The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032393	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 chromosome, complete genome	4858438	1752148	1817921	4858438	tail,integrase,transposase,tRNA,plate,lysis,portal,head,capsid	Salmonella_phage(87.8%)	64	1755185:1755200	1768452:1768467
AYB06187.1|1752148_1753259_+|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
AYB06188.1|1754055_1754859_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
1755185:1755200	attL	TCAGCCAGCAGGCTTT	NA	NA	NA	NA
AYB06189.1|1755257_1755851_-	hypothetical protein	NA	NA	NA	NA	NA
AYB06190.1|1756110_1757136_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	99.1	9.2e-201
AYB06191.1|1757139_1757772_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.1e-66
AYB06192.1|1757888_1758128_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
AYB06193.1|1758681_1758915_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
AYB06194.1|1758862_1759321_-	hypothetical protein	NA	NA	NA	NA	NA
AYB06195.1|1759540_1759882_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
AYB06196.1|1759949_1760183_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
AYB06197.1|1760182_1760410_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
AYB06198.1|1760406_1761264_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	99.6	1.5e-164
AYB06199.1|1761260_1763657_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.9	0.0e+00
AYB06200.1|1763812_1764001_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
AYB06201.1|1764069_1764369_-	hypothetical protein	NA	NA	NA	NA	NA
AYB06202.1|1764479_1765286_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.8	6.2e-51
AYB06203.1|1765778_1766933_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYB06204.1|1767712_1768744_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.0	5.0e-170
1768452:1768467	attR	AAAGCCTGCTGGCTGA	NA	NA	NA	NA
AYB06205.1|1768743_1770510_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
AYB06206.1|1770652_1771486_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	84.5	5.9e-121
AYB06207.1|1771502_1772561_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	4.9e-181
AYB06208.1|1772564_1773215_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYB06209.1|1773310_1773775_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
AYB06210.1|1773774_1773978_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYB06211.1|1773981_1774197_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYB09111.1|1774216_1774690_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYB06212.1|1774691_1775069_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	5.1e-16
AYB06213.1|1775065_1775494_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.1	1.3e-47
AYB06214.1|1775423_1775627_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	73.1	8.9e-23
AYB06215.1|1775589_1776021_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
AYB06216.1|1776013_1776460_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.1	3.1e-60
AYB06217.1|1776486_1777353_-	hypothetical protein	NA	NA	NA	NA	NA
AYB06218.1|1777448_1778027_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.8e-92
AYB06219.1|1778023_1778383_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	91.5	3.5e-54
AYB06220.1|1778369_1779278_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	98.0	7.2e-157
AYB06221.1|1779270_1779876_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
AYB06222.1|1779872_1781558_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	50.6	3.5e-128
AYB06223.1|1781560_1782088_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
AYB06224.1|1782218_1783391_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	1.3e-222
AYB06225.1|1783400_1783916_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYB06226.1|1783970_1784273_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
AYB06227.1|1784287_1784407_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
AYB06228.1|1784399_1787207_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.0	0.0e+00
AYB06229.1|1787203_1787689_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
AYB06230.1|1787685_1788786_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.6	9.0e-194
AYB09112.1|1788854_1789073_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
AYB09113.1|1789624_1790788_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYB06231.1|1792967_1794377_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AYB06232.1|1794441_1805661_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AYB09114.1|1806275_1806758_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AYB06233.1|1806907_1807384_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYB06234.1|1807373_1807664_+	RnfH family protein	NA	NA	NA	NA	NA
AYB06235.1|1807829_1808168_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYB06236.1|1808316_1809978_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AYB09116.1|1810063_1810942_-	NAD(+) kinase	NA	NA	NA	NA	NA
AYB09115.1|1811065_1811656_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYB06237.1|1811690_1812296_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYB06238.1|1812416_1813658_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYB06239.1|1813722_1814514_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYB06240.1|1814459_1814756_-	hypothetical protein	NA	NA	NA	NA	NA
AYB06241.1|1814679_1816041_+	signal recognition particle protein	NA	NA	NA	NA	NA
AYB06242.1|1816293_1816542_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYB06243.1|1816560_1817109_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYB06244.1|1817153_1817921_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
CP032393	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 chromosome, complete genome	4858438	2081048	2087087	4858438		Salmonella_virus(50.0%)	6	NA	NA
