The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	0	7954	4868095		Trichoplusia_ni_ascovirus(33.33%)	9	NA	NA
AYB24069.1|468_1344_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
AYB24070.1|1343_2177_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
AYB24071.1|2176_3193_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYB24072.1|3350_4142_-	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.5e-17
AYB24073.1|4379_5279_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	33.3	3.8e-25
AYB24074.1|5373_5949_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AYB24075.1|6010_6460_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AYB24076.1|6446_6983_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AYB24077.1|7084_7954_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.8e-17
>prophage 2
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	28567	29518	4868095		Cyanophage(100.0%)	1	NA	NA
AYB24098.1|28567_29518_+	transaldolase A	NA	A0A127KNC6	Cyanophage	30.3	8.2e-10
>prophage 3
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	48141	48855	4868095		Synechococcus_phage(100.0%)	1	NA	NA
AYB24112.1|48141_48855_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.5	9.1e-38
>prophage 4
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	52193	53333	4868095		Streptococcus_phage(100.0%)	1	NA	NA
AYB24117.1|52193_53333_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.8	7.2e-45
>prophage 5
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	58916	64190	4868095		uncultured_Caudovirales_phage(25.0%)	7	NA	NA
AYB24122.1|58916_59276_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.6	1.1e-18
AYB24123.1|59302_60028_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
AYB24124.1|60098_61388_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.6	5.1e-63
AYB24125.1|61475_62102_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AYB24126.1|62300_62480_+	hypothetical protein	NA	NA	NA	NA	NA
AYB24127.1|62514_63552_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.8	2.9e-69
AYB24128.1|63551_64190_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	43.4	7.4e-31
>prophage 6
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	70652	70844	4868095		Escherichia_phage(100.0%)	1	NA	NA
AYB24133.1|70652_70844_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	84.1	6.4e-23
>prophage 7
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	74044	82843	4868095		Klosneuvirus(33.33%)	3	NA	NA
AYB24136.1|74044_75511_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.0e-88
AYB24137.1|75671_77021_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.6	4.4e-41
AYB24138.1|77182_82843_-	fibronectin-binding autotransporter adhesin ShdA	NA	A0A2L1IV18	Escherichia_phage	26.7	4.2e-29
>prophage 8
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	109156	112003	4868095		Powai_lake_megavirus(50.0%)	4	NA	NA
AYB24149.1|109156_109588_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	1.1e-17
AYB24150.1|109708_110572_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AYB24151.1|110571_111381_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AYB24152.1|111373_112003_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.9	3.6e-62
>prophage 9
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	125202	131767	4868095		Mycoplasma_phage(20.0%)	8	NA	NA
AYB24158.1|125202_126486_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.2	1.2e-35
AYB24159.1|126663_126864_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
AYB24160.1|126875_127211_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AYB24161.1|127212_129063_-	molecular chaperone HscA	NA	A0A167RF67	Powai_lake_megavirus	39.1	2.7e-102
AYB24162.1|129075_129591_-	co-chaperone protein HscB	NA	NA	NA	NA	NA
AYB24163.1|129786_130110_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.1e-22
AYB24164.1|130138_130525_-	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	2.4e-53
AYB24165.1|130552_131767_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
>prophage 10
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	142631	143885	4868095		Aeromonas_phage(100.0%)	1	NA	NA
AYB24176.1|142631_143885_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
>prophage 11
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	151100	161092	4868095		Bacillus_phage(50.0%)	6	NA	NA
AYB24181.1|151100_152561_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.3e-46
AYB24182.1|152609_152948_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AYB24183.1|153024_154362_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
AYB24184.1|154358_155123_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AYB24185.1|155124_156510_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	1.5e-15
AYB24186.1|157204_161092_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	8.0e-128
>prophage 12
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	169671	177517	4868095		Lactobacillus_phage(25.0%)	9	NA	NA
AYB24195.1|169671_170598_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
AYB24196.1|170635_170896_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
AYB24197.1|171007_171388_-	holo-ACP synthase	NA	NA	NA	NA	NA
AYB24198.1|171387_172119_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AYB24199.1|172130_172859_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AYB24200.1|172870_173776_-	GTPase Era	NA	NA	NA	NA	NA
AYB28495.1|173772_174453_-	ribonuclease 3	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
AYB24201.1|174726_175701_-	S26 family signal peptidase	NA	NA	NA	NA	NA
AYB24202.1|175717_177517_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
>prophage 13
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	182489	287324	4868095	portal,tRNA,tail,lysis,transposase,head,plate,capsid,integrase	Salmonella_phage(70.59%)	94	252674:252692	296994:297012
AYB24210.1|182489_183227_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
AYB24211.1|183356_184691_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AYB28496.1|184708_185608_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB24212.1|185710_186298_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
AYB24213.1|186359_186743_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	71.8	6.1e-33
AYB24214.1|187061_187751_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AYB24215.1|187866_188904_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AYB24216.1|189107_189527_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
AYB24217.1|189599_190280_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AYB24218.1|190333_192994_+	protein lysine acetyltransferase Pat	NA	NA	NA	NA	NA
AYB24219.1|193108_194464_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AYB24220.1|194508_194832_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
AYB24221.1|194828_196130_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.8e-44
AYB24222.1|196233_196689_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
AYB24223.1|202468_205042_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
AYB24224.1|205171_205903_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AYB24225.1|205899_206880_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AYB24226.1|207011_207749_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AYB24227.1|208020_208359_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AYB28497.1|208462_208510_+	hypothetical protein	NA	NA	NA	NA	NA
AYB24228.1|208609_209770_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AYB24229.1|209730_210639_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AYB24230.1|210696_211818_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AYB24231.1|211827_212898_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
AYB24232.1|213337_213856_+	YfiR family protein	NA	NA	NA	NA	NA
AYB24233.1|213848_215069_+	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
AYB24234.1|215226_215574_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AYB24235.1|215614_216382_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AYB28498.1|216426_216975_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYB24236.1|216993_217242_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYB24237.1|217494_218856_-	signal recognition particle protein	NA	NA	NA	NA	NA
AYB24238.1|219021_219813_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYB24239.1|219877_221119_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYB24240.1|221239_221845_+	cytoplasmic protein	NA	NA	NA	NA	NA
AYB28499.1|221879_222470_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYB24241.1|222593_223472_+	NAD(+) kinase	NA	NA	NA	NA	NA
AYB24242.1|223557_225219_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AYB24243.1|225367_225706_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYB24244.1|225871_226162_-	RnfH family protein	NA	NA	NA	NA	NA
AYB24245.1|226151_226628_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYB28500.1|226777_227260_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AYB24246.1|227874_239094_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AYB24247.1|239158_240568_+	type I secretion protein TolC	NA	NA	NA	NA	NA
AYB28501.1|242747_243911_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYB28502.1|244462_244681_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
AYB24248.1|244749_245850_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.6	9.0e-194
AYB24249.1|245846_246332_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
AYB24250.1|246328_249136_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.0	0.0e+00
AYB24251.1|249128_249248_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
AYB24252.1|249262_249565_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
AYB24253.1|249619_250135_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYB24254.1|250144_251317_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	1.3e-222
AYB24255.1|251447_251975_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
AYB24256.1|251977_253663_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	50.6	3.5e-128
252674:252692	attL	AAACAATACGTTATTGCCA	NA	NA	NA	NA
AYB24257.1|253659_254265_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
AYB24258.1|254257_255166_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	98.0	7.2e-157
AYB24259.1|255152_255512_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	91.5	3.5e-54
AYB24260.1|255508_256087_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.8e-92
AYB24261.1|256182_257049_+	hypothetical protein	NA	NA	NA	NA	NA
AYB24262.1|257075_257522_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.1	3.1e-60
AYB24263.1|257514_257946_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
AYB24264.1|257908_258112_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	73.1	8.9e-23
AYB24265.1|258041_258470_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.1	1.3e-47
AYB24266.1|258466_258844_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	5.1e-16
AYB28503.1|258845_259319_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYB24267.1|259338_259554_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYB24268.1|259557_259761_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYB24269.1|259760_260225_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
AYB24270.1|260320_260971_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYB24271.1|260974_262033_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	4.9e-181
AYB24272.1|262049_262883_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	84.5	5.9e-121
AYB24273.1|263025_264792_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
AYB24274.1|264791_265823_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.0	5.0e-170
AYB24275.1|266602_267757_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYB24276.1|268249_269056_+	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.8	6.2e-51
AYB24277.1|269166_269466_+	hypothetical protein	NA	NA	NA	NA	NA
AYB24278.1|269534_269723_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
AYB24279.1|269878_272275_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.9	0.0e+00
AYB24280.1|272271_273129_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	99.6	1.5e-164
AYB24281.1|273125_273353_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
AYB24282.1|273352_273586_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
AYB24283.1|273653_273995_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
AYB24284.1|274214_274673_+	hypothetical protein	NA	NA	NA	NA	NA
AYB24285.1|274620_274854_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
AYB24286.1|275407_275647_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
AYB24287.1|275763_276396_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.1e-66
AYB24288.1|276399_277425_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	99.1	9.2e-201
AYB24289.1|277684_278278_+	hypothetical protein	NA	NA	NA	NA	NA
AYB24290.1|278676_279480_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
AYB24291.1|280275_281387_-|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
AYB24292.1|281936_282218_+	hypothetical protein	NA	NA	NA	NA	NA
AYB24293.1|282184_282367_+	hypothetical protein	NA	NA	NA	NA	NA
AYB24294.1|282471_283587_+	DUF1205 domain-containing protein	NA	NA	NA	NA	NA
AYB24295.1|283667_287324_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	7.9e-45
296994:297012	attR	AAACAATACGTTATTGCCA	NA	NA	NA	NA
>prophage 14
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	307688	311692	4868095		Klosneuvirus(50.0%)	4	NA	NA
AYB24311.1|307688_308972_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.1	2.1e-32
AYB24312.1|309101_310502_+	GABA permease	NA	NA	NA	NA	NA
AYB24313.1|310543_311221_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
AYB24314.1|311242_311692_-	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
>prophage 15
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	318189	323244	4868095		Bacillus_phage(25.0%)	4	NA	NA
AYB24328.1|318189_318600_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	3.3e-16
AYB24329.1|318572_320717_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.6	9.9e-197
AYB24330.1|320727_321687_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.5	5.2e-129
AYB24331.1|322041_323244_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.8	1.4e-27
>prophage 16
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	335080	342315	4868095	tRNA	Acanthocystis_turfacea_Chlorella_virus(20.0%)	8	NA	NA
AYB24342.1|335080_335647_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
AYB24343.1|336480_336756_+	hypothetical protein	NA	NA	NA	NA	NA
AYB24344.1|336768_336954_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AYB24345.1|337188_339819_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.1	1.0e-78
AYB24346.1|339851_340058_-	hypothetical protein	NA	NA	NA	NA	NA
AYB24347.1|340054_340555_-	regulatory protein RecX	NA	NA	NA	NA	NA
AYB24348.1|340671_341733_-	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	3.0e-114
AYB28505.1|341817_342315_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.6	4.4e-31
>prophage 17
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	348222	349188	4868095		Tetraselmis_virus(100.0%)	1	NA	NA
AYB24357.1|348222_349188_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.5	8.8e-36
>prophage 18
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	373104	373926	4868095		Brazilian_cedratvirus(100.0%)	1	NA	NA
AYB24382.1|373104_373926_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	2.3e-13
>prophage 19
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	407417	409106	4868095		Vibrio_phage(100.0%)	1	NA	NA
AYB24419.1|407417_409106_-	type III secretion system outer membrane ring protein InvG	NA	R9TEZ5	Vibrio_phage	27.8	3.9e-15
>prophage 20
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	413032	418761	4868095		Escherichia_phage(50.0%)	5	NA	NA
AYB24423.1|413032_413689_+	Serine/threonine-protein phosphatase 2	NA	Q71TJ1	Escherichia_phage	47.9	7.8e-52
AYB24424.1|413860_414355_-	hypothetical protein	NA	NA	NA	NA	NA
AYB24425.1|414381_415050_-	hypothetical protein	NA	NA	NA	NA	NA
AYB24426.1|415624_416035_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYB24427.1|416193_418761_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.2	1.1e-29
>prophage 21
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	424726	435153	4868095		Escherichia_phage(50.0%)	12	NA	NA
AYB24433.1|424726_425365_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.8e-85
AYB24434.1|425361_426624_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.8	1.7e-132
AYB24435.1|426617_427541_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	77.4	1.7e-116
AYB24436.1|427737_428502_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.5	1.1e-70
AYB24437.1|428520_428925_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYB24438.1|429095_429689_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
AYB24439.1|429688_431116_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
AYB24440.1|431126_431363_+	hypothetical protein	NA	NA	NA	NA	NA
AYB24441.1|431407_432400_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AYB24442.1|432462_433596_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
AYB24443.1|433771_434398_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	4.8e-35
AYB24444.1|434391_435153_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.8	1.4e-57
>prophage 22
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	438263	440295	4868095		Tupanvirus(50.0%)	2	NA	NA
AYB24450.1|438263_438869_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	39.6	1.3e-29
AYB24451.1|438855_440295_-	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	26.5	2.7e-33
>prophage 23
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	459401	463227	4868095		Vibrio_phage(33.33%)	3	NA	NA
AYB24466.1|459401_460073_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.9e-14
AYB24467.1|460208_461507_-	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	3.4e-131
AYB24468.1|461589_463227_-	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.0	1.2e-154
>prophage 24
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	474278	479574	4868095		Erysipelothrix_phage(33.33%)	3	NA	NA
AYB24478.1|474278_475574_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.3	8.2e-37
AYB24479.1|475631_478388_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.4	3.9e-52
AYB24480.1|478431_479574_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.6	2.6e-47
>prophage 25
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	486993	487842	4868095		Vibrio_phage(100.0%)	1	NA	NA
AYB24487.1|486993_487842_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 26
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	492708	493524	4868095		Bacillus_phage(100.0%)	1	NA	NA
AYB24491.1|492708_493524_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	30.6	9.2e-10
>prophage 27
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	505066	521645	4868095	tRNA	environmental_halophage(16.67%)	10	NA	NA
AYB24503.1|505066_506272_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	7.3e-72
AYB24504.1|506271_506715_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AYB28513.1|507014_507902_+	EamA family transporter RarD	NA	NA	NA	NA	NA
AYB24505.1|507953_508760_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	6.5e-16
AYB24506.1|508869_509967_-	murein transglycosylase A	NA	NA	NA	NA	NA
AYB24507.1|510466_511720_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	29.4	1.5e-14
AYB24508.1|511952_513284_+	N-acetylglutamate synthase	NA	NA	NA	NA	NA
AYB24509.1|513386_515222_-	exodeoxyribonuclease V subunit alpha	NA	A0A2P0VMS9	Tetraselmis_virus	25.2	3.2e-18
AYB24510.1|515218_518764_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.6	1.4e-09
AYB24511.1|518756_521645_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.8	1.3e-61
>prophage 28
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	527127	534082	4868095		Cronobacter_phage(33.33%)	6	NA	NA
AYB24518.1|527127_527922_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.2	2.6e-118
AYB24519.1|527928_528804_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AYB24520.1|529019_531266_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	25.1	1.3e-10
AYB24521.1|531278_531809_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AYB24522.1|532491_533187_+	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AYB24523.1|533368_534082_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	6.9e-46
>prophage 29
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	544912	547446	4868095		Aichi_virus(50.0%)	2	NA	NA
AYB24533.1|544912_546331_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.5	3.0e-24
AYB24534.1|546684_547446_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.0e-18
>prophage 30
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	562232	562769	4868095		Enterobacteria_phage(100.0%)	1	NA	NA
AYB24550.1|562232_562769_-	porin family protein	NA	A5LH44	Enterobacteria_phage	30.7	5.6e-16
>prophage 31
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	566032	573779	4868095	tRNA	Clostridium_phage(20.0%)	8	NA	NA
AYB24556.1|566032_566791_-	LysM peptidoglycan-binding domain-containing protein	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
AYB24557.1|566816_567005_+	hypothetical protein	NA	NA	NA	NA	NA
AYB24558.1|567055_567601_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AYB24559.1|567676_569194_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	4.8e-89
AYB24560.1|569203_570302_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AYB24561.1|570406_572140_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.4	1.4e-63
AYB24562.1|572145_572859_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AYB24563.1|572882_573779_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.9	1.4e-30
>prophage 32
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	577761	583465	4868095		Pandoravirus(50.0%)	4	NA	NA
AYB24572.1|577761_579195_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.2	8.8e-32
AYB24573.1|579242_580136_-	transporter	NA	NA	NA	NA	NA
AYB24574.1|580219_580366_-	immunoglobulin	NA	NA	NA	NA	NA
AYB24575.1|580591_583465_-	glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.1	1.4e-262
>prophage 33
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	591733	592966	4868095		Catovirus(100.0%)	1	NA	NA
AYB24584.1|591733_592966_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.6	1.2e-101
>prophage 34
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	604154	604811	4868095		Bacillus_virus(100.0%)	1	NA	NA
AYB24597.1|604154_604811_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.2	4.3e-10
>prophage 35
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	612827	614300	4868095		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AYB24604.1|612827_614300_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.2	1.5e-47
>prophage 36
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	620118	621273	4868095		Staphylococcus_phage(100.0%)	1	NA	NA
AYB24609.1|620118_621273_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	5.1e-131
>prophage 37
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	638585	639668	4868095		Geobacillus_virus(100.0%)	1	NA	NA
AYB24630.1|638585_639668_+	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
>prophage 38
