772	72908	103514	transposase	Escherichia_phage(66.67%)	4	NA	NA
AYB14221.1|69772_70477_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB14222.1|71027_71732_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB14223.1|71946_72444_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14224.1|72446_72908_-	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
>prophage 4
CP032385	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_1, complete sequence	103514	76537	82392	103514		Sodalis_phage(25.0%)	11	NA	NA
AYB14233.1|76537_76810_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	4.2e-20
AYB14234.1|76867_77395_-	nuclease	NA	O64020	Bacillus_phage	37.0	1.3e-09
AYB14235.1|77411_77600_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14236.1|77625_78483_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14237.1|78469_78700_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14238.1|78699_79218_-	nitrite reductase	NA	NA	NA	NA	NA
AYB14239.1|79214_79661_-	Fe3+-siderophore ABC transporter permease	NA	NA	NA	NA	NA
AYB14240.1|79660_80020_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
AYB14241.1|80076_80505_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14242.1|80538_81399_-	DsbA family protein	NA	NA	NA	NA	NA
AYB14243.1|81414_82392_-	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	31.5	7.1e-17
>prophage 5
CP032385	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_1, complete sequence	103514	86033	87149	103514		unidentified_phage(100.0%)	1	NA	NA
AYB14249.1|86033_87149_+	phosphohydrolase	NA	H7BVI4	unidentified_phage	29.1	6.4e-46
>prophage 6
CP032385	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_1, complete sequence	103514	91052	94799	103514		Bacillus_phage(50.0%)	7	NA	NA
AYB14254.1|91052_92036_+	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
AYB14255.1|92052_92346_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14256.1|92347_92767_+	DNA-binding protein	NA	NA	NA	NA	NA
AYB14270.1|92826_93378_-	regulator	NA	NA	NA	NA	NA
AYB14257.1|93374_93983_-	transcriptional regulator	NA	NA	NA	NA	NA
AYB14258.1|93993_94527_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
AYB14259.1|94526_94799_-	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
>prophage 1
CP032386	Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence	75390	13234	45020	75390	integrase,transposase,coat	Escherichia_phage(30.0%)	41	9860:9874	26079:26093
9860:9874	attL	CGGTTTTACCGCTTC	NA	NA	NA	NA
AYB14288.1|13234_14017_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
AYB14289.1|14741_15251_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
AYB14290.1|15792_16353_+	adenylate cyclase	NA	NA	NA	NA	NA
AYB14291.1|16419_16779_-	Virulence protein VsdF	NA	A0A077SLN2	Escherichia_phage	76.7	3.0e-42
AYB14292.1|16835_17261_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	3.4e-24
AYB14293.1|17387_18038_-	SPI-2 type III secretion system effector cysteine hydrolase SpvD	NA	NA	NA	NA	NA
AYB14294.1|18298_19024_-	type III secretion system effector phosphothreonine lyase SpvC	NA	NA	NA	NA	NA
AYB14295.1|19304_21086_-	SPI-2 type III secretion system effector NAD(+)--protein-arginine ADP-ribosyltransferase SpvB	NA	NA	NA	NA	NA
AYB14296.1|21267_22035_-	Virulence protein SpvA	NA	NA	NA	NA	NA
AYB14297.1|22208_22373_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
AYB14298.1|22546_23440_-	virulence genes transcriptional activator SpvR	NA	NA	NA	NA	NA
AYB14299.1|24046_25084_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AYB14300.1|25272_26298_-	AAA family ATPase	NA	NA	NA	NA	NA
26079:26093	attR	CGGTTTTACCGCTTC	NA	NA	NA	NA
AYB14301.1|26230_27895_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AYB14302.1|27878_28439_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	43.2	1.5e-32
AYB14303.1|28503_29208_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB14304.1|29473_30214_-	carbonic anhydrase	NA	NA	NA	NA	NA
AYB14305.1|30868_31357_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYB14306.1|31615_32731_+	DNA-binding protein	NA	NA	NA	NA	NA
AYB14354.1|32816_33233_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
AYB14307.1|33416_33752_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14308.1|33808_34375_+	DUF2913 family protein	NA	NA	NA	NA	NA
AYB14309.1|35741_36362_+	chromosome partitioning protein ParA	NA	A2I303	Vibrio_virus	33.8	6.3e-19
AYB14310.1|36413_36644_+	DNA partition complex ParG	NA	NA	NA	NA	NA
AYB14311.1|36878_37058_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14355.1|37282_37636_-	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
AYB14312.1|37772_38219_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14313.1|38258_39095_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
AYB14314.1|40133_40334_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14315.1|40330_40582_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AYB14316.1|40571_40853_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	3.8e-24
AYB14317.1|40998_41322_+	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	45.1	2.7e-13
AYB14318.1|41366_41612_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14319.1|41601_41817_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14320.1|41909_42239_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14321.1|42281_42461_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14322.1|42482_42680_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14323.1|42692_42965_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14324.1|43025_43175_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14356.1|43290_43836_+	DNA distortion polypeptide 1	NA	NA	NA	NA	NA
AYB14325.1|43832_45020_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