AYB06457.1|2081048_2081279_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	5.4e-08
AYB06458.1|2081217_2081361_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
AYB06459.1|2082350_2084273_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	76.9	8.1e-299
AYB06460.1|2084290_2084545_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
AYB09124.1|2084513_2084903_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
AYB06461.1|2086145_2087087_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 3
CP032393	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 chromosome, complete genome	4858438	2323305	2332476	4858438	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYB06679.1|2323305_2324253_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AYB06680.1|2324236_2324968_+	ABC transporter permease	NA	NA	NA	NA	NA
AYB06681.1|2324948_2325056_-	protein YohO	NA	NA	NA	NA	NA
AYB06682.1|2325115_2325847_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	2.2e-100
AYB06683.1|2326069_2327755_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.4e-278
AYB06684.1|2327751_2328471_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYB06685.1|2328517_2328985_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	8.8e-74
AYB06686.1|2329041_2329572_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AYB06687.1|2329743_2330202_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	71.2	7.1e-52
AYB06688.1|2330442_2332476_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
CP032393	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 chromosome, complete genome	4858438	2399672	2408839	4858438		Enterobacteria_phage(42.86%)	9	NA	NA
AYB06739.1|2399672_2401076_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
AYB06740.1|2401253_2402147_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYB06741.1|2402523_2403609_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYB06742.1|2403608_2404508_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AYB06743.1|2404555_2405434_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
AYB06744.1|2405434_2405986_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
AYB06745.1|2405991_2406966_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AYB06746.1|2406981_2407755_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYB06747.1|2407759_2408839_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
>prophage 5
CP032393	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 chromosome, complete genome	4858438	2523106	2569316	4858438	tail,holin,integrase,transposase,terminase,plate,head,capsid	Salmonella_phage(84.62%)	63	2521078:2521092	2541397:2541411
2521078:2521092	attL	TTATCAATGACATCT	NA	NA	NA	NA
AYB09139.1|2523106_2524381_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.1	8.2e-74
AYB06859.1|2524736_2525534_-	protein MtfA	NA	NA	NA	NA	NA
AYB06860.1|2525825_2526815_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
AYB06861.1|2526816_2527059_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	98.8	2.1e-39
AYB06862.1|2527083_2527653_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	91.0	5.8e-104
AYB06863.1|2527649_2528399_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	83.6	1.1e-46
AYB06864.1|2528402_2528876_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.3	5.0e-69
AYB06865.1|2528875_2529613_-	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	86.3	1.8e-52
AYB06866.1|2529683_2530223_-	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
AYB06867.1|2530359_2531187_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	97.5	1.0e-149
AYB06868.1|2531244_2531616_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
AYB06869.1|2532152_2532398_+	hypothetical protein	NA	NA	NA	NA	NA
AYB06870.1|2532315_2532612_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	98.0	1.1e-50
AYB06871.1|2532592_2532844_-	hypothetical protein	NA	NA	NA	NA	NA
AYB06872.1|2532771_2532957_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
AYB06873.1|2533161_2533857_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
AYB06874.1|2533830_2534016_+	amino acid permease	NA	NA	NA	NA	NA
AYB06875.1|2533954_2534179_+	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AYB06876.1|2534207_2534762_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	5.9e-101
AYB06877.1|2534758_2535901_+	peptidase	NA	A0A1C9IHV9	Salmonella_phage	87.6	1.6e-182
AYB06878.1|2535897_2536122_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AYB06879.1|2536118_2537093_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	98.1	1.2e-165
AYB06880.1|2537089_2537563_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	93.8	6.6e-53
AYB06881.1|2537559_2538441_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	1.1e-170
AYB06882.1|2538449_2538839_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
AYB09140.1|2539722_2540712_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	3.0e-188
AYB06883.1|2540725_2541478_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	2.4e-134
2541397:2541411	attR	AGATGTCATTGATAA	NA	NA	NA	NA
AYB06884.1|2541509_2541698_+	hypothetical protein	NA	NA	NA	NA	NA
AYB06885.1|2541766_2542009_+	hypothetical protein	NA	NA	NA	NA	NA
AYB06886.1|2542140_2542494_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	88.7	1.0e-50
AYB06887.1|2542497_2542974_+	lysozyme	NA	Q8SBE0	Shigella_phage	96.8	1.7e-85
AYB06888.1|2542957_2543350_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	92.3	1.6e-57
AYB06889.1|2543234_2543507_+	peptidase	NA	Q8SBD8	Shigella_phage	77.6	3.8e-29
AYB06890.1|2543875_2544310_+	hypothetical protein	NA	NA	NA	NA	NA
AYB06891.1|2544437_2544788_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	8.0e-64
AYB06892.1|2544905_2545409_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	3.6e-89
AYB06893.1|2545405_2547139_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.8	0.0e+00