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	661572	662451	4868095		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AYB24649.1|661572_662451_-	amidohydrolase	NA	M1HPY5	Paramecium_bursaria_Chlorella_virus	28.4	3.5e-07
>prophage 39
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	665850	667323	4868095		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AYB24652.1|665850_667323_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	6.0e-44
>prophage 40
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	682743	687884	4868095		uncultured_Caudovirales_phage(50.0%)	6	NA	NA
AYB24669.1|682743_684387_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.7	1.1e-09
AYB24670.1|684693_685188_-	TIGR00645 family protein	NA	NA	NA	NA	NA
AYB24671.1|685467_685983_-	RNA helicase	NA	NA	NA	NA	NA
AYB24672.1|686074_686485_+	hypothetical protein	NA	NA	NA	NA	NA
AYB24673.1|686471_686876_+	cytoplasmic protein	NA	NA	NA	NA	NA
AYB24674.1|686999_687884_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	48.2	1.5e-66
>prophage 41
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	693825	699530	4868095		Staphylococcus_phage(33.33%)	5	NA	NA
AYB24682.1|693825_694653_+	2,5-diketo-D-gluconic acid reductase A	NA	A0A2H4PQR8	Staphylococcus_phage	46.0	8.6e-64
AYB24683.1|694849_696304_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
AYB24684.1|696348_696804_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.8	2.4e-20
AYB24685.1|696961_697156_-	hypothetical protein	NA	NA	NA	NA	NA
AYB24686.1|697358_699530_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.8	2.0e-104
>prophage 42
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	705368	709068	4868095		Bacillus_virus(50.0%)	3	NA	NA
AYB24692.1|705368_707627_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.0	1.0e-87
AYB24693.1|707737_708604_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYB24694.1|708675_709068_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	48.1	1.6e-20
>prophage 43
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	712383	714276	4868095		Bacillus_virus(100.0%)	1	NA	NA
AYB24699.1|712383_714276_-	DNA topoisomerase 4 subunit B	NA	G3M9Z3	Bacillus_virus	34.8	5.3e-93
>prophage 44
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	718676	720517	4868095		Erwinia_phage(50.0%)	2	NA	NA
AYB24705.1|718676_719348_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.9	5.7e-34
AYB24706.1|719353_720517_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	1.4e-88
>prophage 45
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	726273	726927	4868095		Staphylococcus_phage(100.0%)	1	NA	NA
AYB24713.1|726273_726927_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.6e-44
>prophage 46
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	730978	732412	4868095		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYB24719.1|730978_732412_-	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.6	3.9e-40
>prophage 47
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	737640	752695	4868095	tRNA	Sinorhizobium_phage(16.67%)	14	NA	NA
AYB24723.1|737640_738882_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	47.9	6.5e-92
AYB24724.1|738985_739807_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AYB24725.1|739904_740264_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AYB24726.1|740370_740982_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AYB24727.1|740989_741328_+	hypothetical protein	NA	NA	NA	NA	NA
AYB24728.1|741231_742245_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
AYB24729.1|742472_742688_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AYB24730.1|742922_744668_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.9	4.7e-72
AYB28519.1|744817_746665_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AYB24731.1|746788_747295_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AYB24732.1|747575_748343_-	siderophore-interacting protein	NA	NA	NA	NA	NA
AYB24733.1|748574_749222_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AYB24734.1|749218_750787_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.2e-12
AYB24735.1|751174_752695_-	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
>prophage 48
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	760693	761662	4868095		Enterobacteria_phage(100.0%)	1	NA	NA
AYB24742.1|760693_761662_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
>prophage 49
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	774856	777151	4868095		Tetraselmis_virus(100.0%)	1	NA	NA
AYB24758.1|774856_777151_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	9.7e-158
>prophage 50
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	783063	784209	4868095		Streptococcus_phage(100.0%)	1	NA	NA
AYB24764.1|783063_784209_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.6	3.5e-47
>prophage 51
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	794896	801545	4868095		Streptococcus_phage(25.0%)	9	NA	NA
AYB24773.1|794896_795760_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.6	1.1e-50
AYB24774.1|795823_797866_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
AYB24775.1|797823_798219_+	YraN family protein	NA	NA	NA	NA	NA
AYB24776.1|798240_798831_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.9	7.1e-12
AYB24777.1|798840_799416_+	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AYB24778.1|799482_800118_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AYB24779.1|800248_800767_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	28.2	9.0e-11
AYB24780.1|800746_801190_-	hypothetical protein	NA	NA	NA	NA	NA
AYB24781.1|801227_801545_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	50.0	6.5e-12
>prophage 52
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	808681	810622	4868095		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AYB24790.1|808681_810622_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.5	3.0e-51
>prophage 53
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	816106	822763	4868095		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
AYB24795.1|816106_818785_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.9e-24
AYB24796.1|818809_820312_-	transcription termination protein NusA	NA	NA	NA	NA	NA
AYB24797.1|820339_820804_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AYB24798.1|821419_822763_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	4.8e-64
>prophage 54
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	825949	828837	4868095	protease	Pandoravirus(50.0%)	2	NA	NA
AYB24802.1|825949_826798_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	30.3	1.4e-21
AYB24803.1|826902_828837_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.1	2.0e-116
>prophage 55
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	835549	837040	4868095		Indivirus(50.0%)	2	NA	NA
AYB24812.1|835549_836521_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	7.8e-08
AYB24813.1|836752_837040_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	68.7	3.5e-17
>prophage 56
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	841149	856056	4868095		Staphylococcus_phage(25.0%)	17	NA	NA
AYB24819.1|841149_841962_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.2	9.7e-20
AYB24820.1|842174_843152_+	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	22.9	1.5e-06
AYB24821.1|843165_844152_+	arabinose 5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	1.1e-38
AYB24822.1|844172_844739_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	74.3	3.6e-53
AYB24823.1|844735_845311_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AYB24824.1|845279_845834_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AYB24825.1|845840_846566_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	7.1e-22
AYB24826.1|846613_848047_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AYB24827.1|848069_848357_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AYB24828.1|848474_848966_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AYB24829.1|849011_849866_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AYB24830.1|849862_850135_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
AYB24831.1|850384_851017_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
AYB24832.1|851091_851820_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AYB24833.1|851816_852470_-	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AYB24834.1|852696_855033_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.9	2.1e-38
AYB24835.1|855126_856056_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.2	1.5e-16
>prophage 57
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	862823	863927	4868095		Salmonella_phage(100.0%)	1	NA	NA
AYB24838.1|862823_863927_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.1	1.9e-74
>prophage 58
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	868716	872751	4868095	protease	Burkholderia_virus(50.0%)	4	NA	NA
AYB24844.1|868716_870207_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	21.9	2.7e-07
AYB24845.1|870322_871216_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AYB24846.1|871350_872142_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
AYB24847.1|872250_872751_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
>prophage 59
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	877619	878987	4868095	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYB28527.1|877619_878987_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.3	2.7e-22
>prophage 60
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	885843	887112	4868095		Oenococcus_phage(100.0%)	1	NA	NA
AYB24860.1|885843_887112_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.0	1.1e-59
>prophage 61
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	905567	906611	4868095		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AYB24878.1|905567_906611_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 62
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	918695	922077	4868095		Ostreococcus_lucimarinus_virus(50.0%)	3	NA	NA
AYB24891.1|918695_919580_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	1.3e-25
AYB24892.1|919662_919827_+	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
AYB24893.1|919977_922077_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.5	7.1e-22
>prophage 63
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	936116	940436	4868095	tRNA	Pandoravirus(33.33%)	6	NA	NA
AYB24899.1|936116_936689_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
AYB24900.1|936693_937236_-	DNA topoisomerase	NA	NA	NA	NA	NA
AYB24901.1|937262_937736_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AYB24902.1|937707_938832_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AYB24903.1|938963_939473_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
AYB24904.1|939488_940436_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	6.5e-07
>prophage 64
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	960329	965900	4868095		Tupanvirus(33.33%)	7	NA	NA
AYB24944.1|960329_961514_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
AYB24945.1|961585_963700_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	8.1e-58
AYB24946.1|963796_964267_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
AYB24947.1|964362_964737_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
AYB24948.1|964862_965150_-	sulfurtransferase TusB	NA	NA	NA	NA	NA
AYB24949.1|965157_965514_-	sulfurtransferase TusC	NA	NA	NA	NA	NA
AYB24950.1|965513_965900_-	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	40.6	2.1e-20
>prophage 65
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	971859	973767	4868095		Tupanvirus(100.0%)	1	NA	NA
AYB24959.1|971859_973767_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.7	2.2e-75
>prophage 66
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	978352	982349	4868095		environmental_Halophage(50.0%)	3	NA	NA
AYB24966.1|978352_980440_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	89.1	4.2e-67
AYB24967.1|980482_981700_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AYB24968.1|981785_982349_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	3.2e-62
>prophage 67
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	999857	1000694	4868095		Vibrio_phage(100.0%)	1	NA	NA
AYB24981.1|999857_1000694_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.7	1.9e-66
>prophage 68
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1017735	1021498	4868095		Bacillus_phage(66.67%)	3	NA	NA
AYB24996.1|1017735_1019355_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	53.3	1.2e-141
AYB24997.1|1019429_1020782_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	22.9	9.5e-12
AYB24998.1|1020778_1021498_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 69
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1028110	1029037	4868095	transposase	Sodalis_phage(100.0%)	1	NA	NA
AYB25005.1|1028110_1029037_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.1	4.4e-69
>prophage 70
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1035097	1037491	4868095		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AYB25011.1|1035097_1037491_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	4.7e-14
>prophage 71
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1042539	1045655	4868095		Ralstonia_phage(50.0%)	2	NA	NA
AYB25015.1|1042539_1043754_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.6	1.6e-135
AYB25016.1|1044101_1045655_-	TROVE domain-containing protein	NA	R4TL80	Halovirus	25.9	4.4e-29
>prophage 72
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1059890	1062338	4868095		Dickeya_phage(100.0%)	1	NA	NA
AYB25028.1|1059890_1062338_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 73
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1083720	1085528	4868095		Enterococcus_phage(50.0%)	2	NA	NA
AYB25047.1|1083720_1084461_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	1.4e-09
AYB25048.1|1084457_1085528_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.5	2.0e-20
>prophage 74
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1089655	1091138	4868095		Planktothrix_phage(50.0%)	2	NA	NA
AYB25054.1|1089655_1090369_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.7e-15
AYB25055.1|1090370_1091138_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	7.5e-14
>prophage 75
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1096929	1108592	4868095		Dickeya_phage(28.57%)	12	NA	NA
AYB25062.1|1096929_1097784_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.3	7.0e-45
AYB25063.1|1098029_1099085_-	cell division protein FtsX	NA	NA	NA	NA	NA
AYB25064.1|1099077_1099746_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	1.9e-13
AYB25065.1|1099748_1101224_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
AYB25066.1|1101349_1101946_+	16S rRNA (guanine(966)-N(2))-methyltransferase	NA	NA	NA	NA	NA
AYB25067.1|1101932_1102205_+	DUF1145 family protein	NA	NA	NA	NA	NA
AYB25068.1|1102226_1102598_-	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
AYB25069.1|1102739_1103366_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	64.6	3.8e-32
AYB25070.1|1103446_1105645_+	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	36.0	2.9e-111
AYB25071.1|1105844_1107488_+	methyl-accepting chemotaxis citrate transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.4	1.8e-12
AYB28532.1|1107511_1107757_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
AYB28533.1|1107926_1108592_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	54.9	1.6e-57
>prophage 76
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1124939	1126982	4868095		Indivirus(100.0%)	1	NA	NA
AYB25084.1|1124939_1126982_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	3.6e-47
>prophage 77
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1141697	1142600	4868095		Burkholderia_virus(100.0%)	1	NA	NA
AYB25097.1|1141697_1142600_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.5	3.4e-05
>prophage 78
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1171329	1173323	4868095		Bacillus_virus(50.0%)	2	NA	NA
AYB25117.1|1171329_1172343_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	9.6e-17
AYB25118.1|1172339_1173323_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	6.7e-15
>prophage 79
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1191464	1200647	4868095		Escherichia_phage(25.0%)	11	NA	NA
AYB25135.1|1191464_1193798_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.4	9.8e-73
AYB25136.1|1193950_1194613_+	OmpA family lipoprotein	NA	NA	NA	NA	NA
AYB25137.1|1194831_1195806_+	bifunctional glyoxylate/hydroxypyruvate reductase B	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	27.1	5.4e-17
AYB25138.1|1195855_1196566_-	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
AYB25139.1|1197004_1197295_+	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
AYB25140.1|1197582_1197795_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
AYB25141.1|1197968_1198508_+	hypothetical protein	NA	NA	NA	NA	NA
AYB25142.1|1198878_1199364_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYB25143.1|1199351_1199639_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AYB25144.1|1199816_1200284_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYB25145.1|1200497_1200647_-	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	69.4	3.6e-13
>prophage 80
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1204840	1205836	4868095		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AYB25150.1|1204840_1205836_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.8	8.3e-13
>prophage 81
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1232319	1234170	4868095	tRNA	Tupanvirus(100.0%)	1	NA	NA
AYB25175.1|1232319_1234170_-|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	24.3	6.5e-11
>prophage 82
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1257671	1267173	4868095		Rhizobium_phage(16.67%)	9	NA	NA
AYB25197.1|1257671_1257923_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
AYB25198.1|1258009_1258441_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AYB25199.1|1258688_1260233_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AYB25200.1|1260242_1261526_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	6.1e-08
AYB25201.1|1261529_1262492_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AYB25202.1|1262478_1263513_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.3	1.1e-07
AYB25203.1|1263806_1264832_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
AYB25204.1|1264841_1266038_-	2-amino-3-ketobutyrate CoA ligase	NA	V5LQ39	Emiliania_huxleyi_virus	30.0	1.9e-35
AYB25205.1|1266240_1267173_+	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	E3SL51	Synechococcus_phage	37.2	5.5e-35
>prophage 83
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1281550	1286104	4868095		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
AYB25218.1|1281550_1282030_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.2e-28
AYB25219.1|1282057_1282867_-	formamidopyrimidine-DNA glycosylase	NA	F8WPX6	Bacillus_phage	31.8	1.3e-24
AYB25220.1|1282964_1283132_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AYB25221.1|1283152_1283389_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AYB25222.1|1283606_1284272_-	JAB domain-containing protein	NA	NA	NA	NA	NA
AYB25223.1|1284447_1285668_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.1	7.2e-43
AYB28535.1|1285648_1286104_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.2e-48
>prophage 84
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1292082	1297108	4868095		Pseudomonas_phage(33.33%)	4	NA	NA
AYB25231.1|1292082_1293768_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.0	8.2e-21
AYB25232.1|1294024_1294648_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.8e-19
AYB25233.1|1294702_1294978_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AYB25234.1|1294996_1297108_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 85
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1301357	1302749	4868095		environmental_Halophage(100.0%)	1	NA	NA
AYB25238.1|1301357_1302749_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	95.9	6.7e-69
>prophage 86
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1311833	1317729	4868095		Wolbachia_phage(50.0%)	3	NA	NA
AYB25243.1|1311833_1312871_+	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	43.4	5.5e-68
AYB25244.1|1314169_1314787_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AYB25245.1|1314861_1317729_+	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	44.3	5.0e-95
>prophage 87
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1321581	1327618	4868095	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
AYB25251.1|1321581_1324308_-	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.1	1.2e-34
AYB25252.1|1324527_1325223_-	protein MgtC	NA	G3MA03	Bacillus_virus	42.4	2.8e-15
AYB28539.1|1325731_1326634_+	EamA family transporter	NA	NA	NA	NA	NA
AYB25253.1|1326676_1327618_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	4.7e-66
>prophage 88
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1335982	1337365	4868095		Pandoravirus(100.0%)	1	NA	NA
AYB25263.1|1335982_1337365_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.1	1.2e-41
>prophage 89
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1350314	1355271	4868095		Micromonas_pusilla_virus(50.0%)	5	NA	NA
AYB25277.1|1350314_1352003_-	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	30.7	4.2e-57
AYB25278.1|1352109_1352208_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AYB25279.1|1352841_1352931_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AYB25280.1|1353023_1353884_+	EamA family transporter	NA	NA	NA	NA	NA
AYB25281.1|1354086_1355271_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.1	9.8e-13
>prophage 90
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1363774	1364726	4868095		Synechococcus_phage(50.0%)	2	NA	NA
AYB25289.1|1363774_1364203_-	heat-shock protein IbpB	NA	A0A1D8KPX5	Synechococcus_phage	38.2	1.7e-15
AYB28541.1|1364312_1364726_-	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	37.0	1.0e-17
>prophage 91
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1372369	1386180	4868095		Brazilian_cedratvirus(20.0%)	10	NA	NA
AYB28542.1|1372369_1372987_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	1.8e-10
AYB25299.1|1372992_1374393_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AYB25300.1|1374582_1375215_-	molecular chaperone TorD	NA	NA	NA	NA	NA
AYB25301.1|1375207_1377760_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.2	4.8e-73
AYB25302.1|1377749_1378934_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AYB28543.1|1379063_1379756_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	3.8e-17
AYB25303.1|1379728_1380769_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AYB25304.1|1380848_1383584_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.2	1.4e-33
AYB25305.1|1383609_1384947_-	MFS transporter	NA	NA	NA	NA	NA
AYB25306.1|1385031_1386180_-	D-galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	8.0e-52
>prophage 92
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1391028	1400819	4868095		Oenococcus_phage(25.0%)	9	NA	NA
AYB25312.1|1391028_1392222_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.7	6.2e-47
AYB25313.1|1392336_1393233_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB25314.1|1393251_1395666_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.6	2.2e-115
AYB25315.1|1395694_1396768_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AYB25316.1|1396915_1398016_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.7	4.1e-53