AYB06894.1|2547150_2547333_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
AYB06895.1|2549215_2550421_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
AYB06896.1|2550471_2550672_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
AYB06897.1|2550674_2550998_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
AYB06898.1|2550994_2551399_+|head,tail	head-tail adaptor protein	head,tail	A0A192Y6C2	Salmonella_phage	99.3	5.4e-72
AYB06899.1|2551370_2551883_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
AYB06900.1|2551879_2552440_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	99.5	8.8e-105
AYB06901.1|2552443_2552608_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
AYB06902.1|2552597_2554094_+|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	99.8	6.1e-278
AYB06903.1|2554093_2554450_+|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
AYB06904.1|2554446_2554773_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
AYB06905.1|2554857_2556786_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.7	0.0e+00
AYB06906.1|2556819_2558160_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
AYB06907.1|2558156_2559221_+|plate	baseplate protein	plate	Q8HAC0	Salmonella_phage	95.1	4.2e-188
AYB06908.1|2559213_2559747_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
AYB06909.1|2559751_2560165_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
AYB06910.1|2560157_2561237_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.7	2.5e-204
AYB06911.1|2561239_2561827_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
AYB06912.1|2561813_2563376_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	100.0	2.6e-287
AYB06913.1|2563375_2563945_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
AYB06914.1|2564229_2565237_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
AYB06915.1|2565449_2565671_+	DNA-binding protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
AYB06916.1|2566034_2566217_+	hypothetical protein	NA	NA	NA	NA	NA
AYB06917.1|2566609_2566987_+	hypothetical protein	NA	NA	NA	NA	NA
AYB06918.1|2567013_2567832_+	hypothetical protein	NA	NA	NA	NA	NA
AYB06919.1|2568293_2569316_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP032393	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 chromosome, complete genome	4858438	3262460	3360994	4858438	tail,holin,integrase,terminase,protease,tRNA,portal,lysis	Enterobacteria_phage(24.0%)	108	3292243:3292258	3360995:3361159
AYB07588.1|3262460_3263156_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AYB07589.1|3263213_3265124_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
AYB07590.1|3265254_3265599_+	RidA family protein	NA	NA	NA	NA	NA
AYB07591.1|3265604_3265784_-	YoaH family protein	NA	NA	NA	NA	NA
AYB07592.1|3265864_3267229_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	34.5	3.6e-43
AYB07593.1|3267232_3267811_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AYB07594.1|3268074_3269439_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AYB07595.1|3269576_3271178_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AYB07596.1|3271199_3272759_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
AYB07597.1|3272746_3273082_-	hypothetical protein	NA	NA	NA	NA	NA
AYB07598.1|3273231_3274200_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AYB07599.1|3274252_3275053_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AYB07600.1|3275065_3275917_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AYB07601.1|3275975_3276434_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AYB09169.1|3276789_3277410_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
AYB07602.1|3277406_3278216_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AYB07603.1|3278281_3280027_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
AYB07604.1|3280246_3280456_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AYB07605.1|3280468_3280612_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AYB07606.1|3281260_3281548_-	hypothetical protein	NA	NA	NA	NA	NA
AYB07607.1|3281618_3281762_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AYB07608.1|3281919_3282159_+	hypothetical protein	NA	NA	NA	NA	NA
AYB07609.1|3282370_3283162_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AYB07610.1|3283337_3284711_+	MFS transporter	NA	NA	NA	NA	NA
AYB07611.1|3284758_3285640_-|protease	protease HtpX	protease	NA	NA	NA	NA
AYB07612.1|3285832_3287881_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AYB07613.1|3287900_3288587_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYB07614.1|3288684_3289269_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AYB07615.1|3289310_3290594_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYB07616.1|3290556_3293196_+	PqiB family protein	NA	NA	NA	NA	NA
3292243:3292258	attL	CCGGAATATCGCCACC	NA	NA	NA	NA
AYB09170.1|3293273_3294713_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
3292243:3292258	attL	CCGGAATATCGCCACC	NA	NA	NA	NA
AYB07617.1|3294827_3295067_+	DUF1480 family protein	NA	NA	NA	NA	NA
AYB07618.1|3295177_3295369_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYB07619.1|3295387_3296038_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
AYB07620.1|3296261_3296426_-	hypothetical protein	NA	NA	NA	NA	NA
AYB07621.1|3296710_3297433_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AYB07622.1|3298116_3298458_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AYB07623.1|3298839_3299316_+	hypothetical protein	NA	NA	NA	NA	NA
AYB07624.1|3299688_3300108_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYB07625.1|3300236_3300431_-	hypothetical protein	NA	NA	NA	NA	NA
AYB07626.1|3300477_3300747_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
AYB07627.1|3300912_3301053_+	hypothetical protein	NA	NA	NA	NA	NA
AYB09171.1|3303361_3303562_-	hypothetical protein	NA	NA	NA	NA	NA
AYB07628.1|3305228_3305387_+	hypothetical protein	NA	NA	NA	NA	NA
AYB07629.1|3305396_3306011_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
AYB07630.1|3306763_3307030_-	hypothetical protein	NA	NA	NA	NA	NA
AYB07631.1|3307158_3307284_-	arsenic transporter	NA	NA	NA	NA	NA
AYB07632.1|3307545_3307650_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYB07633.1|3307851_3308052_+	phage virulence factor	NA	NA	NA	NA	NA
AYB07634.1|3309510_3309702_+	hypothetical protein	NA	NA	NA	NA	NA
AYB07635.1|3309766_3309934_+	lytic enzyme	NA	NA	NA	NA	NA
AYB07636.1|3310190_3310724_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	3.2e-11
AYB07637.1|3310720_3311008_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.9	1.6e-38
AYB07638.1|3312141_3313221_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	1.1e-98
AYB07639.1|3314174_3314975_+	hypothetical protein	NA	NA	NA	NA	NA
AYB07640.1|3315454_3316177_+	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AYB07641.1|3316378_3316948_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	90.5	3.4e-96
AYB07642.1|3316947_3319365_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.8	4.7e-86
3317847:3317862	attR	CCGGAATATCGCCACC	NA	NA	NA	NA
AYB07643.1|3319418_3319661_-	hypothetical protein	NA	NA	NA	NA	NA
3317847:3317862	attR	CCGGAATATCGCCACC	NA	NA	NA	NA
AYB07644.1|3319699_3320563_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
AYB07645.1|3323123_3323828_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
AYB07646.1|3323731_3324463_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	1.0e-113
AYB07647.1|3324472_3325168_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
AYB07648.1|3325257_3325791_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AYB07649.1|3325907_3326405_-	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	35.9	1.4e-16
AYB07650.1|3326503_3326836_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
AYB09172.1|3326832_3329820_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	2.8e-266
AYB07651.1|3329899_3330229_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AYB07652.1|3330225_3330624_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AYB07653.1|3330669_3331419_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	4.8e-90
AYB07654.1|3331430_3331832_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
AYB07655.1|3331828_3332395_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
AYB07656.1|3332375_3332675_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AYB07657.1|3332667_3332991_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AYB09174.1|3333081_3335163_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
AYB09173.1|3335086_3336604_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.7	4.9e-174
AYB07658.1|3336630_3336837_-	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AYB07659.1|3336833_3338972_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
AYB07660.1|3338928_3339462_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	7.8e-34
AYB09176.1|3339669_3340149_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AYB07661.1|3340166_3340619_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AYB09175.1|3340602_3340932_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AYB07662.1|3341207_3341894_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
AYB07663.1|3342254_3342704_+	hypothetical protein	NA	NA	NA	NA	NA
AYB09177.1|3343077_3343602_-	hypothetical protein	NA	NA	NA	NA	NA
AYB07664.1|3343698_3344388_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
AYB07665.1|3344517_3344745_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
AYB07666.1|3344741_3345341_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
AYB07667.1|3345404_3345710_-	hypothetical protein	NA	NA	NA	NA	NA
AYB07668.1|3346132_3346324_+	hypothetical protein	NA	NA	NA	NA	NA
AYB07669.1|3346341_3348321_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
AYB07670.1|3348717_3349848_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AYB07671.1|3350134_3350530_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	9.8e-18
AYB07672.1|3350542_3351004_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	75.5	3.5e-67
AYB07673.1|3350996_3351995_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.3	4.1e-121
AYB07674.1|3352041_3352536_-	hypothetical protein	NA	NA	NA	NA	NA
AYB07675.1|3352522_3352777_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
AYB07676.1|3352875_3353274_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
AYB07677.1|3353676_3353943_+	hypothetical protein	NA	NA	NA	NA	NA
AYB07678.1|3354291_3354567_+	hypothetical protein	NA	NA	NA	NA	NA
AYB07679.1|3354570_3354777_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
AYB07680.1|3354852_3355188_+	hypothetical protein	NA	NA	NA	NA	NA
AYB07681.1|3355328_3358019_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	72.8	4.0e-118
AYB07682.1|3358011_3358842_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	2.5e-103
AYB07683.1|3358888_3359074_+	DUF1187 family protein	NA	NA	NA	NA	NA
AYB09178.1|3359364_3359601_+	hypothetical protein	NA	NA	NA	NA	NA
AYB07684.1|3359661_3359940_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.8e-10
AYB07685.1|3359914_3360994_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	1.5e-100
3360995:3361159	attR	TACTCCAATTTTCGTTGTGAAATAAATGTTAAATTTAATTTGATTGTGATATAACCAAAAAGACCGGAATACAGAAATTCGGAAAAATTTCGGAAAATTTCGGAAAACGGATCGTAAGCGACTGTTTTATAAGAAAAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
CP032393	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 chromosome, complete genome	4858438	3463092	3472800	4858438		Burkholderia_phage(28.57%)	12	NA	NA
AYB07792.1|3463092_3464805_-	cellulose synthesis regulatory protein	NA	A0A127AWB9	Bacillus_phage	37.4	1.6e-19
AYB07793.1|3464969_3465215_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AYB07794.1|3465231_3466149_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AYB07795.1|3466318_3467239_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AYB07796.1|3467227_3467698_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