AYB25317.1|1398020_1399421_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AYB25318.1|1400081_1400222_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
AYB25319.1|1400238_1400598_+	ribonuclease P protein component	NA	NA	NA	NA	NA
AYB25320.1|1400561_1400819_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 93
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1407812	1414704	4868095		Moraxella_phage(33.33%)	7	NA	NA
AYB25326.1|1407812_1409276_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.1	1.2e-63
AYB25327.1|1409318_1409984_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AYB25328.1|1410078_1410804_-	phosphate transport system regulator PhoU	NA	NA	NA	NA	NA
AYB28545.1|1410818_1411592_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	2.0e-14
AYB25329.1|1411678_1412569_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
AYB25330.1|1412568_1413528_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
AYB25331.1|1413663_1414704_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	36.2	4.1e-47
>prophage 94
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1419111	1422500	4868095		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
AYB25334.1|1419111_1420941_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	6.2e-131
AYB25335.1|1421129_1422500_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.7	8.7e-37
>prophage 95
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1435383	1436376	4868095		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AYB25349.1|1435383_1436376_+	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	3.2e-49
>prophage 96
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1439669	1443687	4868095		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
AYB25352.1|1439669_1441538_+	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.5e-63
AYB25353.1|1441754_1442174_+	D-ribose pyranase	NA	NA	NA	NA	NA
AYB28548.1|1442181_1443687_+	ribose import ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	5.1e-14
>prophage 97
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1459086	1460733	4868095		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AYB25364.1|1459086_1460733_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	3.1e-65
>prophage 98
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1466093	1466435	4868095		Pseudomonas_phage(100.0%)	1	NA	NA
AYB25369.1|1466093_1466435_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	38.5	1.7e-05
>prophage 99
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1469875	1475296	4868095		Bacillus_phage(33.33%)	5	NA	NA
AYB25374.1|1469875_1471900_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.3	1.1e-112
AYB25375.1|1471939_1473421_-	guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase	NA	NA	NA	NA	NA
AYB25376.1|1473426_1473549_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AYB25377.1|1473557_1474823_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.4	4.1e-41
AYB25378.1|1474966_1475296_+	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 100
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1479420	1484924	4868095		Enterobacteria_phage(40.0%)	6	NA	NA
AYB25382.1|1479420_1480551_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.7	2.3e-27
AYB25383.1|1480547_1481810_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1H3J6	Paramecium_bursaria_Chlorella_virus	27.0	1.2e-24
AYB25384.1|1481809_1482877_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	1.4e-98
AYB25385.1|1482909_1483134_+	sugar nucleotidyltransferase	NA	I7I009	Enterobacteria_phage	52.2	2.0e-07
AYB25386.1|1483084_1483789_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AYB25387.1|1483793_1484924_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
>prophage 101
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1502361	1506278	4868095		Bacillus_phage(100.0%)	3	NA	NA
AYB25404.1|1502361_1503264_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	31.0	5.9e-26
AYB25405.1|1503263_1503980_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AYB25406.1|1504115_1506278_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.1	1.7e-116
>prophage 102
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1511154	1512984	4868095		Catovirus(100.0%)	1	NA	NA
AYB28552.1|1511154_1512984_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	5.9e-81
>prophage 103
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1527228	1530663	4868095		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AYB25427.1|1527228_1528869_+	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.5	3.4e-40
AYB25428.1|1529074_1529329_+	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AYB25429.1|1529332_1529881_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AYB25430.1|1529883_1530663_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.7	1.5e-25
>prophage 104
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1541539	1542154	4868095		Streptococcus_phage(100.0%)	1	NA	NA
AYB25439.1|1541539_1542154_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.3	6.2e-19
>prophage 105
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1554605	1557392	4868095		Enterococcus_phage(100.0%)	1	NA	NA
AYB25447.1|1554605_1557392_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	27.0	1.3e-47
>prophage 106
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1562749	1563799	4868095		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AYB25454.1|1562749_1563799_-	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.0	4.1e-10
>prophage 107
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1582237	1585032	4868095		Staphylococcus_phage(50.0%)	3	NA	NA
AYB25471.1|1582237_1583134_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	100.0	1.5e-66
AYB25472.1|1583298_1584195_+	sugar kinase	NA	NA	NA	NA	NA
AYB25473.1|1584228_1585032_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	7.6e-25
>prophage 108
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1593231	1596282	4868095		Escherichia_phage(100.0%)	1	NA	NA
AYB25485.1|1593231_1596282_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	1.6e-06
>prophage 109
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1615013	1618919	4868095		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
AYB25504.1|1615013_1615634_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
AYB25505.1|1615640_1616393_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AYB25506.1|1616404_1616800_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AYB25507.1|1616850_1618224_-	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	5.5e-15
AYB25508.1|1618220_1618919_-	DNA-binding transcriptional regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 110
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1631982	1633518	4868095		Staphylococcus_phage(100.0%)	1	NA	NA
AYB25522.1|1631982_1633518_+	autoinducer 2 import ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
>prophage 111
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1644351	1648962	4868095		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
AYB25535.1|1644351_1645197_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
AYB25536.1|1645595_1645835_+	cell division protein ZapB	NA	NA	NA	NA	NA
AYB25537.1|1646056_1646542_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AYB25538.1|1646634_1647564_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AYB25539.1|1647630_1648962_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
>prophage 112
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1667056	1668316	4868095		Aeromonas_phage(100.0%)	1	NA	NA
AYB28557.1|1667056_1668316_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	1.0e-100
>prophage 113
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1676413	1679588	4868095		Synechococcus_phage(50.0%)	2	NA	NA
AYB25560.1|1676413_1677076_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.5e-29
AYB25561.1|1677086_1679588_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.4	3.6e-12
>prophage 114
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1700704	1702549	4868095		Acinetobacter_phage(100.0%)	1	NA	NA
AYB25580.1|1700704_1702549_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	30.0	1.7e-11
>prophage 115
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1711205	1714299	4868095		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AYB25584.1|1711205_1712156_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	6.0e-29
AYB25585.1|1712364_1712538_-	hypothetical protein	NA	NA	NA	NA	NA
AYB25586.1|1713114_1714299_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
>prophage 116
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1718419	1731928	4868095		Chrysochromulina_ericina_virus(25.0%)	10	NA	NA
AYB25593.1|1718419_1722448_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
AYB25594.1|1722524_1726748_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	5.0e-67
AYB25595.1|1726830_1727112_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28558.1|1727113_1727434_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYB25596.1|1727529_1727772_+	hypothetical protein	NA	NA	NA	NA	NA
AYB25597.1|1727837_1728866_+	type III secretion system effector arginine glycosyltransferase SseK1	NA	Q8HAB2	Salmonella_phage	60.5	4.0e-103
AYB25598.1|1729086_1730220_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
AYB25599.1|1730216_1730987_-	thiazole synthase	NA	NA	NA	NA	NA
AYB25600.1|1730988_1731189_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AYB25601.1|1731169_1731928_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	28.5	5.9e-11
>prophage 117
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1737283	1739046	4868095		Klosneuvirus(50.0%)	3	NA	NA
AYB25607.1|1737283_1737955_+	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	2.1e-20
AYB25608.1|1737996_1738587_+	DUF416 family protein	NA	NA	NA	NA	NA
AYB25609.1|1738773_1739046_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
>prophage 118
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1744530	1746120	4868095		Prochlorococcus_phage(100.0%)	1	NA	NA
AYB25615.1|1744530_1746120_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	8.4e-68
>prophage 119
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1760015	1763699	4868095		Dickeya_phage(100.0%)	1	NA	NA
AYB25622.1|1760015_1763699_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 120
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1775033	1775381	4868095		Burkholderia_phage(100.0%)	1	NA	NA
AYB25633.1|1775033_1775381_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 121
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1787967	1789077	4868095		Mycoplasma_phage(100.0%)	1	NA	NA
AYB25644.1|1787967_1789077_+	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 122
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1796335	1796944	4868095		Lactococcus_phage(100.0%)	1	NA	NA
AYB25651.1|1796335_1796944_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 123
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1803678	1806205	4868095		Salmonella_phage(50.0%)	2	NA	NA
AYB25659.1|1803678_1805094_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
AYB25660.1|1805125_1806205_+	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	1.2e-28
>prophage 124
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1810300	1813904	4868095		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AYB25668.1|1810300_1813126_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	0.0e+00
AYB25669.1|1813090_1813207_+	hypothetical protein	NA	NA	NA	NA	NA
AYB25670.1|1813373_1813904_+	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	88.9	3.9e-54
>prophage 125
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1848202	1850269	4868095		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AYB25683.1|1848202_1850269_+	peptidase domain-containing ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	23.7	6.3e-15
>prophage 126
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1855156	1856506	4868095		Moraxella_phage(100.0%)	1	NA	NA
AYB25689.1|1855156_1856506_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	6.7e-159
>prophage 127
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1862718	1864677	4868095		Staphylococcus_phage(100.0%)	1	NA	NA
AYB25697.1|1862718_1864677_-	acetyl-coenzyme A synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	1.6e-89
>prophage 128
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1874354	1882725	4868095		Escherichia_phage(25.0%)	8	NA	NA
AYB25707.1|1874354_1876502_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	24.6	5.9e-32
AYB25708.1|1876867_1877776_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	37.1	5.9e-34
AYB25709.1|1878033_1878498_-	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
AYB25710.1|1878619_1879063_-	VOC family metalloprotein YjdN	NA	NA	NA	NA	NA
AYB25711.1|1879182_1879518_-	phnA family protein	NA	NA	NA	NA	NA
AYB25712.1|1879985_1881488_+	proline/betaine transporter	NA	Q6JIH2	Burkholderia_virus	30.5	3.5e-55
AYB25713.1|1881557_1881647_+	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
AYB28564.1|1881654_1882725_-	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	25.3	6.0e-09
>prophage 129
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1900929	1905404	4868095		Escherichia_phage(100.0%)	4	NA	NA
AYB28566.1|1900929_1903329_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	81.6	0.0e+00
AYB25725.1|1903342_1903969_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	92.3	2.9e-120
AYB25726.1|1903961_1904735_+	dimethyl sulfoxide reductase	NA	A0A077SK59	Escherichia_phage	79.8	3.5e-104
AYB25727.1|1904750_1905404_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	72.4	1.8e-80
>prophage 130
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1921554	1923538	4868095		Cronobacter_phage(50.0%)	2	NA	NA
AYB25743.1|1921554_1921848_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.6e-12
AYB25744.1|1921891_1923538_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.7	1.2e-189
>prophage 131
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1928614	1929148	4868095		Morganella_phage(100.0%)	1	NA	NA
AYB25752.1|1928614_1929148_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	4.7e-47
>prophage 132
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1932875	1933853	4868095		Tupanvirus(100.0%)	1	NA	NA
AYB25757.1|1932875_1933853_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.4	1.3e-26
>prophage 133
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1941577	1942123	4868095		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AYB25763.1|1941577_1942123_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	4.5e-29
>prophage 134
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1947144	1950333	4868095		Vibrio_phage(50.0%)	2	NA	NA
AYB25768.1|1947144_1948467_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.2	1.8e-15
AYB25769.1|1948476_1950333_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.8	5.8e-60
>prophage 135
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1955878	1960293	4868095		Pithovirus(50.0%)	3	NA	NA
AYB25776.1|1955878_1957177_+	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.6	8.4e-66
AYB25777.1|1957391_1957817_+	transcriptional regulator	NA	NA	NA	NA	NA
AYB25778.1|1957854_1960293_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	2.6e-68
>prophage 136
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	1965157	1966321	4868095		Ralstonia_phage(100.0%)	1	NA	NA
AYB25786.1|1965157_1966321_+	glutathionylspermidine synthase preATP-grasp family protein	NA	B2ZXR7	Ralstonia_phage	43.5	2.0e-82
>prophage 137
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2004393	2006149	4868095		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AYB25827.1|2004393_2004924_-	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	4.2e-56
AYB25828.1|2005150_2006149_-	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	1.3e-69
>prophage 138
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2018072	2021412	4868095		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AYB25842.1|2018072_2018315_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	51.2	5.6e-16
AYB25843.1|2018304_2018589_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	69.1	1.9e-31
AYB25844.1|2018592_2019057_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	55.8	2.7e-51
AYB25845.1|2019273_2021412_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	1.5e-266
>prophage 139
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2025078	2031627	4868095	transposase	Enterobacteria_phage(33.33%)	7	NA	NA
AYB25848.1|2025078_2026026_-	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	21.5	1.2e-13
AYB25849.1|2026170_2026269_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
AYB25850.1|2026409_2029118_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	25.8	5.9e-45
AYB25851.1|2029233_2029680_-|transposase	transposase	transposase	NA	NA	NA	NA
AYB25852.1|2029754_2030141_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AYB25853.1|2030217_2030679_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AYB25854.1|2030691_2031627_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.9	5.5e-51
>prophage 140
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2045061	2050008	4868095	tRNA	Klosneuvirus(50.0%)	3	NA	NA
AYB25868.1|2045061_2047917_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.5	1.6e-141
AYB25869.1|2047916_2048399_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AYB25870.1|2048496_2050008_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	8.3e-49
>prophage 141
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2057775	2058795	4868095		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AYB25879.1|2057775_2058795_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	7.9e-43
>prophage 142
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2098242	2104517	4868095		Liberibacter_phage(50.0%)	2	NA	NA
AYB25917.1|2098242_2101509_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.6	2.8e-49
AYB25918.1|2102897_2104517_-	DNA methyltransferase	NA	A0A2H4UVW8	Bodo_saltans_virus	22.0	1.9e-06
>prophage 143
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2115175	2116837	4868095		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYB25927.1|2115175_2116837_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 144
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2122568	2123627	4868095		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
AYB25932.1|2122568_2123627_+	SIS domain-containing protein	NA	J3IZE6	Acanthamoeba_polyphaga_lentillevirus	23.6	2.0e-09
>prophage 145
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2127881	2129161	4868095		Shigella_phage(50.0%)	2	NA	NA
AYB25936.1|2127881_2128619_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	3.4e-64
AYB25937.1|2128621_2129161_-	primosomal protein 1	NA	T1SA92	Salmonella_phage	65.6	2.2e-28
>prophage 146
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2134143	2135208	4868095		Bacillus_virus(100.0%)	1	NA	NA
AYB25943.1|2134143_2135208_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	33.1	4.2e-15
>prophage 147
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2138984	2141883	4868095		Streptococcus_phage(50.0%)	3	NA	NA
AYB25948.1|2138984_2140574_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	3.1e-30
AYB25949.1|2140975_2141593_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
AYB25950.1|2141703_2141883_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	1.5e-10
>prophage 148
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2147430	2148753	4868095		Geobacillus_virus(100.0%)	1	NA	NA
AYB25955.1|2147430_2148753_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.4	1.8e-79
>prophage 149
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2156864	2162028	4868095		Enterococcus_phage(33.33%)	3	NA	NA
AYB28577.1|2156864_2158097_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	45.2	3.3e-88
AYB25963.1|2158214_2159882_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.7	1.7e-42
AYB25964.1|2160054_2162028_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.4	1.8e-11
>prophage 150
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2165977	2167402	4868095		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AYB25971.1|2165977_2167402_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.7	5.1e-08
>prophage 151
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2186141	2198445	4868095		Cyanophage(20.0%)	12	NA	NA
AYB25987.1|2186141_2187095_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.0	9.7e-11
AYB25988.1|2187205_2187796_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AYB25989.1|2187852_2188419_-	acetate uptake transporter	NA	NA	NA	NA	NA
AYB25990.1|2188568_2189282_-	acidic protein MsyB	NA	NA	NA	NA	NA
AYB25991.1|2189317_2189722_-	DUF2541 family protein	NA	NA	NA	NA	NA
AYB25992.1|2190070_2191987_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.1	1.2e-148
AYB25993.1|2192072_2193212_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.0	4.2e-29
AYB25994.1|2193492_2194440_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB25995.1|2194566_2194911_+	hypothetical protein	NA	NA	NA	NA	NA
AYB25996.1|2194971_2195505_-	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	56.6	1.2e-53
AYB25997.1|2195521_2195965_-	transcriptional regulator	NA	NA	NA	NA	NA
AYB25998.1|2196345_2198445_+	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	9.5e-35
>prophage 152
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2218604	2220098	4868095		Tetraselmis_virus(100.0%)	1	NA	NA
AYB26015.1|2218604_2220098_+	DUF229 domain-containing protein	NA	A0A2P0VMN7	Tetraselmis_virus	30.6	9.1e-32
>prophage 153
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2224663	2225830	4868095		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYB26019.1|2224663_2225830_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.1	7.5e-90
>prophage 154
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2232328	2235163	4868095	tRNA	Tupanvirus(100.0%)	1	NA	NA
AYB28579.1|2232328_2235163_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	5.0e-79
>prophage 155
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2254174	2255323	4868095		Halovirus(100.0%)	1	NA	NA
AYB26042.1|2254174_2255323_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	2.0e-50
>prophage 156
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2260859	2266499	4868095		Hepacivirus(50.0%)	4	NA	NA
AYB26047.1|2260859_2262413_-	ATP-dependent acyl-CoA ligase	NA	Q75ZG1	Hepacivirus	24.6	2.0e-29
AYB26048.1|2262475_2263693_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
AYB26049.1|2263804_2264947_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYB26050.1|2264981_2266499_-	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	22.2	1.4e-08
>prophage 157
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2274816	2276250	4868095		Bacillus_phage(50.0%)	2	NA	NA
AYB26060.1|2274816_2275296_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	2.3e-29
AYB26061.1|2275401_2276250_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0E3T919	Enterococcus_phage	47.8	5.8e-07
>prophage 158
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2283979	2289411	4868095		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AYB26069.1|2283979_2286886_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	2.9e-21