AYB07797.1|3467678_3469109_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
AYB07798.1|3469182_3469878_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AYB07799.1|3469957_3470269_-	hypothetical protein	NA	NA	NA	NA	NA
AYB07800.1|3470918_3471476_+	porin	NA	Q1MVN1	Enterobacteria_phage	68.4	2.0e-64
AYB07801.1|3471731_3472130_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	55.0	2.7e-31
AYB09184.1|3472388_3472577_-	cold-shock protein	NA	NA	NA	NA	NA
AYB07802.1|3472587_3472800_-	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
>prophage 8
CP032393	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 chromosome, complete genome	4858438	3557719	3601681	4858438	tail,protease	Escherichia_phage(33.33%)	45	NA	NA
AYB07884.1|3557719_3558400_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.4	1.6e-84
AYB07885.1|3559038_3559698_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYB07886.1|3559784_3560114_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AYB07887.1|3560110_3560392_-	acylphosphatase	NA	NA	NA	NA	NA
AYB07888.1|3560440_3561220_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYB07889.1|3561245_3561794_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AYB07890.1|3562008_3563220_+	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AYB07891.1|3563277_3563595_+	heat-shock protein HspQ	NA	NA	NA	NA	NA
AYB07892.1|3563639_3564056_-	CoA-binding protein	NA	NA	NA	NA	NA
AYB07893.1|3564226_3564889_+	DUF2057 family protein	NA	NA	NA	NA	NA
AYB07894.1|3564983_3565442_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AYB07895.1|3565477_3567532_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYB07896.1|3567655_3568102_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AYB07897.1|3568120_3570274_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AYB07898.1|3570260_3570866_-	DNA transformation protein	NA	NA	NA	NA	NA
AYB07899.1|3571082_3571592_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AYB09187.1|3571948_3573001_+	outer membrane protein A	NA	NA	NA	NA	NA
AYB07900.1|3573072_3573525_-	macrodomain Ter protein	NA	NA	NA	NA	NA
AYB07901.1|3573710_3575471_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AYB07902.1|3575539_3576058_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AYB07903.1|3576157_3576325_-	ribosome modulation factor	NA	NA	NA	NA	NA
AYB07904.1|3576580_3577144_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AYB07905.1|3577140_3578781_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AYB07906.1|3578785_3580039_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
AYB07907.1|3580053_3581961_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
AYB07908.1|3581973_3584082_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AYB07909.1|3584180_3585290_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYB07910.1|3585286_3585829_-	cell division protein ZapC	NA	NA	NA	NA	NA
AYB07911.1|3585994_3587005_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AYB07912.1|3587212_3589825_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
AYB07913.1|3590251_3590443_+	DinI family protein	NA	S4TNM0	Salmonella_phage	93.7	1.8e-25
AYB07914.1|3590713_3591400_+	virulence protein	NA	NA	NA	NA	NA
AYB07915.1|3591384_3591690_+	hypothetical protein	NA	NA	NA	NA	NA
AYB07916.1|3591758_3592385_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AYB07917.1|3593032_3594001_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.1	3.3e-192
AYB07918.1|3594226_3594475_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
AYB07919.1|3594478_3595060_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AYB07920.1|3595059_3596769_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
AYB07921.1|3596765_3597392_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
AYB07922.1|3597375_3598602_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	63.6	3.2e-147
AYB07923.1|3598598_3598931_-	hypothetical protein	NA	NA	NA	NA	NA
AYB07924.1|3598927_3599644_-	hypothetical protein	NA	NA	NA	NA	NA
AYB07925.1|3599640_3600693_-	hypothetical protein	NA	NA	NA	NA	NA
AYB07926.1|3600692_3600968_-	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	33.3	1.6e-06
AYB07927.1|3601183_3601681_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	38.0	8.9e-24
>prophage 9
CP032393	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 chromosome, complete genome	4858438	3608623	3634257	4858438	holin,terminase	Salmonella_phage(72.41%)	32	NA	NA
AYB07935.1|3608623_3609655_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.2	2.5e-73
AYB07936.1|3609672_3610545_-	hypothetical protein	NA	NA	NA	NA	NA
AYB07937.1|3610565_3612140_-	NUDIX hydrolase	NA	Q6UJ14	Burkholderia_virus	48.6	2.2e-20
AYB07938.1|3612140_3613016_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	45.5	1.5e-55
AYB07939.1|3612987_3614418_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.9	2.6e-92
AYB07940.1|3614417_3615689_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.3	1.1e-83
AYB07941.1|3615678_3616653_-|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	37.3	1.6e-29
AYB07942.1|3616714_3617128_-	hypothetical protein	NA	NA	NA	NA	NA
AYB07943.1|3617117_3617669_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AYB07944.1|3617665_3618280_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.1	1.2e-107
AYB07945.1|3618282_3618630_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	1.3e-45
AYB07946.1|3619028_3619826_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	4.4e-150
AYB07947.1|3619815_3619962_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AYB07948.1|3619958_3620570_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