AYB26070.1|2287059_2289411_-	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.5	4.2e-15
>prophage 159
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2297184	2297892	4868095		Bacillus_virus(100.0%)	1	NA	NA
AYB26076.1|2297184_2297892_-	thiamine import ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	38.3	8.2e-23
>prophage 160
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2307587	2309159	4868095		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
AYB26085.1|2307587_2309159_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.1	6.9e-06
>prophage 161
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2341136	2342180	4868095		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AYB26114.1|2341136_2342180_+	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.2	3.4e-102
>prophage 162
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2346437	2347001	4868095		Sphingobium_phage(100.0%)	1	NA	NA
AYB26120.1|2346437_2347001_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.0	2.6e-11
>prophage 163
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2358091	2359516	4868095		Erysipelothrix_phage(100.0%)	1	NA	NA
AYB26128.1|2358091_2359516_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.2e-41
>prophage 164
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2370858	2380562	4868095		Escherichia_phage(25.0%)	9	NA	NA
AYB26138.1|2370858_2371626_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	1.7e-29
AYB26139.1|2371655_2372450_-	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AYB26140.1|2372470_2373331_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AYB26141.1|2373437_2373785_-	hypothetical protein	NA	NA	NA	NA	NA
AYB26142.1|2373986_2375597_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	58.7	1.9e-19
AYB26143.1|2375674_2378065_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AYB26144.1|2378270_2378807_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.0e-17
AYB26145.1|2378864_2379527_-	carbonate dehydratase	NA	NA	NA	NA	NA
AYB26146.1|2379635_2380562_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	5.9e-21
>prophage 165
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2391318	2392737	4868095		unidentified_phage(100.0%)	1	NA	NA
AYB26158.1|2391318_2392737_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.8	1.4e-26
>prophage 166
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2395753	2398228	4868095		Bodo_saltans_virus(100.0%)	1	NA	NA
AYB26162.1|2395753_2398228_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.2	1.1e-34
>prophage 167
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2403421	2404219	4868095		Planktothrix_phage(100.0%)	1	NA	NA
AYB26165.1|2403421_2404219_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	2.7e-14
>prophage 168
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2417609	2417954	4868095		Lake_Baikal_phage(100.0%)	1	NA	NA
AYB26177.1|2417609_2417954_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.0e-26
>prophage 169
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2421937	2427764	4868095	protease	uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AYB26182.1|2421937_2423365_+|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	4.2e-26
AYB26183.1|2423517_2424675_+	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
AYB26184.1|2424731_2427764_-	viral enhancin protein	NA	A0A288QW20	Cyclophragma_undans_nucleopolyhedrovirus	25.8	1.2e-46
>prophage 170
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2439986	2440745	4868095		Flavobacterium_phage(100.0%)	1	NA	NA
AYB26197.1|2439986_2440745_+	ditrans,polycis-undecaprenyl-diphosphate synthase ((2E,6E)-farnesyl-diphosphate specific)	NA	R9W0U9	Flavobacterium_phage	42.2	1.9e-25
>prophage 171
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2449559	2453662	4868095		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
AYB26206.1|2449559_2450156_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.5e-25
AYB26207.1|2450179_2453662_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
>prophage 172
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2467649	2468681	4868095		Planktothrix_phage(100.0%)	1	NA	NA
AYB26223.1|2467649_2468681_-	methionine import ATP-binding protein MetN 1	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 173
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2475697	2476501	4868095		Indivirus(100.0%)	1	NA	NA
AYB26225.1|2475697_2476501_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	1.6e-38
>prophage 174
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2480551	2484762	4868095		Lactobacillus_phage(33.33%)	5	NA	NA
AYB26230.1|2480551_2481919_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
AYB26231.1|2481990_2482746_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AYB26232.1|2482780_2483503_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYB26233.1|2483499_2483967_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
AYB28587.1|2484030_2484762_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
>prophage 175
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2491777	2494417	4868095		Vibrio_phage(100.0%)	1	NA	NA
AYB26239.1|2491777_2494417_+	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.3	5.7e-77
>prophage 176
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2517706	2520481	4868095		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYB26259.1|2517706_2520481_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	40.0	2.2e-31
>prophage 177
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2538645	2539224	4868095		Caulobacter_phage(100.0%)	1	NA	NA
AYB26277.1|2538645_2539224_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
>prophage 178
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2542438	2543578	4868095		Mycobacterium_phage(100.0%)	1	NA	NA
AYB26281.1|2542438_2543578_+	RNA ligase RtcB family protein	NA	A0A0M5M6X2	Mycobacterium_phage	30.5	1.5e-29
>prophage 179
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2548350	2552673	4868095		Enterobacteria_phage(50.0%)	4	NA	NA
AYB26287.1|2548350_2549403_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
AYB26288.1|2549686_2550790_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
AYB26289.1|2550801_2552049_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.9	5.5e-99
AYB26290.1|2552403_2552673_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	63.8	1.4e-20
>prophage 180
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2560763	2561036	4868095		Salmonella_phage(100.0%)	1	NA	NA
AYB26299.1|2560763_2561036_-	cytoplasmic protein	NA	B8K1I9	Salmonella_phage	60.9	5.4e-07
>prophage 181
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2573581	2574106	4868095		Escherichia_phage(100.0%)	1	NA	NA
AYB26312.1|2573581_2574106_+	outer membrane protein	NA	B0FEG7	Escherichia_phage	29.2	1.3e-09
>prophage 182
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2581754	2591466	4868095		Streptococcus_phage(33.33%)	6	NA	NA
AYB26317.1|2581754_2584058_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.4	7.1e-92
AYB26318.1|2584054_2584519_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AYB26319.1|2584596_2584791_+	copper chaperone	NA	NA	NA	NA	NA
AYB26320.1|2585083_2586337_+	MFS transporter	NA	NA	NA	NA	NA
AYB26321.1|2586525_2588484_+	type III restriction-modification system StyLTI enzyme mod	NA	Q1MVP0	Enterobacteria_phage	32.2	1.3e-81
AYB26322.1|2588493_2591466_+	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	26.3	2.1e-83
>prophage 183
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2604787	2606584	4868095		Staphylococcus_phage(100.0%)	1	NA	NA
AYB26334.1|2604787_2606584_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	28.9	9.0e-50
>prophage 184
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2621238	2622351	4868095		Bacillus_phage(100.0%)	1	NA	NA
AYB26348.1|2621238_2622351_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	33.1	5.6e-18
>prophage 185
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2626055	2635975	4868095		Bacillus_phage(60.0%)	7	NA	NA
AYB26355.1|2626055_2626967_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	7.1e-104
AYB26356.1|2627092_2628001_+	fructokinase	NA	NA	NA	NA	NA
AYB26357.1|2628022_2629195_-	MFS transporter AraJ	NA	NA	NA	NA	NA
AYB26358.1|2629367_2632508_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	21.3	7.4e-07
AYB26359.1|2632504_2633707_-	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	26.0	7.4e-08
AYB26360.1|2633920_2634610_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
AYB26361.1|2634679_2635975_+	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.1	2.6e-27
>prophage 186
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2643946	2648286	4868095	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AYB26368.1|2643946_2645074_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	9.5e-90
AYB26369.1|2645096_2645429_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	3.7e-10
AYB26370.1|2645456_2647304_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AYB26371.1|2647314_2648286_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.1	2.3e-44
>prophage 187
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2652966	2654629	4868095		Indivirus(50.0%)	2	NA	NA
AYB26379.1|2652966_2654070_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	1.1e-50
AYB26380.1|2654158_2654629_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.0	1.0e-29
>prophage 188
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2664148	2665258	4868095		Bacillus_virus(100.0%)	1	NA	NA
AYB26391.1|2664148_2665258_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.8	8.0e-25
>prophage 189
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2686324	2691492	4868095	protease	Agrobacterium_phage(25.0%)	4	NA	NA
AYB26411.1|2686324_2686948_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
AYB26412.1|2687199_2688471_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	5.6e-131
AYB26413.1|2688656_2691011_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	1.6e-224
AYB26414.1|2691219_2691492_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.9e-20
>prophage 190
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2694785	2695481	4868095		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYB26418.1|2694785_2695481_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.2e-87
>prophage 191
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2699881	2703428	4868095		Bacillus_phage(100.0%)	2	NA	NA
AYB26422.1|2699881_2701654_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	4.7e-51
AYB26423.1|2701646_2703428_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	1.9e-39
>prophage 192
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2721047	2732079	4868095	transposase	Sodalis_phage(20.0%)	14	NA	NA
AYB26440.1|2721047_2721983_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.1	1.6e-63
AYB26441.1|2722052_2722220_-	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AYB26442.1|2722233_2722749_-	primosomal replication protein N''	NA	NA	NA	NA	NA
AYB26443.1|2722829_2723207_+	DUF454 family protein	NA	NA	NA	NA	NA
AYB26444.1|2723359_2723911_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	1.0e-28
AYB26445.1|2724024_2725953_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	2.3e-43
AYB26446.1|2725998_2726328_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AYB26447.1|2726327_2726933_+	recombination protein RecR	NA	NA	NA	NA	NA
AYB26448.1|2727043_2728918_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.9	1.3e-115
AYB26449.1|2729137_2729359_-	hypothetical protein	NA	NA	NA	NA	NA
AYB26450.1|2729275_2729920_+	adenylate kinase	NA	NA	NA	NA	NA
AYB26451.1|2729932_2730139_+	hypothetical protein	NA	NA	NA	NA	NA
AYB26452.1|2730148_2731111_+	ferrochelatase	NA	NA	NA	NA	NA
AYB26453.1|2731107_2732079_-	acetylesterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.9	1.7e-15
>prophage 193
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2741179	2746398	4868095		uncultured_virus(50.0%)	5	NA	NA
AYB26460.1|2741179_2743681_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.1	2.0e-111
AYB26461.1|2743790_2744207_+	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
AYB26462.1|2744207_2744660_-	NfeD family protein	NA	NA	NA	NA	NA
AYB26463.1|2744656_2745574_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AYB26464.1|2745720_2746398_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	32.5	3.0e-22
>prophage 194
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2749673	2750360	4868095		Planktothrix_phage(100.0%)	1	NA	NA
AYB26469.1|2749673_2750360_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	4.6e-31
>prophage 195
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2755213	2756230	4868095		Planktothrix_phage(100.0%)	1	NA	NA
AYB26473.1|2755213_2756230_+	methionine import ATP-binding protein MetN 2	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-32
>prophage 196
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2760701	2762483	4868095		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AYB26479.1|2760701_2762483_+	glyoxylate carboligase	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	27.3	1.9e-39
>prophage 197
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2769933	2771082	4868095		Streptococcus_phage(100.0%)	1	NA	NA
AYB26486.1|2769933_2771082_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	39.0	2.7e-47
>prophage 198
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2782354	2786788	4868095	tRNA	Moumouvirus(50.0%)	6	NA	NA
AYB26498.1|2782354_2783740_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
AYB26499.1|2783784_2784609_-	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
AYB26500.1|2784605_2785043_-	hypothetical protein	NA	NA	NA	NA	NA
AYB26501.1|2785035_2785581_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYB26502.1|2785707_2785920_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AYB26503.1|2785921_2786788_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
>prophage 199
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2796865	2846435	4868095	portal,terminase,holin,coat,lysis,protease,tail,integrase	Salmonella_phage(70.59%)	73	2796808:2796848	2842796:2842836
2796808:2796848	attL	TCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGC	NA	NA	NA	NA
AYB26513.1|2796865_2798029_-|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	97.1	1.0e-219
AYB26514.1|2797884_2798256_-	DNA-binding protein	NA	B9UDM0	Salmonella_phage	80.5	2.1e-46
AYB26515.1|2798258_2798603_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	97.4	1.1e-57
AYB26516.1|2798680_2798992_-	hypothetical protein	NA	A0A1I9LJL8	Stx_converting_phage	99.0	7.9e-55
AYB26517.1|2799073_2799403_-	ASCH domain-containing protein	NA	Q9XJG9	Enterobacteria_phage	94.2	1.0e-52
AYB26518.1|2799347_2800430_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.2	6.5e-80
AYB26519.1|2800426_2800720_-	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	99.0	4.2e-50
AYB26520.1|2801104_2801686_-	Eae-like protein	NA	A0A0N6WGF1	Salmonella_phage	71.5	5.2e-68
AYB26521.1|2801682_2801853_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AYB26522.1|2801863_2802157_-	DUF2856 family protein	NA	A0A1V0E5L7	Salmonella_phage	100.0	5.5e-50
AYB26523.1|2802172_2802721_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
AYB26524.1|2802729_2803236_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	98.8	3.8e-91
AYB26525.1|2803236_2803944_-	recombinase	NA	E7C9Q0	Salmonella_phage	89.8	9.7e-125
AYB26526.1|2803952_2804141_-	hypothetical protein	NA	C6ZR38	Salmonella_phage	100.0	1.3e-28
AYB26527.1|2804137_2804251_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
AYB26528.1|2804243_2804384_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	2.0e-18
AYB26529.1|2804707_2805007_-	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	99.0	3.3e-50
AYB26530.1|2805046_2805247_-	restriction endonuclease	NA	A0A1R3Y5S4	Salmonella_virus	100.0	1.0e-31
AYB26531.1|2805325_2805658_-	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	100.0	2.2e-55
AYB26532.1|2806021_2806231_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	5.5e-28
AYB26533.1|2806266_2807190_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	100.0	1.5e-181
AYB26534.1|2807278_2807968_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
AYB26535.1|2808078_2808294_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
AYB26536.1|2808404_2808686_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
AYB26537.1|2808720_2808867_+	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AYB26538.1|2809675_2811052_+	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	99.3	4.8e-253
AYB26539.1|2811107_2811566_+	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	98.6	3.0e-79
AYB26540.1|2811562_2812435_+	hypothetical protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
AYB26541.1|2812431_2812605_+	protein ninD	NA	C6ZR56	Salmonella_phage	93.0	7.0e-29
AYB26542.1|2812571_2812754_+	NinE family protein	NA	Q716C5	Shigella_phage	96.7	1.8e-27
AYB26543.1|2812750_2812927_+	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	96.6	1.8e-27
AYB26544.1|2812889_2813186_+	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	98.9	7.5e-47
AYB26545.1|2813182_2813578_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	96.9	2.9e-70
AYB26546.1|2813574_2813778_+	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	94.0	5.7e-30
AYB26547.1|2813847_2814336_+	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
AYB26548.1|2814382_2814580_+	hypothetical protein	NA	C6ZR63	Salmonella_phage	96.2	5.0e-23
AYB26549.1|2814715_2815042_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
AYB26550.1|2815025_2815463_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
AYB26551.1|2815459_2815930_+|lysis	lysis protein	lysis	H6WRZ5	Salmonella_phage	87.2	1.2e-62
AYB26552.1|2815964_2816189_+	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	90.3	7.2e-26
AYB26553.1|2816142_2816673_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	96.6	4.0e-91
AYB26554.1|2816931_2817174_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AYB26555.1|2817177_2817567_+	hypothetical protein	NA	C6ZR72	Salmonella_phage	99.2	1.5e-74
AYB26556.1|2817566_2817971_+	Decoration protein	NA	C6ZR73	Salmonella_phage	100.0	5.3e-67
AYB26557.1|2817974_2818463_+	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
AYB26558.1|2818440_2819940_+|terminase	terminase	terminase	A8CGE0	Salmonella_phage	99.8	6.9e-306
AYB26559.1|2819939_2822117_+|portal	portal protein	portal	I6R968	Salmonella_phage	98.3	0.0e+00
AYB26560.1|2822130_2823042_+	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	100.0	4.9e-161
AYB26561.1|2823041_2824334_+|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.8	1.1e-243
AYB26562.1|2824374_2824935_+	hypothetical protein	NA	C6ZR11	Salmonella_phage	98.9	1.4e-102
AYB26563.1|2824918_2825419_+	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.8	5.5e-90
AYB26564.1|2825378_2826797_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.3	3.3e-273
AYB26565.1|2826800_2827502_+|tail	phage tail protein	tail	B8K1I3	Salmonella_phage	98.3	8.8e-70
AYB26566.1|2827501_2827957_+	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
AYB26567.1|2827959_2828649_+	DNA transfer protein	NA	E7C9U4	Salmonella_phage	99.6	1.2e-108
AYB26568.1|2828659_2829964_+	acyltransferase	NA	E7C9U5	Salmonella_phage	96.3	7.8e-213
AYB26569.1|2829963_2831877_+	DNA transfer protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
AYB26570.1|2831894_2832224_-	hypothetical protein	NA	NA	NA	NA	NA
AYB26571.1|2832254_2832620_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
AYB28600.1|2832633_2832813_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
AYB26572.1|2832912_2833164_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
AYB26573.1|2833299_2835303_+	endorhamnosidase	NA	E7C9U9	Salmonella_phage	99.9	0.0e+00
AYB26574.1|2835361_2836819_-	hypothetical protein	NA	E7C9N7	Salmonella_phage	99.8	1.7e-240
AYB26575.1|2836808_2837741_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
AYB26576.1|2837737_2838100_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
AYB26577.1|2839583_2841236_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	38.0	1.5e-83
AYB26578.1|2841216_2842143_-	glycosyltransferase	NA	I1TED8	Salmonella_phage	96.7	1.4e-168
AYB26579.1|2842139_2842502_-	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
AYB28601.1|2842926_2843136_-	copper-binding protein	NA	NA	NA	NA	NA
2842796:2842836	attR	TCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGC	NA	NA	NA	NA
AYB26580.1|2843371_2843701_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
AYB26581.1|2843809_2843989_+	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AYB26582.1|2844039_2844894_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYB26583.1|2845109_2846435_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.5	1.0e-103
>prophage 200
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2861068	2867186	4868095		Tupanvirus(50.0%)	3	NA	NA
AYB26598.1|2861068_2864953_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	28.5	1.9e-60
AYB26599.1|2865202_2866339_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AYB26600.1|2866391_2867186_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.9	2.2e-08
>prophage 201
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2881656	2883482	4868095		uncultured_marine_virus(50.0%)	2	NA	NA
AYB26613.1|2881656_2882274_-	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	51.3	3.0e-53
AYB26614.1|2882246_2883482_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.3	2.9e-60
>prophage 202
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2886857	2893406	4868095		Bacillus_virus(33.33%)	7	NA	NA
AYB26618.1|2886857_2888423_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	3.2e-43
AYB26619.1|2888755_2889316_+	molecular chaperone	NA	NA	NA	NA	NA
AYB26620.1|2889308_2889665_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
AYB26621.1|2889642_2891589_+	DMSO reductase	NA	A0A077SK27	Escherichia_phage	24.0	3.5e-31
AYB26622.1|2891585_2892143_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AYB26623.1|2892142_2892910_+	hydrogenase	NA	NA	NA	NA	NA
AYB26624.1|2892977_2893406_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.3e-18
>prophage 203
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2908514	2909165	4868095		Morganella_phage(50.0%)	2	NA	NA
AYB26637.1|2908514_2908724_+	cold shock-like protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	5.9e-22
AYB26638.1|2908781_2909165_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.6	1.7e-22
>prophage 204
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2914000	2916485	4868095		Stx2-converting_phage(50.0%)	2	NA	NA
AYB26645.1|2914000_2915212_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.7	3.4e-101
AYB26646.1|2915351_2916485_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	4.8e-09
>prophage 205
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2924712	2927295	4868095	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
AYB26655.1|2924712_2927295_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.6e-185
>prophage 206
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2938120	2942923	4868095		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
AYB26664.1|2938120_2939800_-	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	36.1	1.0e-76
AYB26665.1|2939875_2941114_-	hypothetical protein	NA	NA	NA	NA	NA
AYB26666.1|2941145_2942081_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AYB26667.1|2942197_2942923_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	8.7e-28
>prophage 207
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2948823	2949909	4868095		Pseudomonas_phage(100.0%)	1	NA	NA
AYB26673.1|2948823_2949909_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.6e-48
>prophage 208
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2954416	2956081	4868095		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AYB26677.1|2954416_2956081_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.0	4.7e-85
>prophage 209
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2960736	2970950	4868095	tRNA	Vibrio_phage(25.0%)	7	NA	NA
AYB26682.1|2960736_2962689_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	2.9e-09
AYB26683.1|2962899_2964567_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	96.0	0.0e+00
AYB26684.1|2964914_2965100_+	hypothetical protein	NA	NA	NA	NA	NA
AYB26685.1|2966684_2967017_+	hypothetical protein	NA	NA	NA	NA	NA
AYB26686.1|2967065_2968370_-	tricarballylate/proton symporter TcuC	NA	Q6JIH2	Burkholderia_virus	34.9	1.2e-59
AYB26687.1|2968420_2969560_-	tricarballylate utilization protein TcuB	NA	NA	NA	NA	NA
AYB26688.1|2969546_2970950_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	25.9	1.0e-08
>prophage 210
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2982033	2982711	4868095		Bacillus_phage(100.0%)	1	NA	NA
AYB26700.1|2982033_2982711_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	2.6e-26
>prophage 211
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2985981	2993415	4868095		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
AYB26702.1|2985981_2988030_-	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.3	1.9e-27
AYB26703.1|2988050_2989730_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AYB26704.1|2989729_2989819_-	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AYB26705.1|2990155_2990362_+	DUF2517 family protein	NA	NA	NA	NA	NA
AYB26706.1|2990473_2991895_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.3	2.3e-56
AYB26707.1|2991933_2993415_-	dipeptide permease D	NA	A0A0P0IY73	Acinetobacter_phage	28.7	1.1e-45
>prophage 212
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	2996930	2997722	4868095		Kaumoebavirus(100.0%)	1	NA	NA
AYB26713.1|2996930_2997722_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.1	4.0e-10
>prophage 213
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3023824	3027347	4868095		Vibrio_phage(33.33%)	4	NA	NA
AYB26734.1|3023824_3024544_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	35.8	1.7e-23
AYB26735.1|3024540_3025479_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.1	1.0e-25
AYB26736.1|3025589_3025976_-	hypothetical protein	NA	NA	NA	NA	NA
AYB26737.1|3026294_3027347_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.1	6.4e-80
>prophage 214
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3031072	3032341	4868095		Oenococcus_phage(100.0%)	1	NA	NA
AYB26742.1|3031072_3032341_+	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	26.6	3.2e-33
>prophage 215
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3038016	3038793	4868095		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AYB26748.1|3038016_3038793_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.0	3.3e-09
>prophage 216
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3043101	3050719	4868095		Tupanvirus(33.33%)	8	NA	NA
AYB26754.1|3043101_3044118_-	UDP-glucose 4-epimerase	NA	A0A2K9L5H6	Tupanvirus	47.3	3.3e-81
AYB26755.1|3044340_3045249_-	DUF2167 domain-containing protein	NA	NA	NA	NA	NA
AYB26756.1|3045419_3046895_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	30.2	4.4e-10
AYB26757.1|3046962_3047751_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AYB26758.1|3047879_3048029_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AYB26759.1|3048195_3048969_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYB26760.1|3048968_3049658_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AYB26761.1|3049660_3050719_+	molybdenum import ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.3	5.1e-21
>prophage 217
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3059176	3062604	4868095		Catovirus(50.0%)	3	NA	NA
AYB26768.1|3059176_3060697_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.0	1.7e-81
AYB26769.1|3060781_3061258_-	kinase inhibitor	NA	NA	NA	NA	NA
AYB28613.1|3061305_3062604_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	7.7e-19
>prophage 218
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3069464	3072732	4868095		Phage_Gifsy-2(50.0%)	2	NA	NA
AYB26777.1|3069464_3071732_+	SPI-1 type III secretion system effector E3 ubiquitin transferase SlrP	NA	Q9MBL9	Phage_Gifsy-2	42.1	4.1e-15
AYB26778.1|3071823_3072732_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.9	6.0e-26
>prophage 219
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3084445	3093758	4868095		Anomala_cuprea_entomopoxvirus(25.0%)	8	NA	NA
AYB26793.1|3084445_3086182_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	4.6e-19
AYB26794.1|3086174_3087170_-	secretion protein HlyD	NA	NA	NA	NA	NA
AYB26795.1|3087169_3087844_-	transcriptional regulator	NA	NA	NA	NA	NA
AYB26796.1|3088073_3089435_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	2.9e-53
AYB26797.1|3089642_3091787_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.6	3.7e-42
AYB26798.1|3091816_3092791_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AYB26799.1|3092946_3093207_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYB26800.1|3093491_3093758_-	DksA/TraR family C4-type zinc finger protein	NA	E5E4B1	Acinetobacter_phage	52.8	1.7e-13
>prophage 220
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3097226	3102507	4868095		Planktothrix_phage(33.33%)	6	NA	NA
AYB26803.1|3097226_3097949_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	43.2	1.9e-35
AYB26804.1|3097945_3098605_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AYB26805.1|3098748_3099495_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AYB26806.1|3099971_3100475_-	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	23.0	7.1e-05
AYB26807.1|3100777_3101638_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AYB26808.1|3101991_3102507_+	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	34.2	1.1e-16
>prophage 221
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3107492	3109085	4868095		Tupanvirus(100.0%)	1	NA	NA
AYB26814.1|3107492_3109085_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.9	1.6e-58
>prophage 222
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3113805	3116238	4868095		Citrobacter_phage(100.0%)	1	NA	NA
AYB26817.1|3113805_3116238_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	43.5	2.1e-09
>prophage 223
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3120560	3122432	4868095		Planktothrix_phage(100.0%)	1	NA	NA
AYB26822.1|3120560_3122432_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	28.0	2.4e-13
>prophage 224
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3137978	3139984	4868095		Stx2-converting_phage(50.0%)	2	NA	NA
AYB26836.1|3137978_3139181_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.4e-99
AYB26837.1|3139225_3139984_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	29.6	8.8e-15
>prophage 225
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3147555	3156721	4868095		Vibrio_phage(25.0%)	11	NA	NA
AYB26844.1|3147555_3147819_-	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	5.9e-27
AYB26845.1|3147988_3148279_+	DUF1418 family protein	NA	NA	NA	NA	NA
AYB26846.1|3148262_3148985_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AYB26847.1|3149042_3149945_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	3.5e-34
AYB26848.1|3150040_3150517_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AYB26849.1|3150865_3151978_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AYB26850.1|3152065_3153199_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	8.5e-30
AYB26851.1|3153208_3154162_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AYB26852.1|3154158_3155004_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AYB28617.1|3155077_3155551_+	DUF2593 family protein	NA	NA	NA	NA	NA
AYB26853.1|3155593_3156721_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.0	4.1e-24
>prophage 226
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3163521	3166273	4868095		Planktothrix_phage(50.0%)	4	NA	NA
AYB26861.1|3163521_3164250_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
AYB26862.1|3164479_3164995_-	lipoprotein	NA	NA	NA	NA	NA
AYB26863.1|3165122_3165446_+	hypothetical protein	NA	NA	NA	NA	NA
AYB26864.1|3165442_3166273_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	2.3e-08
>prophage 227
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3169862	3171581	4868095		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AYB26867.1|3169862_3171581_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	2.2e-29
>prophage 228
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3178367	3185680	4868095	protease,integrase	Dickeya_phage(16.67%)	7	3179618:3179632	3190611:3190625
AYB26874.1|3178367_3179486_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	8.1e-09
AYB26875.1|3179482_3181429_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.9	2.0e-39
3179618:3179632	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYB26876.1|3181558_3181780_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYB26877.1|3182103_3182424_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYB26878.1|3182454_3184731_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AYB26879.1|3184943_3185141_-	hypothetical protein	NA	NA	NA	NA	NA
AYB26880.1|3185302_3185680_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
3190611:3190625	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 229
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3190034	3206829	4868095	tRNA	Bacillus_phage(25.0%)	12	NA	NA
AYB26887.1|3190034_3191756_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	24.4	1.2e-14
AYB26888.1|3191756_3193523_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.1	6.0e-22
AYB26889.1|3193636_3194605_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	1.1e-62
AYB28618.1|3194946_3195222_-	hypothetical protein	NA	NA	NA	NA	NA
AYB26890.1|3195150_3195645_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AYB28619.1|3195779_3199862_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
AYB28620.1|3200004_3200616_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AYB26891.1|3200625_3201969_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
AYB28621.1|3201965_3202184_-	hypothetical protein	NA	NA	NA	NA	NA
AYB26892.1|3202227_3203520_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	1.9e-94
AYB26893.1|3203756_3206201_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	7.0e-223
AYB26894.1|3206211_3206829_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
>prophage 230
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3211123	3215814	4868095		Tetraselmis_virus(100.0%)	4	NA	NA
AYB26898.1|3211123_3211948_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	2.8e-22
AYB26899.1|3212039_3212366_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYB26900.1|3212496_3213456_+	SPI-2 type III secretion system effector SopD2	NA	NA	NA	NA	NA
AYB26901.1|3213531_3215814_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.1e-161
>prophage 231
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3219910	3220999	4868095		Streptococcus_phage(100.0%)	1	NA	NA
AYB26904.1|3219910_3220999_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.5	2.8e-78
>prophage 232
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3226055	3230617	4868095		Bacillus_phage(66.67%)	4	NA	NA
AYB26909.1|3226055_3226340_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
AYB26910.1|3226404_3226620_-	hypothetical protein	NA	NA	NA	NA	NA
AYB26911.1|3226618_3228832_+	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	22.5	8.6e-10
AYB26912.1|3228868_3230617_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
>prophage 233
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3245551	3251297	4868095	tRNA	Rhodobacter_phage(33.33%)	5	NA	NA
AYB26924.1|3245551_3246100_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
AYB26925.1|3246127_3246775_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYB26926.1|3246836_3248027_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AYB26927.1|3248211_3249303_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
AYB26928.1|3249896_3251297_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
>prophage 234
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3256647	3317195	4868095	terminase,protease,holin,tail	Salmonella_phage(54.55%)	66	NA	NA
AYB26933.1|3256647_3257940_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.3e-252
AYB26934.1|3257984_3258233_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYB26935.1|3258273_3258513_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AYB26936.1|3259677_3262866_-	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	74.0	0.0e+00
AYB26937.1|3263575_3263980_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYB26938.1|3264109_3264346_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
AYB26939.1|3264311_3264686_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYB26940.1|3264770_3265754_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
AYB26941.1|3265756_3266506_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYB26942.1|3266516_3266864_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYB26943.1|3266860_3267385_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYB26944.1|3267384_3267858_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	4.7e-67
AYB26945.1|3267861_3268434_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYB26946.1|3268527_3268794_+	hypothetical protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYB26947.1|3268949_3269189_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYB26948.1|3269178_3269484_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYB26949.1|3269523_3270126_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
AYB26950.1|3270125_3270332_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AYB26951.1|3270334_3270946_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
AYB26952.1|3270942_3271089_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AYB26953.1|3271078_3271876_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	4.4e-150
AYB26954.1|3272274_3272622_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	1.3e-45
AYB26955.1|3272624_3273239_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.1	1.2e-107
AYB26956.1|3273235_3273787_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AYB26957.1|3273776_3274190_+	hypothetical protein	NA	NA	NA	NA	NA
AYB26958.1|3274251_3275226_+|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	37.3	1.6e-29
AYB26959.1|3275215_3276487_+	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.3	1.1e-83
AYB26960.1|3276486_3277917_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.9	2.6e-92
AYB26961.1|3277888_3278764_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	45.5	1.5e-55
AYB26962.1|3278764_3280339_+	NUDIX hydrolase	NA	Q6UJ14	Burkholderia_virus	48.6	2.2e-20
AYB26963.1|3280359_3281232_+	hypothetical protein	NA	NA	NA	NA	NA
AYB26964.1|3281249_3282281_+	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.2	2.5e-73
AYB26965.1|3282345_3282831_+	hypothetical protein	NA	NA	NA	NA	NA
AYB26966.1|3282843_3283269_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28623.1|3283286_3283697_+	hypothetical protein	NA	NA	NA	NA	NA
AYB26967.1|3283680_3284619_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	39.9	2.9e-52
AYB26968.1|3284623_3286018_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	37.0	1.2e-70
AYB26969.1|3286021_3286459_+	hypothetical protein	NA	NA	NA	NA	NA
AYB26970.1|3286458_3287046_+	hypothetical protein	NA	NA	NA	NA	NA
AYB26971.1|3287169_3289224_+	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	36.3	7.7e-21
AYB26972.1|3289223_3289721_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	38.0	8.9e-24
AYB26973.1|3289936_3290212_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	33.3	1.6e-06
AYB26974.1|3290211_3291264_+	hypothetical protein	NA	NA	NA	NA	NA
AYB26975.1|3291260_3291977_+	hypothetical protein	NA	NA	NA	NA	NA
AYB26976.1|3291973_3292306_+	hypothetical protein	NA	NA	NA	NA	NA
AYB26977.1|3292302_3293529_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	63.6	3.2e-147
AYB26978.1|3293512_3294139_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
AYB26979.1|3294135_3295845_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
AYB26980.1|3295844_3296426_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AYB26981.1|3296429_3296678_-|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
AYB26982.1|3296903_3297872_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.1	3.3e-192
AYB26983.1|3298519_3299146_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AYB26984.1|3299505_3300192_-	virulence protein	NA	NA	NA	NA	NA
AYB26985.1|3300462_3300654_-	DinI family protein	NA	S4TNM0	Salmonella_phage	93.7	1.8e-25
AYB26986.1|3301080_3303693_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
AYB26987.1|3303900_3304911_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AYB26988.1|3305076_3305619_+	cell division protein ZapC	NA	NA	NA	NA	NA
AYB26989.1|3305615_3306725_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYB26990.1|3306823_3308932_+	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AYB26991.1|3308944_3310852_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
AYB26992.1|3310866_3312120_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
AYB26993.1|3312124_3313765_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AYB26994.1|3313761_3314325_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AYB26995.1|3314580_3314748_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYB26996.1|3314847_3315366_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AYB26997.1|3315434_3317195_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 235
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3323373	3325428	4868095		Bacillus_phage(100.0%)	1	NA	NA
AYB27004.1|3323373_3325428_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
>prophage 236
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3331207	3334821	4868095	protease	uncultured_Caudovirales_phage(33.33%)	4	NA	NA
AYB27014.1|3331207_3331867_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYB27015.1|3332505_3333186_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.4	1.6e-84
AYB27016.1|3333407_3334283_-	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
AYB28624.1|3334497_3334821_+	hypothetical protein	NA	E5G6P3	Salmonella_phage	68.1	3.2e-06
>prophage 237
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3340594	3341341	4868095		Bacillus_phage(100.0%)	1	NA	NA
AYB27023.1|3340594_3341341_-	DNA-binding response regulator HprR	NA	W8CYM9	Bacillus_phage	36.5	3.7e-34
>prophage 238
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3354638	3356880	4868095		Phage_258-320(50.0%)	4	NA	NA
AYB27039.1|3354638_3355001_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	43.5	1.9e-23
AYB27040.1|3355448_3355604_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27041.1|3355654_3355960_-	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AYB27042.1|3355959_3356880_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	46.7	3.2e-11
>prophage 239
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3362840	3413036	4868095	transposase,plate,tail	Shigella_phage(25.0%)	45	NA	NA
AYB27050.1|3362840_3364484_+	recombinase family protein	NA	A0A142LP20	Marinitoga_camini_virus	24.1	6.6e-07
AYB27051.1|3364503_3365277_-	hypothetical protein	NA	A0A291AY96	Shigella_phage	59.1	1.3e-74
AYB27052.1|3365434_3367567_-|tail	phage tail tape measure protein	tail	A0A291AY30	Shigella_phage	26.1	4.2e-54
AYB27053.1|3367751_3367961_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27054.1|3367986_3368694_-|transposase	transposase	transposase	NA	NA	NA	NA
AYB27055.1|3369243_3369540_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27056.1|3369696_3369984_-	HNH endonuclease	NA	NA	NA	NA	NA
AYB27057.1|3369980_3370196_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27058.1|3370195_3370474_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27059.1|3370475_3371030_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27060.1|3371274_3371463_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27061.1|3373749_3373974_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27062.1|3374000_3374168_+	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
AYB27063.1|3374304_3374943_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
AYB27064.1|3374939_3375335_-	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
AYB27065.1|3375393_3379356_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYB27066.1|3379776_3381285_+	sodium:proline symporter	NA	NA	NA	NA	NA
AYB28626.1|3381902_3382199_+	phosphate starvation-inducible protein PhoH	NA	NA	NA	NA	NA
AYB27067.1|3382111_3382966_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	4.5e-92
AYB27068.1|3383071_3383953_-	MurR/RpiR family transcriptional regulator	NA	A0A2P0VNK5	Tetraselmis_virus	28.9	3.3e-05
AYB27069.1|3384238_3385735_-	acetylneuraminate ABC transporter	NA	A0A240F3J2	Aeromonas_phage	22.9	1.3e-17
AYB27070.1|3385848_3386058_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27071.1|3386071_3386752_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
AYB27072.1|3387257_3388412_+	YjhT family mutarotase	NA	NA	NA	NA	NA
AYB27073.1|3388456_3389149_+	outer membrane protein	NA	NA	NA	NA	NA
AYB27074.1|3390722_3391829_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYB27075.1|3391995_3392289_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27076.1|3392319_3392538_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27077.1|3393138_3393597_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AYB27078.1|3393720_3394092_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27079.1|3394100_3394541_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27080.1|3394560_3395433_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AYB27081.1|3395465_3395945_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AYB27082.1|3395960_3397325_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27083.1|3397335_3400857_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AYB27084.1|3400875_3402288_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AYB27085.1|3402289_3403027_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AYB27086.1|3403023_3405759_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.4	5.0e-84
AYB27087.1|3405771_3406530_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AYB27088.1|3406534_3407866_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AYB27089.1|3407868_3408402_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AYB27090.1|3408398_3409685_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AYB27091.1|3409709_3410798_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYB27092.1|3410761_3412615_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYB27093.1|3412619_3413036_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 240