AYB07949.1|3620572_3620779_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AYB07950.1|3620778_3621381_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
AYB07951.1|3621420_3621726_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYB07952.1|3621715_3621955_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYB07953.1|3622110_3622377_-	hypothetical protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYB07954.1|3622470_3623043_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYB07955.1|3623046_3623520_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	4.7e-67
AYB07956.1|3623519_3624044_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYB07957.1|3624040_3624388_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYB07958.1|3624398_3625148_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYB07959.1|3625150_3626134_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
AYB07960.1|3626218_3626593_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYB07961.1|3626558_3626795_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
AYB07962.1|3626924_3627329_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYB07963.1|3628038_3631227_+	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	74.0	0.0e+00
AYB07964.1|3632391_3632631_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AYB07965.1|3632671_3632920_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYB07966.1|3632964_3634257_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.3e-252
>prophage 10
CP032393	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 chromosome, complete genome	4858438	3705223	3712536	4858438	integrase,protease	Ralstonia_phage(16.67%)	7	3700279:3700293	3711272:3711286
3700279:3700293	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYB08020.1|3705223_3705601_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
AYB08021.1|3705762_3705960_+	hypothetical protein	NA	NA	NA	NA	NA
AYB08022.1|3706172_3708449_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AYB08023.1|3708479_3708800_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYB08024.1|3709123_3709345_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYB08025.1|3709474_3711421_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.9	2.0e-39
3711272:3711286	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
AYB08026.1|3711417_3712536_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	8.1e-09
>prophage 11
CP032393	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 chromosome, complete genome	4858438	4050009	4095646	4858438	tail,holin,integrase,coat,terminase,protease,portal,lysis	Salmonella_phage(71.64%)	68	4049676:4049716	4095664:4095704
4049676:4049716	attL	GCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGA	NA	NA	NA	NA
AYB08321.1|4050009_4050372_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
AYB08322.1|4050368_4051295_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	96.7	1.4e-168
AYB08323.1|4051275_4052928_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	38.0	1.5e-83
AYB08324.1|4054411_4054774_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
AYB08325.1|4054770_4055703_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
AYB08326.1|4055692_4057150_+	hypothetical protein	NA	E7C9N7	Salmonella_phage	99.8	1.7e-240
AYB08327.1|4057208_4059212_-	endorhamnosidase	NA	E7C9U9	Salmonella_phage	99.9	0.0e+00
AYB08328.1|4059347_4059599_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
AYB09211.1|4059698_4059878_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
AYB08329.1|4059891_4060257_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
AYB08330.1|4060287_4060617_+	hypothetical protein	NA	NA	NA	NA	NA
AYB08331.1|4060634_4062548_-	DNA transfer protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
AYB08332.1|4062547_4063852_-	acyltransferase	NA	E7C9U5	Salmonella_phage	96.3	7.8e-213
AYB08333.1|4063862_4064552_-	DNA transfer protein	NA	E7C9U4	Salmonella_phage	99.6	1.2e-108
AYB08334.1|4064554_4065010_-	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
AYB08335.1|4065009_4065711_-|tail	phage tail protein	tail	B8K1I3	Salmonella_phage	98.3	8.8e-70
AYB08336.1|4065714_4067133_-	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.3	3.3e-273
AYB08337.1|4067092_4067593_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.8	5.5e-90
AYB08338.1|4067576_4068137_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	98.9	1.4e-102
AYB08339.1|4068177_4069470_-|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.8	1.1e-243
AYB08340.1|4069469_4070381_-	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	100.0	4.9e-161
AYB08341.1|4070394_4072572_-|portal	portal protein	portal	I6R968	Salmonella_phage	98.3	0.0e+00
AYB08342.1|4072571_4074071_-|terminase	terminase	terminase	A8CGE0	Salmonella_phage	99.8	6.9e-306
AYB08343.1|4074048_4074537_-	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
AYB08344.1|4074540_4074945_-	Decoration protein	NA	C6ZR73	Salmonella_phage	100.0	5.3e-67
AYB08345.1|4074944_4075334_-	hypothetical protein	NA	C6ZR72	Salmonella_phage	99.2	1.5e-74
AYB08346.1|4075337_4075580_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AYB08347.1|4075838_4076369_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	96.6	4.0e-91
AYB08348.1|4076322_4076547_-	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	90.3	7.2e-26
AYB08349.1|4076581_4077052_-|lysis	lysis protein	lysis	H6WRZ5	Salmonella_phage	87.2	1.2e-62
AYB08350.1|4077048_4077486_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
AYB08351.1|4077469_4077796_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
AYB08352.1|4077931_4078129_-	hypothetical protein	NA	C6ZR63	Salmonella_phage	96.2	5.0e-23
AYB08353.1|4078175_4078664_-	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
AYB08354.1|4078733_4078937_-	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	94.0	5.7e-30
AYB08355.1|4078933_4079329_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	96.9	2.9e-70