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3416667	3423101	4868095		Ralstonia_phage(50.0%)	2	NA	NA
AYB27098.1|3416667_3418782_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.6	7.6e-24
AYB27099.1|3418883_3423101_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	41.7	9.2e-21
>prophage 241
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3428941	3438649	4868095		Burkholderia_phage(40.0%)	10	NA	NA
AYB27107.1|3428941_3429154_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AYB28627.1|3429164_3429353_+	cold-shock protein	NA	NA	NA	NA	NA
AYB27108.1|3431472_3431784_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27109.1|3431863_3432559_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AYB27110.1|3432632_3434063_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
AYB27111.1|3434043_3434514_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
AYB27112.1|3434502_3435423_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AYB27113.1|3435592_3436510_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AYB27114.1|3436526_3436772_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AYB27115.1|3436936_3438649_+	cellulose synthesis regulatory protein	NA	A0A127AWB9	Bacillus_phage	37.4	1.6e-19
>prophage 242
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3466348	3467101	4868095		Bacillus_virus(100.0%)	1	NA	NA
AYB27150.1|3466348_3467101_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	35.0	4.9e-26
>prophage 243
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3491296	3495438	4868095		Bacillus_thuringiensis_phage(66.67%)	4	NA	NA
AYB27175.1|3491296_3492958_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.0	4.4e-11
AYB27176.1|3493118_3493985_+	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
AYB27177.1|3493981_3495031_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AYB27178.1|3495048_3495438_+	two-component system response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	2.2e-06
>prophage 244
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3503389	3509949	4868095	tRNA	Tupanvirus(33.33%)	8	NA	NA
AYB27185.1|3503389_3505123_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	3.7e-85
AYB27186.1|3505359_3505929_+	VOC family protein	NA	NA	NA	NA	NA
AYB27187.1|3505948_3506695_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AYB27188.1|3506672_3506882_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27189.1|3506930_3507902_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AYB27190.1|3507898_3508642_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	5.4e-25
AYB27191.1|3508682_3509078_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27192.1|3509130_3509949_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	4.5e-57
>prophage 245
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3513970	3514492	4868095		Bacillus_virus(100.0%)	1	NA	NA
AYB27197.1|3513970_3514492_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
>prophage 246
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3518595	3523580	4868095		Bacillus_phage(33.33%)	5	NA	NA
AYB27201.1|3518595_3519606_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.4	2.4e-07
AYB27202.1|3519684_3520470_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AYB27203.1|3520466_3521222_-	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	8.5e-18
AYB28630.1|3521285_3522245_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AYB27204.1|3522260_3523580_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
>prophage 247
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3527517	3528993	4868095		Cyanophage(100.0%)	1	NA	NA
AYB27210.1|3527517_3528993_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	5.8e-79
>prophage 248
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3536891	3616984	4868095	portal,terminase,holin,lysis,protease,tail,integrase	Enterobacteria_phage(25.0%)	91	3541829:3541858	3589602:3589631
AYB27218.1|3536891_3537590_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	2.8e-07
AYB27219.1|3537613_3538270_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AYB27220.1|3538377_3538608_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
AYB27221.1|3538745_3539120_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AYB27222.1|3539120_3539996_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27223.1|3540012_3540366_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AYB28631.1|3540423_3540543_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27224.1|3540748_3541828_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	1.5e-100
AYB27225.1|3541802_3542081_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.8e-10
3541829:3541858	attL	TGATCAACTTCTCCAGCAATGCACTCGGTT	NA	NA	NA	NA
AYB28632.1|3542141_3542378_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27226.1|3542668_3542854_-	DUF1187 family protein	NA	NA	NA	NA	NA
AYB27227.1|3542900_3543731_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	2.5e-103
AYB27228.1|3543723_3546414_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	72.8	4.0e-118
AYB27229.1|3546554_3546890_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27230.1|3546965_3547172_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
AYB27231.1|3547175_3547451_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27232.1|3547799_3548066_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27233.1|3548468_3548867_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
AYB27234.1|3548965_3549220_+	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
AYB27235.1|3549206_3549701_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27236.1|3549747_3550746_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.3	4.1e-121
AYB27237.1|3550738_3551200_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	75.5	3.5e-67
AYB27238.1|3551212_3551608_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	9.8e-18
AYB27239.1|3551894_3553025_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AYB27240.1|3553421_3555401_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
AYB27241.1|3555418_3555610_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27242.1|3556032_3556338_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27243.1|3556401_3557001_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
AYB27244.1|3556997_3557225_+	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
AYB27245.1|3557354_3558044_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
AYB28633.1|3558140_3558665_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27246.1|3559038_3559488_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27247.1|3559848_3560535_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
AYB28634.1|3560810_3561140_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AYB27248.1|3561123_3561576_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AYB28635.1|3561593_3562073_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AYB27249.1|3562280_3562814_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	7.8e-34
AYB27250.1|3562770_3564909_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
AYB27251.1|3564905_3565112_+	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AYB28636.1|3565138_3566656_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.7	4.9e-174
AYB28637.1|3566579_3568661_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
AYB27252.1|3568751_3569075_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AYB27253.1|3569067_3569367_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AYB27254.1|3569347_3569914_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
AYB27255.1|3569910_3570312_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
AYB27256.1|3570323_3571073_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	4.8e-90
AYB27257.1|3571118_3571517_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AYB27258.1|3571513_3571843_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AYB28638.1|3571922_3574910_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	2.8e-266
AYB27259.1|3574906_3575239_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
AYB27260.1|3575337_3575835_+	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	35.9	1.4e-16
AYB27261.1|3575951_3576485_-	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AYB27262.1|3576574_3577270_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
AYB27263.1|3577279_3578011_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	1.0e-113
AYB27264.1|3577914_3578619_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
AYB27265.1|3581179_3582043_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
AYB27266.1|3582081_3582324_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27267.1|3582377_3584795_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.8	4.7e-86
AYB27268.1|3584794_3585364_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	90.5	3.4e-96
AYB27269.1|3585565_3586288_-	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AYB27270.1|3586767_3587568_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27271.1|3588521_3589601_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	1.1e-98
AYB27272.1|3590734_3591022_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.9	1.6e-38
3589602:3589631	attR	TGATCAACTTCTCCAGCAATGCACTCGGTT	NA	NA	NA	NA
AYB27273.1|3591018_3591552_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	3.2e-11
AYB27274.1|3591808_3591976_-	lytic enzyme	NA	NA	NA	NA	NA
AYB27275.1|3592040_3592232_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27276.1|3593690_3593891_-	phage virulence factor	NA	NA	NA	NA	NA
AYB27277.1|3594092_3594197_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYB27278.1|3594458_3594584_+	arsenic transporter	NA	NA	NA	NA	NA
AYB27279.1|3594712_3594979_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27280.1|3595731_3596346_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AYB27281.1|3596355_3596514_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28639.1|3598180_3598381_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27282.1|3600689_3600830_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27283.1|3600995_3601265_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
AYB27284.1|3601311_3601506_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27285.1|3601634_3602054_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYB27286.1|3602426_3602903_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27287.1|3603284_3603626_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AYB27288.1|3604309_3605032_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AYB27289.1|3605316_3605481_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27290.1|3605704_3606355_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
AYB27291.1|3606373_3606565_-	DUF1482 family protein	NA	NA	NA	NA	NA
AYB27292.1|3606675_3606915_-	DUF1480 family protein	NA	NA	NA	NA	NA
AYB28640.1|3607029_3608469_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AYB27293.1|3608546_3611186_-	PqiB family protein	NA	NA	NA	NA	NA
AYB27294.1|3611148_3612432_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYB27295.1|3612473_3613058_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AYB27296.1|3613155_3613842_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYB27297.1|3613861_3615910_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AYB27298.1|3616102_3616984_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 249
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3621286	3621496	4868095		Morganella_phage(100.0%)	1	NA	NA
AYB27305.1|3621286_3621496_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 250
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3628983	3630543	4868095		Moraxella_phage(100.0%)	1	NA	NA
AYB27314.1|3628983_3630543_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
>prophage 251
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3634513	3641825	4868095	tRNA	Pandoravirus(33.33%)	8	NA	NA
AYB27318.1|3634513_3635878_-	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	34.5	3.6e-43
AYB27319.1|3635958_3636138_+	YoaH family protein	NA	NA	NA	NA	NA
AYB27320.1|3636143_3636488_-	RidA family protein	NA	NA	NA	NA	NA
AYB27321.1|3636618_3638529_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
AYB27322.1|3638586_3639282_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AYB27323.1|3639353_3639935_+	Slp family lipoprotein	NA	NA	NA	NA	NA
AYB27324.1|3639913_3640120_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28641.1|3640139_3641825_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
>prophage 252
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3677378	3680136	4868095		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AYB27361.1|3677378_3679064_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	2.3e-23
AYB28644.1|3679188_3680136_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
>prophage 253
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3683483	3689141	4868095		Pseudomonas_phage(33.33%)	7	NA	NA
AYB27365.1|3683483_3684566_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	8.7e-08
AYB27366.1|3684565_3685399_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AYB27367.1|3685395_3685785_+	protein sirB2	NA	NA	NA	NA	NA
AYB27368.1|3685788_3686598_+	protein sirB1	NA	NA	NA	NA	NA
AYB27369.1|3686635_3687490_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	1.9e-45
AYB27370.1|3687543_3688644_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AYB28645.1|3688910_3689141_+	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	40.0	4.2e-05
>prophage 254
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3699480	3701019	4868095		Escherichia_phage(100.0%)	1	NA	NA
AYB27377.1|3699480_3701019_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	4.8e-20
>prophage 255
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3705520	3711928	4868095		Synechococcus_phage(33.33%)	7	NA	NA
AYB27382.1|3705520_3706363_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	7.5e-15
AYB27383.1|3706413_3706872_-	YchJ family protein	NA	NA	NA	NA	NA
AYB27384.1|3706982_3707888_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
AYB27385.1|3707978_3708992_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
AYB27386.1|3709194_3710103_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	8.2e-60
AYB27387.1|3710234_3710648_-	DNA-binding protein H-NS	NA	NA	NA	NA	NA
AYB27388.1|3711310_3711928_+	thymidine kinase	NA	A0A023W530	Serratia_phage	54.2	2.7e-54
>prophage 256
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3720297	3723190	4868095		Planktothrix_phage(33.33%)	3	NA	NA
AYB27393.1|3720297_3721305_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	29.3	1.7e-13
AYB27394.1|3721301_3722306_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	8.1e-16
AYB27395.1|3722353_3723190_+	voltage-gated potassium channel	NA	A0A1B0Y2S3	Lactobacillus_phage	42.4	1.0e-08
>prophage 257
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3734859	3737817	4868095		Acinetobacter_phage(100.0%)	2	NA	NA
AYB27410.1|3734859_3736218_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	2.3e-37
AYB27411.1|3736221_3737817_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	39.1	2.0e-53
>prophage 258
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3742798	3748137	4868095	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
AYB27417.1|3742798_3743560_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.2	7.5e-06
AYB27418.1|3743797_3744844_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.5	1.6e-19
AYB27419.1|3744885_3745137_-	DUF2498 family protein	NA	NA	NA	NA	NA
AYB27420.1|3745539_3748137_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.4	4.1e-88
>prophage 259
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3753229	3753820	4868095		Staphylococcus_phage(100.0%)	1	NA	NA
AYB27425.1|3753229_3753820_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	2.9e-42
>prophage 260
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3759404	3763583	4868095		Bacillus_virus(50.0%)	3	NA	NA
AYB28649.1|3759404_3761387_-	cyclic di-GMP phosphodiesterase	NA	G3MA91	Bacillus_virus	31.5	2.9e-17
AYB27435.1|3761401_3761623_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27436.1|3761648_3763583_-	exoribonuclease 2	NA	A0A2H4UVB7	Bodo_saltans_virus	23.5	6.5e-06
>prophage 261
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3768959	3769766	4868095		Bacillus_virus(100.0%)	1	NA	NA
AYB27442.1|3768959_3769766_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
>prophage 262
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3788254	3789124	4868095		Staphylococcus_phage(100.0%)	1	NA	NA
AYB27461.1|3788254_3789124_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.2	3.0e-51
>prophage 263
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3792675	3793533	4868095		Streptococcus_phage(100.0%)	1	NA	NA
AYB27466.1|3792675_3793533_-	helix-turn-helix domain-containing protein	NA	A0A1B0RXG1	Streptococcus_phage	28.1	2.0e-07
>prophage 264
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3803751	3811799	4868095	tRNA	Streptococcus_phage(20.0%)	11	NA	NA
AYB27479.1|3803751_3804267_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	2.3e-22
AYB27480.1|3804524_3805088_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
AYB27481.1|3805068_3805248_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27482.1|3805498_3806653_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.8	1.2e-10
AYB27483.1|3806798_3807782_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AYB27484.1|3808057_3808240_+	hypothetical protein	NA	NA	NA	NA	NA
AYB27485.1|3808268_3809642_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	7.3e-52
AYB27486.1|3809685_3810621_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
AYB27487.1|3810831_3810984_+	multidrug transporter	NA	NA	NA	NA	NA
AYB27488.1|3810976_3811315_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AYB27489.1|3811364_3811799_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
>prophage 265
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3816911	3817901	4868095		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AYB27494.1|3816911_3817901_-	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	42.5	1.2e-69
>prophage 266
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3822693	3828107	4868095		Klosneuvirus(50.0%)	3	NA	NA
AYB28652.1|3822693_3826596_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	28.8	5.5e-52
AYB27500.1|3826659_3827460_+	YdcF family protein	NA	NA	NA	NA	NA
AYB27501.1|3827576_3828107_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	3.5e-18
>prophage 267
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3831867	3832599	4868095		Planktothrix_phage(100.0%)	1	NA	NA
AYB27505.1|3831867_3832599_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.4e-24
>prophage 268
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3839137	3846227	4868095		Synechococcus_phage(33.33%)	6	NA	NA
AYB27510.1|3839137_3840256_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.1	6.8e-32
AYB27511.1|3840210_3840426_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27512.1|3840424_3842050_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	8.5e-07
AYB27513.1|3842110_3843034_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB27514.1|3843326_3844670_+	VOC family protein	NA	NA	NA	NA	NA
AYB27515.1|3844718_3846227_+	carboxylesterase/lipase family protein	NA	L7Y5U6	Megavirus	38.3	7.1e-32
>prophage 269
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3862262	3864227	4868095	protease	Phage_TP(100.0%)	1	NA	NA
AYB27532.1|3862262_3864227_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	26.7	8.6e-22
>prophage 270
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3881822	3883943	4868095		Salmonella_phage(100.0%)	1	NA	NA
AYB27549.1|3881822_3883943_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.9	3.7e-135
>prophage 271
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3891883	3893428	4868095		Escherichia_phage(100.0%)	1	NA	NA
AYB27558.1|3891883_3893428_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	8.3e-20
>prophage 272
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3909048	3910059	4868095		Tupanvirus(100.0%)	1	NA	NA
AYB27569.1|3909048_3910059_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.9	8.6e-26
>prophage 273
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3939535	3940654	4868095		Enterobacteria_phage(100.0%)	1	NA	NA
AYB27596.1|3939535_3940654_-	porin	NA	Q1MVN1	Enterobacteria_phage	58.5	1.6e-113
>prophage 274
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3949537	3949972	4868095		Streptococcus_phage(100.0%)	1	NA	NA
AYB27606.1|3949537_3949972_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.1e-09
>prophage 275
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3958106	3977389	4868095		Escherichia_phage(40.0%)	18	NA	NA
AYB27615.1|3958106_3958310_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
AYB27616.1|3958376_3959843_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	31.4	1.6e-41
AYB27617.1|3959986_3961366_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.4	2.5e-28
AYB27618.1|3962449_3963664_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.7	2.0e-45
AYB27619.1|3963785_3964112_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.0	1.7e-23
AYB27620.1|3964264_3964606_+	DUF1283 family protein	NA	NA	NA	NA	NA
AYB27621.1|3964641_3965202_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AYB27622.1|3965242_3965953_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AYB27623.1|3966056_3966365_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AYB27624.1|3966521_3968960_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	1.2e-219
AYB27625.1|3969058_3971494_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.2	1.7e-205
AYB27626.1|3971504_3972122_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	1.6e-75
AYB27627.1|3972123_3972981_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AYB27628.1|3973023_3973638_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.3	2.5e-28
AYB27629.1|3973942_3974653_+	osmoprotectant import permease OsmY	NA	NA	NA	NA	NA
AYB27630.1|3974681_3975584_+	osmoprotectant ABC transporter substrate-binding protein OsmX	NA	NA	NA	NA	NA
AYB27631.1|3975593_3976241_+	osmoprotectant ABC transporter permease OsmW	NA	NA	NA	NA	NA
AYB27632.1|3976240_3977389_+	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	33.9	2.2e-25
>prophage 276
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	3995105	3999528	4868095		Enterobacteria_phage(50.0%)	3	NA	NA
AYB27648.1|3995105_3996257_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.8	2.1e-116
AYB27649.1|3996409_3998116_+	amidohydrolase	NA	NA	NA	NA	NA
AYB27650.1|3998226_3999528_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.0	4.4e-14
>prophage 277
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4021186	4022461	4868095	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AYB27669.1|4021186_4022461_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 278
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4029384	4029906	4868095		Salmonella_phage(100.0%)	1	NA	NA
AYB27678.1|4029384_4029906_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	60.3	2.3e-51
>prophage 279
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4034981	4042405	4868095		Streptococcus_phage(20.0%)	8	NA	NA
AYB27686.1|4034981_4035836_+	peptidoglycan endopeptidase	NA	A0A1S5SEZ8	Streptococcus_phage	41.0	1.2e-15
AYB27687.1|4035962_4036544_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.5	5.3e-44
AYB27688.1|4036626_4036716_-	YnhF family membrane protein	NA	NA	NA	NA	NA
AYB27689.1|4037011_4038037_+	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.6	3.1e-31
AYB27690.1|4038033_4038966_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB27691.1|4039078_4040284_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AYB27692.1|4040573_4041722_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.9	2.5e-85
AYB27693.1|4041763_4042405_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.3	8.8e-24
>prophage 280
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4066297	4069060	4868095		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AYB27723.1|4066297_4069060_+	hybrid sensor histidine kinase/response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.2	7.9e-29
>prophage 281
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4088515	4091725	4868095		environmental_halophage(50.0%)	3	NA	NA
AYB27740.1|4088515_4089736_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.8	2.9e-92
AYB27741.1|4089732_4091004_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AYB27742.1|4090978_4091725_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.2	2.5e-06
>prophage 282
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4113715	4133344	4868095	tRNA	Tupanvirus(22.22%)	19	NA	NA
AYB27761.1|4113715_4115356_+	cyclohexanecarboxylate-CoA ligase	NA	A0A1V0SBX8	Catovirus	24.1	2.3e-20
AYB27762.1|4115397_4117776_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	2.5e-172
AYB27763.1|4118112_4118946_+	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AYB27764.1|4119101_4120148_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.8	3.3e-81
AYB27765.1|4120304_4120496_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
AYB27766.1|4120530_4121973_-	YdiU family protein	NA	NA	NA	NA	NA
AYB27767.1|4122034_4122748_-	anti-FlhDC factor YdiV	NA	NA	NA	NA	NA
AYB27768.1|4123061_4123526_-	lipoprotein	NA	A0A1V0DZX6	Clostridioides_phage	39.4	2.0e-14
AYB27769.1|4123602_4124352_-	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	4.6e-08
AYB27770.1|4124351_4124903_-	glutathione peroxidase	NA	NA	NA	NA	NA
AYB27771.1|4124994_4125975_-	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AYB27772.1|4126177_4126477_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYB27773.1|4126481_4128869_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYB27774.1|4128884_4129868_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AYB28666.1|4130004_4130049_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AYB27775.1|4130169_4130526_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AYB27776.1|4130576_4130774_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AYB27777.1|4130869_4131412_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
AYB27778.1|4131415_4133344_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	5.5e-130
>prophage 283
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4146168	4148421	4868095		Tupanvirus(100.0%)	1	NA	NA
AYB27793.1|4146168_4148421_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	49.8	1.7e-143
>prophage 284
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4154588	4155416	4868095		Bacillus_virus(100.0%)	1	NA	NA
AYB27801.1|4154588_4155416_+	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	5.0e-72
>prophage 285
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4162114	4163341	4868095		Klosneuvirus(100.0%)	1	NA	NA
AYB27809.1|4162114_4163341_-	succinylornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.8	2.1e-26
>prophage 286
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4166928	4168878	4868095		Streptococcus_phage(100.0%)	1	NA	NA
AYB27815.1|4166928_4168878_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.0	1.4e-40
>prophage 287
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4173763	4177888	4868095		Tupanvirus(50.0%)	4	NA	NA
AYB27820.1|4173763_4174420_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.2	7.3e-18
AYB27821.1|4174522_4175881_-	MFS transporter	NA	NA	NA	NA	NA
AYB27822.1|4176016_4176775_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AYB27823.1|4176904_4177888_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.4	9.7e-06
>prophage 288
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4193188	4196608	4868095		Bacillus_phage(100.0%)	3	NA	NA
AYB27835.1|4193188_4194475_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.3e-10
AYB27836.1|4194619_4194820_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27837.1|4195114_4196608_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.3	2.0e-10
>prophage 289
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4216919	4217450	4868095		Escherichia_phage(100.0%)	1	NA	NA
AYB27867.1|4216919_4217450_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
>prophage 290
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4222076	4225419	4868095		Enterobacterial_phage(50.0%)	5	NA	NA
AYB27872.1|4222076_4222634_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	32.5	2.2e-15
AYB27873.1|4223445_4223709_+	virulence protein PagD	NA	NA	NA	NA	NA
AYB27874.1|4223840_4224053_+	cold-shock protein CspH	NA	NA	NA	NA	NA
AYB27875.1|4224467_4224989_+	lipoprotein	NA	NA	NA	NA	NA
AYB27876.1|4225179_4225419_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
>prophage 291
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4229272	4230523	4868095		Phage_21(100.0%)	1	NA	NA
AYB27880.1|4229272_4230523_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 292
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4234050	4235421	4868095		Bodo_saltans_virus(100.0%)	1	NA	NA
AYB27885.1|4234050_4235421_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	8.5e-109
>prophage 293
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4241741	4243725	4868095		Bacillus_virus(50.0%)	2	NA	NA
AYB27891.1|4241741_4242878_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	2.1e-28
AYB27892.1|4242861_4243725_+	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	26.2	2.0e-10
>prophage 294
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4247311	4251037	4868095		Vibrio_phage(50.0%)	4	NA	NA
AYB27896.1|4247311_4248133_-	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	1.0e-21
AYB27897.1|4248151_4249063_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AYB27898.1|4249091_4250336_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AYB27899.1|4250335_4251037_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.7	2.4e-35
>prophage 295
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4257222	4257480	4868095		Erwinia_phage(100.0%)	1	NA	NA
AYB28671.1|4257222_4257480_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	37.1	2.1e-05
>prophage 296
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4270641	4271283	4868095		Pseudomonas_phage(100.0%)	1	NA	NA
AYB27915.1|4270641_4271283_-	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	35.7	3.2e-26
>prophage 297
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4274557	4275684	4868095		Ralstonia_phage(50.0%)	2	NA	NA
AYB27919.1|4274557_4274794_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AYB27920.1|4274949_4275684_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	1.7e-15
>prophage 298
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4289501	4290452	4868095		Brevibacillus_phage(100.0%)	1	NA	NA
AYB27934.1|4289501_4290452_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.8	2.2e-10
>prophage 299
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4306464	4306710	4868095		Salmonella_phage(100.0%)	1	NA	NA
AYB27954.1|4306464_4306710_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	52.6	4.1e-14
>prophage 300
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4311369	4312290	4868095		Morganella_phage(100.0%)	1	NA	NA
AYB27962.1|4311369_4312290_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.5	1.1e-54
>prophage 301
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4321353	4321893	4868095		Scale_drop_disease_virus(100.0%)	1	NA	NA
AYB27969.1|4321353_4321893_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.7	2.9e-28
>prophage 302
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4326045	4326879	4868095		Pelagibacter_phage(100.0%)	1	NA	NA
AYB27978.1|4326045_4326879_+	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	40.5	3.3e-39
>prophage 303
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4332346	4384485	4868095	tail,terminase,holin,transposase,head,plate,capsid,integrase	Salmonella_phage(81.82%)	70	4327748:4327762	4376613:4376627
4327748:4327762	attL	GCCAGCGGCATCCCT	NA	NA	NA	NA
AYB27984.1|4332346_4333369_-|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
AYB27985.1|4333830_4334649_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27986.1|4334675_4335053_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27987.1|4335445_4335628_-	hypothetical protein	NA	NA	NA	NA	NA
AYB27988.1|4335991_4336213_-	DNA-binding protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
AYB27989.1|4336425_4337433_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
AYB27990.1|4337717_4338287_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
AYB27991.1|4338286_4339849_-|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	100.0	2.6e-287
AYB27992.1|4339835_4340423_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
AYB27993.1|4340425_4341505_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.7	2.5e-204
AYB27994.1|4341497_4341911_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
AYB27995.1|4341915_4342449_-|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
AYB27996.1|4342441_4343506_-|plate	baseplate protein	plate	Q8HAC0	Salmonella_phage	95.1	4.2e-188
AYB27997.1|4343502_4344843_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
AYB27998.1|4344876_4346805_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.7	0.0e+00
AYB27999.1|4346889_4347216_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
AYB28000.1|4347212_4347569_-|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
AYB28001.1|4347568_4349065_-|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	99.8	6.1e-278
AYB28002.1|4349054_4349219_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
AYB28003.1|4349222_4349783_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	99.5	8.8e-105
AYB28004.1|4349779_4350292_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
AYB28005.1|4350263_4350668_-|head,tail	head-tail adaptor protein	head,tail	A0A192Y6C2	Salmonella_phage	99.3	5.4e-72
AYB28006.1|4350664_4350988_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
AYB28007.1|4350990_4351191_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
AYB28008.1|4351241_4352447_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
AYB28009.1|4354329_4354512_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
AYB28010.1|4354523_4356257_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.8	0.0e+00
AYB28011.1|4356253_4356757_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	3.6e-89
AYB28012.1|4356874_4357225_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	8.0e-64
AYB28013.1|4357352_4357787_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28014.1|4358155_4358428_-	peptidase	NA	Q8SBD8	Shigella_phage	77.6	3.8e-29
AYB28015.1|4358312_4358705_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	92.3	1.6e-57
AYB28016.1|4358688_4359165_-	lysozyme	NA	Q8SBE0	Shigella_phage	96.8	1.7e-85
AYB28017.1|4359168_4359522_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	88.7	1.0e-50
AYB28018.1|4359653_4359896_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28019.1|4359964_4360153_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28020.1|4360184_4360937_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	2.4e-134
AYB28674.1|4360950_4361940_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	3.0e-188
AYB28021.1|4361947_4362853_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.0	2.8e-161
AYB28022.1|4362824_4363214_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
AYB28023.1|4363222_4364104_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	1.1e-170
AYB28024.1|4364100_4364574_-	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	93.8	6.6e-53
AYB28025.1|4364570_4365545_-	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	98.1	1.2e-165
AYB28026.1|4365541_4365766_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AYB28027.1|4365762_4366905_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	87.6	1.6e-182
AYB28028.1|4366901_4367456_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	5.9e-101
AYB28029.1|4367484_4367709_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AYB28030.1|4367647_4367833_-	amino acid permease	NA	NA	NA	NA	NA
AYB28031.1|4367806_4368502_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
AYB28032.1|4368706_4368892_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
AYB28675.1|4368819_4369071_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28033.1|4369051_4369348_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	98.0	1.1e-50
AYB28034.1|4369265_4369511_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28035.1|4370047_4370419_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
AYB28036.1|4370476_4371304_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	97.5	1.0e-149
AYB28037.1|4371440_4371980_+	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
AYB28038.1|4372050_4372788_+	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	86.3	1.8e-52
AYB28039.1|4372787_4373261_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.3	5.0e-69
AYB28040.1|4373264_4374014_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	83.6	1.1e-46
AYB28041.1|4374010_4374580_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	91.0	5.8e-104
AYB28042.1|4374604_4374847_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	98.8	2.1e-39
AYB28043.1|4374848_4375838_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
AYB28044.1|4376129_4376927_+	protein MtfA	NA	NA	NA	NA	NA
4376613:4376627	attR	GCCAGCGGCATCCCT	NA	NA	NA	NA
AYB28676.1|4377282_4378557_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.1	8.2e-74
AYB28677.1|4378628_4378880_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28045.1|4379358_4379856_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28046.1|4379866_4380196_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28047.1|4380217_4380781_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28048.1|4381191_4382073_+	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	42.0	3.3e-29
AYB28049.1|4382646_4384485_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	I1TR70	Cronobacter_phage	49.0	1.0e-32
>prophage 304
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4396007	4396742	4868095		Cellulophaga_phage(100.0%)	1	NA	NA
AYB28063.1|4396007_4396742_+	DNA-binding protein	NA	M1Q742	Cellulophaga_phage	39.3	2.2e-26
>prophage 305
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4401952	4404264	4868095		Stenotrophomonas_phage(50.0%)	3	NA	NA
AYB28070.1|4401952_4402171_-	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	52.8	3.0e-08
AYB28071.1|4402321_4403197_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28072.1|4403739_4404264_+	peptidase	NA	G9L6C4	Escherichia_phage	77.7	1.3e-36
>prophage 306
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4420527	4421343	4868095		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AYB28085.1|4420527_4421343_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.1	4.5e-09
>prophage 307
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4434856	4435651	4868095		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
AYB28101.1|4434856_4435651_-	aquaporin	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	27.2	1.2e-11
>prophage 308
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4455352	4457988	4868095		Stx2-converting_phage(50.0%)	3	NA	NA
AYB28127.1|4455352_4456525_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	87.9	1.1e-200
AYB28128.1|4456648_4457413_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
AYB28129.1|4457409_4457988_-	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.2	3.9e-23
>prophage 309
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4468964	4469864	4868095		Cellulophaga_phage(100.0%)	1	NA	NA
AYB28135.1|4468964_4469864_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	100.0	1.7e-12
>prophage 310
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4477307	4480118	4868095		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
AYB28144.1|4477307_4478474_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	53.5	2.4e-112
AYB28145.1|4478535_4478724_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28146.1|4478711_4480118_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.2e-36
>prophage 311
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4483202	4484642	4868095		Hokovirus(100.0%)	1	NA	NA
AYB28149.1|4483202_4484642_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	1.3e-54
>prophage 312
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4489595	4501989	4868095		Enterobacteria_phage(33.33%)	11	NA	NA
AYB28154.1|4489595_4490612_-	CDP-paratose 2-epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	27.1	2.1e-24
AYB28155.1|4490608_4491448_-	CDP-paratose synthase	NA	NA	NA	NA	NA
AYB28156.1|4491483_4492797_-	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYB28157.1|4492823_4493903_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
AYB28158.1|4493907_4494681_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYB28159.1|4495675_4496227_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
AYB28160.1|4496227_4497106_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
AYB28161.1|4497153_4498053_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AYB28162.1|4498052_4499138_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYB28163.1|4499514_4500408_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYB28164.1|4500585_4501989_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 313
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4507546	4514252	4868095		Bacillus_phage(25.0%)	6	NA	NA
AYB28169.1|4507546_4508917_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.4	7.6e-33
AYB28170.1|4509027_4510470_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.5	1.0e-48
AYB28171.1|4510466_4511690_-	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AYB28172.1|4511686_4512160_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AYB28173.1|4512162_4513128_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	6.0e-85
AYB28174.1|4513130_4514252_-	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	65.3	6.9e-133
>prophage 314
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4519427	4528727	4868095		Streptococcus_phage(25.0%)	8	NA	NA
AYB28181.1|4519427_4521587_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	5.4e-17
AYB28182.1|4521583_4522033_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AYB28183.1|4522038_4523178_-	polysaccharide export protein	NA	NA	NA	NA	NA
AYB28184.1|4523260_4523497_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28185.1|4523852_4525433_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.1e-38
AYB28186.1|4525518_4527375_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AYB28187.1|4527413_4527995_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	9.3e-33
AYB28188.1|4528085_4528727_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	2.5e-34
>prophage 315
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4539174	4545786	4868095		Bacillus_phage(66.67%)	3	NA	NA
AYB28193.1|4539174_4542255_+	multidrug efflux RND transporter permease subunit MdtC	NA	S5VTK5	Leptospira_phage	23.1	2.7e-62
AYB28194.1|4543663_4545067_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.7	4.7e-30
AYB28195.1|4545063_4545786_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	6.4e-31
>prophage 316
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4550210	4551572	4868095		Phage_TP(100.0%)	1	NA	NA
AYB28683.1|4550210_4551572_+	U32 family peptidase	NA	Q6DW11	Phage_TP	95.6	4.6e-208
>prophage 317
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4569186	4578357	4868095	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYB28216.1|4569186_4571220_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
AYB28217.1|4571460_4571919_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	71.2	7.1e-52
AYB28218.1|4572090_4572621_+	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AYB28219.1|4572677_4573145_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	8.8e-74
AYB28220.1|4573191_4573911_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYB28221.1|4573907_4575593_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.4e-278
AYB28222.1|4575815_4576547_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	2.2e-100
AYB28223.1|4576606_4576714_+	protein YohO	NA	NA	NA	NA	NA
AYB28224.1|4576694_4577426_-	ABC transporter permease	NA	NA	NA	NA	NA
AYB28225.1|4577409_4578357_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 318
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4609596	4610265	4868095		Cellulophaga_phage(100.0%)	1	NA	NA
AYB28252.1|4609596_4610265_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
>prophage 319
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4615704	4617696	4868095		Acinetobacter_phage(100.0%)	1	NA	NA
AYB28259.1|4615704_4617696_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
>prophage 320
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4621813	4622671	4868095		Catovirus(100.0%)	1	NA	NA
AYB28263.1|4621813_4622671_+	endonuclease	NA	A0A1V0SBL9	Catovirus	28.5	9.9e-23
>prophage 321
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4632812	4633385	4868095		Clostridioides_phage(100.0%)	1	NA	NA
AYB28276.1|4632812_4633385_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
>prophage 322
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4639357	4653546	4868095	tail	Salmonella_phage(33.33%)	13	NA	NA
AYB28281.1|4639357_4640947_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	3.2e-19
AYB28282.1|4640950_4641295_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28283.1|4641685_4642876_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
AYB28284.1|4642903_4643599_-	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AYB28285.1|4643750_4645511_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
AYB28286.1|4645635_4645920_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
AYB28287.1|4646028_4646649_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28288.1|4646676_4647684_-	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
AYB28289.1|4647863_4648091_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
AYB28290.1|4648122_4649883_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
AYB28291.1|4650653_4652960_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	90.1	1.7e-72
AYB28292.1|4653054_4653297_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28293.1|4653183_4653546_-|tail	phage tail protein	tail	S4TUB9	Salmonella_phage	86.5	7.3e-52
>prophage 323
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4662754	4663372	4868095		Brazilian_cedratvirus(100.0%)	1	NA	NA