AYB08356.1|4079325_4079622_-	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	98.9	7.5e-47
AYB08357.1|4079584_4079761_-	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	96.6	1.8e-27
AYB08358.1|4079757_4079940_-	NinE family protein	NA	Q716C5	Shigella_phage	96.7	1.8e-27
AYB08359.1|4079906_4080080_-	protein ninD	NA	C6ZR56	Salmonella_phage	93.0	7.0e-29
AYB08360.1|4080076_4080949_-	hypothetical protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
AYB08361.1|4080945_4081404_-	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	98.6	3.0e-79
AYB08362.1|4081459_4082836_-	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	99.3	4.8e-253
AYB08363.1|4083644_4083791_-	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AYB08364.1|4083825_4084107_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
AYB08365.1|4084217_4084433_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
AYB08366.1|4084543_4085233_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
AYB08367.1|4085321_4086245_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	100.0	1.5e-181
AYB08368.1|4086280_4086490_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	5.5e-28
AYB08369.1|4086853_4087186_+	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	100.0	2.2e-55
AYB08370.1|4087264_4087465_+	restriction endonuclease	NA	A0A1R3Y5S4	Salmonella_virus	100.0	1.0e-31
AYB08371.1|4087504_4087804_+	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	99.0	3.3e-50
AYB08372.1|4088127_4088268_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	2.0e-18
AYB08373.1|4088260_4088374_+	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
AYB08374.1|4088370_4088559_+	hypothetical protein	NA	C6ZR38	Salmonella_phage	100.0	1.3e-28
AYB08375.1|4088567_4089275_+	recombinase	NA	E7C9Q0	Salmonella_phage	89.8	9.7e-125
AYB08376.1|4089275_4089782_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	98.8	3.8e-91
AYB08377.1|4089790_4090339_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
AYB08378.1|4090354_4090648_+	DUF2856 family protein	NA	A0A1V0E5L7	Salmonella_phage	100.0	5.5e-50
AYB08379.1|4090658_4090829_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AYB08380.1|4090825_4091407_+	Eae-like protein	NA	A0A0N6WGF1	Salmonella_phage	71.5	5.2e-68
AYB08381.1|4091791_4092085_+	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	99.0	4.2e-50
AYB08382.1|4092081_4093164_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.2	6.5e-80
AYB08383.1|4093108_4093438_+	ASCH domain-containing protein	NA	Q9XJG9	Enterobacteria_phage	94.2	1.0e-52
AYB08384.1|4093519_4093831_+	hypothetical protein	NA	A0A1I9LJL8	Stx_converting_phage	99.0	7.9e-55
AYB09212.1|4093908_4094253_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	97.4	1.1e-57
AYB08385.1|4094255_4094627_+	DNA-binding protein	NA	B9UDM0	Salmonella_phage	80.5	2.1e-46
AYB08386.1|4094482_4095646_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	97.1	1.0e-219
4095664:4095704	attR	GCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGA	NA	NA	NA	NA
>prophage 1
CP032395	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_1, complete sequence	164900	13898	115609	164900	head,integrase,transposase,tail	Escherichia_phage(21.74%)	112	59685:59698	113324:114144
AYB09334.1|13898_15098_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYB09335.1|15107_15296_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09489.1|15650_15836_+	hypothetical protein	NA	NA	NA	NA	NA
AYB09490.1|15856_16138_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09336.1|16483_17584_-	plasmid replication protein	NA	NA	NA	NA	NA
AYB09337.1|17568_17856_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09338.1|17860_18427_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09339.1|18898_19882_+	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
AYB09340.1|19898_20192_+	hypothetical protein	NA	NA	NA	NA	NA
AYB09341.1|20193_20613_+	DNA-binding protein	NA	NA	NA	NA	NA
AYB09491.1|20672_21224_-	regulator	NA	NA	NA	NA	NA
AYB09342.1|21220_21829_-	transcriptional regulator	NA	NA	NA	NA	NA
AYB09343.1|21839_22373_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
AYB09344.1|22372_22645_-	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
AYB09345.1|23360_23723_+	permease	NA	NA	NA	NA	NA
AYB09346.1|23760_27375_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AYB09347.1|27387_28821_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
AYB09348.1|28822_29863_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AYB09349.1|29973_31485_-	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
AYB09350.1|31493_31772_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09351.1|31771_32812_-	DNA-binding protein	NA	NA	NA	NA	NA
AYB09352.1|32964_33840_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
AYB09353.1|34166_34658_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09354.1|34654_35524_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
AYB09355.1|35528_36539_-|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
AYB09356.1|36541_37078_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09357.1|37070_37358_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09358.1|37376_37697_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09359.1|37927_38530_+	hypothetical protein	NA	NA	NA	NA	NA
AYB09360.1|39168_39609_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09361.1|39580_43834_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
AYB09492.1|43788_43992_+	hypothetical protein	NA	NA	NA	NA	NA
AYB09362.1|43966_44692_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09363.1|44805_45207_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09364.1|45822_46827_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AYB09365.1|46926_47361_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AYB09366.1|47432_47783_+	mercuric transporter	NA	NA	NA	NA	NA
AYB09367.1|47798_48074_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AYB09368.1|48145_49831_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
AYB09369.1|49845_50484_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
AYB09370.1|50595_50961_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AYB09371.1|50957_51194_+	mercury resistance protein	NA	NA	NA	NA	NA
AYB09372.1|51190_52180_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AYB09373.1|52389_53094_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYB09374.1|53291_53780_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYB09375.1|54038_55154_+	DNA-binding protein	NA	NA	NA	NA	NA
AYB09376.1|55146_55740_+	3'-5' exonuclease	NA	O64348	Escherichia_phage	42.9	6.9e-07
55634:55693	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
AYB09377.1|55685_56390_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
55634:55693	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
AYB09378.1|56584_56845_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	4.3e-06
AYB09379.1|57182_58004_+	hypothetical protein	NA	NA	NA	NA	NA
AYB09380.1|58234_58447_+	hypothetical protein	NA	A0A191ZBY1	Erwinia_phage	50.7	7.6e-09
AYB09381.1|58542_63306_-	ATP-binding protein	NA	NA	NA	NA	NA
AYB09493.1|63381_63642_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09382.1|63793_65827_-|integrase	integrase	integrase	NA	NA	NA	NA
AYB09383.1|65843_67382_-	recombinase	NA	NA	NA	NA	NA
66724:66737	attR	TCTCCCTTTCCATT	NA	NA	NA	NA
AYB09384.1|67368_68616_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
66724:66737	attR	TCTCCCTTTCCATT	NA	NA	NA	NA
AYB09385.1|68774_69302_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	54.3	6.7e-46
AYB09386.1|69327_69468_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AYB09494.1|69366_69600_+	hypothetical protein	NA	NA	NA	NA	NA
AYB09387.1|69529_69721_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09388.1|69643_69868_+	hypothetical protein	NA	NA	NA	NA	NA
AYB09389.1|69771_70020_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09390.1|69941_70172_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09391.1|70171_70735_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	38.0	2.7e-21
AYB09392.1|70781_72143_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AYB09393.1|72194_72425_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09394.1|73462_73654_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09395.1|73650_74073_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AYB09396.1|74119_74545_-	antirestriction protein	NA	NA	NA	NA	NA
AYB09397.1|75788_76223_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AYB09398.1|76236_76458_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09399.1|76458_77142_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
AYB09495.1|77526_78429_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AYB09400.1|78466_78739_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09401.1|79295_80267_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
AYB09402.1|80266_81433_-	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
AYB09403.1|82020_82776_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
AYB09404.1|83549_84356_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
AYB09405.1|84356_84662_-	toxin CcdB	NA	NA	NA	NA	NA
AYB09406.1|84663_84882_-	antitoxin CcdA	NA	NA	NA	NA	NA
AYB09407.1|85449_85962_+	hypothetical protein	NA	NA	NA	NA	NA
AYB09408.1|85995_87129_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09409.1|87295_88069_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09410.1|88081_88582_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09411.1|88846_89077_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AYB09412.1|89073_89490_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AYB09413.1|89534_93359_-	pcar	NA	NA	NA	NA	NA
AYB09414.1|93709_93940_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AYB09415.1|93936_94353_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AYB09416.1|94427_95993_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AYB09417.1|96917_97106_+	hypothetical protein	NA	NA	NA	NA	NA
AYB09418.1|97115_98315_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYB09419.1|99073_100006_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	2.2e-44
AYB09420.1|100015_100303_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09421.1|100327_100468_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AYB09497.1|100366_100600_+	hypothetical protein	NA	NA	NA	NA	NA
AYB09496.1|100529_100721_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09422.1|100771_101002_-	hypothetical protein	NA	NA	NA	NA	NA
AYB09423.1|101659_102379_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AYB09424.1|102596_103301_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYB09425.1|104115_105141_+	AAA family ATPase	NA	NA	NA	NA	NA
AYB09426.1|105329_106367_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AYB09427.1|106973_107867_+	virulence genes transcriptional activator SpvR	NA	NA	NA	NA	NA
AYB09428.1|108040_108205_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
AYB09429.1|108378_109146_+	Virulence protein SpvA	NA	NA	NA	NA	NA
AYB09430.1|109327_111109_+	SPI-2 type III secretion system effector NAD(+)--protein-arginine ADP-ribosyltransferase SpvB	NA	NA	NA	NA	NA
AYB09431.1|111389_112115_+	type III secretion system effector phosphothreonine lyase SpvC	NA	NA	NA	NA	NA
AYB09432.1|112375_113026_+	SPI-2 type III secretion system effector cysteine hydrolase SpvD	NA	NA	NA	NA	NA
AYB09433.1|113375_114080_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYB09434.1|114070_114280_+	hypothetical protein	NA	NA	NA	NA	NA
AYB09435.1|114279_114936_+	hypothetical protein	NA	NA	NA	NA	NA
AYB09436.1|114991_115609_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