AYB28304.1|4662754_4663372_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	1.8e-10
>prophage 324
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4670462	4676280	4868095		Bacillus_phage(33.33%)	5	NA	NA
AYB28313.1|4670462_4672106_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.6	7.5e-11
AYB28314.1|4672181_4672832_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
AYB28315.1|4672834_4673896_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A167R6J9	Powai_lake_megavirus	58.0	1.4e-18
AYB28316.1|4673976_4675029_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AYB28317.1|4675143_4676280_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	6.6e-115
>prophage 325
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4680446	4687659	4868095		Hokovirus(33.33%)	4	NA	NA
AYB28320.1|4680446_4683293_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.4	4.1e-41
AYB28321.1|4683410_4686047_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	4.3e-93
AYB28322.1|4686126_4686357_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28323.1|4686456_4687659_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	36.3	4.6e-58
>prophage 326
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4691099	4698300	4868095		Pseudomonas_phage(50.0%)	6	NA	NA
AYB28327.1|4691099_4693385_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	1.3e-282
AYB28328.1|4693497_4694628_+	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	8.7e-176
AYB28329.1|4694627_4694882_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	74.6	3.1e-25
AYB28330.1|4694883_4696074_-	MFS transporter	NA	NA	NA	NA	NA
AYB28331.1|4696235_4697114_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB28332.1|4697229_4698300_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 327
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4707913	4709119	4868095		Oenococcus_phage(100.0%)	1	NA	NA
AYB28688.1|4707913_4709119_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	3.5e-26
>prophage 328
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4712766	4717775	4868095		Tupanvirus(50.0%)	4	NA	NA
AYB28345.1|4712766_4713372_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	43.8	1.9e-12
AYB28346.1|4713652_4714810_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.1	6.0e-31
AYB28347.1|4714812_4715796_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.7	1.7e-34
AYB28348.1|4715792_4717775_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.8	7.9e-23
>prophage 329
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4730342	4731344	4868095		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AYB28363.1|4730342_4731344_+	chemotaxis signal transduction protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.9	1.8e-28
>prophage 330
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4753039	4756311	4868095		Salmonella_phage(50.0%)	3	NA	NA
AYB28383.1|4753039_4753639_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
AYB28384.1|4753730_4755557_-	SLC13 family permease	NA	NA	NA	NA	NA
AYB28385.1|4755633_4756311_-	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.3e-08
>prophage 331
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4767119	4768139	4868095		Enterobacteria_phage(100.0%)	1	NA	NA
AYB28397.1|4767119_4768139_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	3.2e-20
>prophage 332
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4771867	4772641	4868095		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AYB28690.1|4771867_4772641_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.7e-10
>prophage 333
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4784072	4785590	4868095		Mollivirus(100.0%)	1	NA	NA
AYB28414.1|4784072_4785590_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	6.3e-89
>prophage 334
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4792091	4793228	4868095		Brazilian_cedratvirus(100.0%)	1	NA	NA
AYB28422.1|4792091_4793228_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
>prophage 335
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4796651	4797020	4868095		Campylobacter_virus(100.0%)	1	NA	NA
AYB28425.1|4796651_4797020_+	hypothetical protein	NA	H6SUH4	Campylobacter_virus	37.9	3.9e-08
>prophage 336
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4804277	4805363	4868095		Pandoravirus(100.0%)	1	NA	NA
AYB28434.1|4804277_4805363_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 337
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4814545	4820584	4868095		Salmonella_virus(50.0%)	6	NA	NA
AYB28443.1|4814545_4815487_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
AYB28444.1|4816729_4817119_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
AYB28445.1|4817087_4817342_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
AYB28446.1|4817359_4819282_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	76.9	8.1e-299
AYB28447.1|4820271_4820415_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
AYB28448.1|4820353_4820584_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	5.4e-08
>prophage 338
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4829274	4830195	4868095		Morganella_phage(100.0%)	1	NA	NA
AYB28455.1|4829274_4830195_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	1.1e-75
>prophage 339
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4851588	4861438	4868095		Lactobacillus_phage(25.0%)	9	NA	NA
AYB28473.1|4851588_4852515_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.4	2.0e-08
AYB28474.1|4852604_4853603_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
AYB28475.1|4853599_4853818_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28476.1|4853819_4855835_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.6	9.8e-146
AYB28477.1|4855906_4856893_-	cell division protein ZipA	NA	NA	NA	NA	NA
AYB28478.1|4857124_4857886_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
AYB28479.1|4858049_4859021_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	9.7e-75
AYB28480.1|4859404_4859662_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AYB28481.1|4859710_4861438_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
>prophage 340
CP032396	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 chromosome, complete genome	4868095	4866497	4867409	4868095		Streptococcus_phage(100.0%)	1	NA	NA
AYB28490.1|4866497_4867409_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.8	2.9e-57
>prophage 1
CP032397	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence	329264	92711	149304	329264	transposase,integrase	Salmonella_phage(23.08%)	59	99755:99769	158297:158311
AYB28784.1|92711_93974_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AYB28785.1|94792_95938_+	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
AYB28786.1|96031_96565_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
AYB28787.1|96561_96879_-	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
AYB28788.1|97135_97561_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AYB28789.1|97606_103093_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
99755:99769	attL	CGGATCATCGAAACC	NA	NA	NA	NA
AYB28790.1|103241_103949_+	DsbC family protein	NA	NA	NA	NA	NA
AYB28791.1|103945_106393_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
AYB28792.1|106407_106725_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28793.1|106721_107252_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AYB28794.1|107214_108480_+	conjugal transfer protein TraW	NA	NA	NA	NA	NA
AYB28795.1|108476_109148_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYB28796.1|109144_110152_+	conjugal transfer protein TraU	NA	NA	NA	NA	NA
AYB28797.1|110255_113063_+	conjugal transfer mating pair stabilization protein TraN	NA	NA	NA	NA	NA
AYB28798.1|113101_113962_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28799.1|114084_114726_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28800.1|115020_115341_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28801.1|115644_115830_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28802.1|116049_117018_+	CbbQ/NirQ/NorQ/GpvN family protein	NA	L7TKP0	Rhizobium_phage	32.6	1.2e-29
AYB28803.1|117028_117937_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28804.1|117997_118528_+	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
AYB28805.1|118622_119612_+	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
AYB28806.1|119674_120685_+	endonuclease	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
AYB28807.1|120590_120803_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28808.1|120884_122162_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
AYB28809.1|122246_124043_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AYB28810.1|124104_124440_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28811.1|124704_125244_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28812.1|125334_125835_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28813.1|125908_126793_+	DNA adenine modification methylase	NA	NA	NA	NA	NA
AYB28814.1|126858_127083_+	2Fe-2S ferredoxin-like protein	NA	NA	NA	NA	NA
AYB28815.1|127144_127534_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28816.1|127523_127976_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28817.1|127956_128256_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28818.1|128313_128505_+	hypothetical protein	NA	NA	NA	NA	NA
AYB29041.1|128549_128927_+	topoisomerase II	NA	NA	NA	NA	NA
AYB28819.1|129118_129463_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28820.1|129540_129843_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28821.1|129920_131546_+	DNA cytosine methyltransferase	NA	A0A0N9SK84	Staphylococcus_phage	25.8	1.2e-05
AYB28822.1|131561_132038_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28823.1|132111_132666_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28824.1|132898_133285_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28825.1|133372_135826_+	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
AYB28826.1|136027_136231_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28827.1|136302_136908_+	5'-deoxynucleotidase	NA	NA	NA	NA	NA
AYB28828.1|136900_137170_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28829.1|137183_137402_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28830.1|137475_138033_+	pyruvate dehydrogenase	NA	NA	NA	NA	NA
AYB28831.1|138107_138959_+	NgrC	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
AYB28832.1|139417_139804_+	hypothetical protein	NA	NA	NA	NA	NA
AYB29042.1|139981_141709_+	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
AYB28833.1|141695_141974_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28834.1|142046_142268_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28835.1|142449_143454_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AYB28836.1|143532_146505_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AYB28837.1|146507_147065_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AYB28838.1|147102_147426_-|transposase	transposase	transposase	NA	NA	NA	NA
AYB28839.1|147370_148384_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYB28840.1|148599_149304_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
158297:158311	attR	CGGATCATCGAAACC	NA	NA	NA	NA
>prophage 2
CP032397	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence	329264	163152	217193	329264	transposase,integrase	Macacine_betaherpesvirus(26.67%)	59	178692:178751	217451:219142
AYB28855.1|163152_164163_+|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
AYB28856.1|164167_165037_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
AYB28857.1|165033_165525_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28858.1|165851_166727_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
AYB28859.1|166888_167929_+	DNA-binding protein	NA	NA	NA	NA	NA
AYB28860.1|167928_168207_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28861.1|168215_169727_+	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
AYB28862.1|169837_170878_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AYB28863.1|170879_172313_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
AYB28864.1|172325_175940_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AYB28865.1|175977_176340_-	permease	NA	NA	NA	NA	NA
AYB28866.1|177055_177328_+	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
AYB28867.1|177327_177861_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
AYB28868.1|177871_178480_+	transcriptional regulator	NA	NA	NA	NA	NA
AYB29043.1|178476_178722_+	hypothetical protein	NA	NA	NA	NA	NA
178692:178751	attL	GAACCACGGCAGCCTGGCGGCTGCAAATTGAAAACCGCCCCGGTTCGTCCTGTTGTTGCC	NA	NA	NA	NA
AYB28869.1|178810_178999_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28870.1|179008_180208_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYB28871.1|180966_181899_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	2.2e-44
AYB28872.1|181908_182196_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28873.1|182220_182361_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AYB29045.1|182259_182493_+	hypothetical protein	NA	NA	NA	NA	NA
AYB29044.1|182422_182614_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28874.1|182664_182895_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28875.1|183552_184272_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AYB28876.1|184268_184703_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AYB28877.1|184757_186794_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.2	4.9e-20
AYB28878.1|186774_187035_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	4.3e-06
AYB28879.1|187372_188194_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28880.1|188424_188637_+	hypothetical protein	NA	A0A191ZBY1	Erwinia_phage	50.7	7.6e-09
AYB28881.1|188732_193496_-	ATP-binding protein	NA	NA	NA	NA	NA
AYB29046.1|193571_193832_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28882.1|193983_196017_-|integrase	integrase	integrase	NA	NA	NA	NA
AYB28883.1|196033_197572_-	recombinase	NA	NA	NA	NA	NA
AYB28884.1|197558_198806_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AYB28885.1|198964_199492_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	54.3	6.7e-46
AYB28886.1|199517_199658_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AYB29047.1|199556_199790_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28887.1|199719_199911_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28888.1|199833_200058_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28889.1|199961_200210_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28890.1|200131_200362_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28891.1|200361_200925_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	38.0	2.7e-21
AYB28892.1|200971_202333_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AYB28893.1|202384_202615_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28894.1|203652_203844_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28895.1|203840_204263_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AYB28896.1|204309_204735_-	antirestriction protein	NA	NA	NA	NA	NA
AYB28897.1|205978_206413_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AYB28898.1|206426_206648_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28899.1|206648_207332_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
AYB29048.1|207716_208619_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AYB28900.1|208656_208929_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28901.1|209485_210457_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
AYB28902.1|210456_211623_-	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
AYB28903.1|212210_212966_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
AYB28904.1|213739_214546_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
AYB28905.1|214546_214852_-	toxin CcdB	NA	NA	NA	NA	NA
AYB28906.1|214853_215072_-	antitoxin CcdA	NA	NA	NA	NA	NA
AYB28907.1|215993_217193_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
217451:219142	attR	GGCAACAACAGGACGAACCGGGGCGGTTTTCAATTTGCAGCCGCCAGGCTGCCGTGGTTCATTAATTAGTAGTAAGAAGAAAATCGATGTTTTTCTTCCGGTAGAGTTTTATACGCAGTTTCAAAATCTTCGATTTTGATTGCCAGCTCATCACCAAAATCTTTTATCTGGCGCTTAAAACATTCACCAGTAAAATCATTTAAAACGGGAGTCTTAAAGCCGACCATTGAATCTGTATATTCTGAATTGGCGCGAATCTCGCGAACGGTGACGTTTTTTTTACCGTGAACAGAAAGAACCTGGTAGAAGGTTACATTGGTTTGCTCATAGCCCCAGGATGATACAAAGACATCACCAACAGAGACAGTATCATTTTTAAAAGTTAATACTTTCATTTTTAGCTCCCGCCCAGCTTGGGCTCTGGATGAAAGAGAACCTGTTTCCCTTTCTTGTGTTTTATTATACCTGCATTTGCAGGTATAACAAGTTATTTTTTTACCAGCCTGTAAGACGGATGCATATTTGCTAATAGCAATAAATACTGATATTCACCAACAGATAAAGAACGACTGGCCTTACCTGCACTTTCTTTCATCTGCCAGGAATTCAGTTGATAACCAAAAATATCAGCAGCTTCTTTAAGAGTAAGACCTGCCGCAACCCGTGCATTCTTTACTTCTTCAGGTGTAGGTTTATTCTGCATTTTCATCCCCTTTTGTCAGACAATCACACAAAATCCCATTATCCAGAAGCATCAATGATGCCAGGTTGAGTTTTTCGTCCATTATCAATTTTCTTACTGTTTTCCTGCTTTTAGTTTTATCAATCGTCTTAACATATTTTAAGACGTGAAAAACCGCATCCCCATCTTCATCCATCGTTCTGATTACATAAGAGTAATTACCTCTGTTTTTCTTAATTATCTTATCTTTATCCATATTATTCCTCATAACTAAAAAAGGGGCTTAATGCCCCTTTTTATCTATAACACGGTATGTAACCCTGTTTCCTGTGTAAATAAACACGCTAACTGATCACAATAGATATTATCGAATCTTGAAATATCTTTAACTTCAGCACCACGTACACGAGAAAATTTCACCTGGTACGTATCAGTAAAATCCAGTTTAATTTTTACTAAGTTGATGCCTTTCATTGCAAAATTTGACGGTAAACGGAAAGTTACCCCACACTCACCGTTTTCATCAAAGTAAGAAAAACTTTTAGCACCAGTCATAACAATAAAACGATTACCACCAAGTTGACGTAAAATCTCTGTGGCTACAGATTTAGCGTAGTTTTGCATTTTTAACCTCCCGCCCACTTTGGGCTCTGGATGAAAGAGAACCTGTTTCCCTTTCTTGTGTTTCACTATACCTGCATTTGCAGGTATAGCAAATTTTTAATGCTCTCGTTCAGACTGTAAACAGTCAATCATTTGATGATTAATCTTAGCGCAAATCTGCGATCTGATAGACTTCGCTGCTTTCCCTTCTTCCAACGGCAATAACGAGTAAAACGACTTTCTCATCAATGACTTGATATACAAGTCTGTAGCCAGATGCACGAAGTTTGATTTTATAGCGATCAGCATGACCATGTAACCGGGCTGCGGGTACGCGTGGATTTTCCAGCCGTTCTGCCAGTTTCTTTTTGAATTGTTCACGGATGGTGTGGCCGAGTTTCTGCCAT	NA	NA	NA	NA
>prophage 3
CP032397	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence	329264	221428	254179	329264	transposase,integrase	Escherichia_phage(28.57%)	40	215819:215878	254295:255986
215819:215878	attL	GTTCACGTATAGGAAATTGAAAAACCAGTCGATACCATTGTCCACGCCTTATGCCACGTG	NA	NA	NA	NA
AYB28916.1|221428_222628_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYB28917.1|222637_222826_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28918.1|223223_223670_+	hypothetical protein	NA	NA	NA	NA	NA
AYB29049.1|223806_224160_+	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
AYB28919.1|224384_224564_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28920.1|224798_225029_-	DNA partition complex ParG	NA	NA	NA	NA	NA
AYB28921.1|225080_225701_-	chromosome partitioning protein ParA	NA	A2I303	Vibrio_virus	33.8	6.3e-19
AYB28922.1|227067_227634_-	DUF2913 family protein	NA	NA	NA	NA	NA
AYB28923.1|227690_228026_-	hypothetical protein	NA	NA	NA	NA	NA
AYB29050.1|228209_228626_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
AYB28924.1|228711_229827_-	DNA-binding protein	NA	NA	NA	NA	NA
AYB28925.1|230085_230574_+	cytoplasmic protein	NA	NA	NA	NA	NA
AYB28926.1|231228_231969_+	carbonic anhydrase	NA	NA	NA	NA	NA
AYB28927.1|232175_232736_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	43.2	1.5e-32
AYB28928.1|232719_234384_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AYB28929.1|234316_235342_+	AAA family ATPase	NA	NA	NA	NA	NA
AYB28930.1|235530_236568_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AYB28931.1|237174_238068_+	virulence genes transcriptional activator SpvR	NA	NA	NA	NA	NA
AYB28932.1|238241_238406_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
AYB28933.1|238579_239347_+	Virulence protein SpvA	NA	NA	NA	NA	NA
AYB28934.1|239528_241310_+	SPI-2 type III secretion system effector NAD(+)--protein-arginine ADP-ribosyltransferase SpvB	NA	NA	NA	NA	NA
AYB28935.1|241590_242316_+	type III secretion system effector phosphothreonine lyase SpvC	NA	NA	NA	NA	NA
AYB28936.1|242576_243227_+	SPI-2 type III secretion system effector cysteine hydrolase SpvD	NA	NA	NA	NA	NA
AYB28937.1|243353_243779_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	3.4e-24
AYB28938.1|243835_244204_+|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	74.8	7.0e-42
AYB28939.1|244270_244831_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AYB28940.1|245372_245882_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
AYB28941.1|246606_247389_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
AYB28942.1|247423_247945_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYB28943.1|247941_248232_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYB28944.1|248233_248539_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
AYB28945.1|248540_248759_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
AYB28946.1|249503_249734_+	virulence-associated protein vagC	NA	NA	NA	NA	NA
AYB28947.1|249730_250159_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AYB28948.1|250366_250654_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28949.1|250728_251577_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28950.1|252024_252237_-	faeA-like family protein	NA	NA	NA	NA	NA
AYB28951.1|252309_252726_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28952.1|252781_252970_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28953.1|252979_254179_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
254295:255986	attR	CACGTGGCATAAGGCGTGGACAATGGTATCGACTGGTTTTTCAATTTCCTATACGTGAACCCGGCTTATCCATCTCAAAACTGGCGCTTGAAAACGGCATTAACGCCAATCTGTTGTTTAAATGGCGCAAGGGAAAGCTGCTATTACCTTTCAGCTACTCCCTGTGACTCTCAATGCCACCTCCGTACAGCCAGAACTAACCGCTGAAGGCCCGGAGGTTCTCAGTATCAGCTGTGAGGCAACGTTCTGGCACGGGACGCTTCGCCTCAACGGCACTGTCAGCGAAAAGCTCCTGACTCTGCTGATACAGGAACTGAAGCGATGATCCCGTTACCTTCCGGGACCAAGATCTGGCTGGTTGCAAAAGTGCAGACGGTGCTGAAAGATGATCCGATGTCCGGCCACCTCTTCATCTTCCGGGGTCACAGTGGCAGTCAGGTCAAACTGCTGTGGTCTACCGGAGACAGCTGGAGCGCGGGCGTCAGCCCGCGATAGCAAAGTGTTCCTGACACCGGCGCAGCTGGATAAGCTTCGGCAATCGTTCCGAAAAGGTCTCCCGCTGCATCGCACAGATGGAAGCCGACCTGAACCGGCTGCAGAAAGAAGGCGATGCGCTGCGTCAGACCCGCACCCGCAAACCGTTCCCCGCATCACTCCCCCGTGACGAAAAACAGCTGCAGCCGGCAGAGGCATGCTGCCCGGACTGCGGCGATGCGTTGAGTTATTTGGGCGAAGATGCCGCCGAATAGCTGGAGCTGATGCGCAGCGCCTTCCGGGTTATCCGGACCTGCGGGAAAAACACGTCTGTACAAAATGCGACGCCATCGAGCGAGGTATCGCCGGGCCGGGGCTGCTGGCCCGAGTGCTGAGTTCAAAGTATGCAGAGTATACCCCGATGTATCGTCAGTCAGAAATATACAGTTGCCAAGTGTAGAGCGATTTCTTTCAGTTTGTCTTCGGTCTTGAATTGTCAACTGCTGAATCGCGGGGGCCCCTTCGGGGTTCCGATTCAGTGGTTGACAACTGCACAGAAAATACCCTGCTGGCGGGGTGATGGTTCACGCAGTGGGCCATCGCCCTGCAAAGCCAGACGGGGCATAACGCCACTCAGTAGTTTAGTTACATCATTCATTATTAAAAGCGACTCCATTCCGGCCCTTTGGGCCGGGGCGGCGGCGCTTTTCAGTGGTGGGAATGGGCTGGATATCAGGTTTTTGCTCCGGTTTCGTTGGTCAGGATTTTGGATGTTGTAACTATTTGCATGACCGGGGCCCGGCGCATCGCGACGGGAGGTACTGATGGTGTTTCCGAACCGGCGCGGACGTGAGTCCGCTGCAAGGGCGCGCATTCTCTGGAACCTGTCCACAGGGCAGGTGATGAATAGGTTATTTATTTATAAGAGAGAAAGATTATGTATTTAAAAGAAGTATAGATCTGGGGTTTAAAGGAAACCACGCACTTTGAAATCAGGTCGCCTGGCGCTTTGTCAGTATATCGGTTGTAACTTTATGGAAAGGTCCCTTGCAGTTATCTGTGAGTAACTGAATATTACGACCGGAAATGGCTCAGGCGGGAACATTTCTGGCCATTCTGGCAGCAGAATGAGAGATATTTTGGCAGGAAGAACGAGCGTTCCGCGCAGAAAACAGGCGGTGCCAGGCGACAGACGTACAAAATCCTCCGGCGTCAGCC	NA	NA	NA	NA
>prophage 4
CP032397	Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence	329264	285923	321663	329264	coat,transposase,integrase	Escherichia_phage(40.0%)	41	288696:288755	323995:325687
AYB28982.1|285923_287111_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
AYB29053.1|287107_287653_-	DNA distortion polypeptide 1	NA	NA	NA	NA	NA
AYB28983.1|287768_287918_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28984.1|287978_288251_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28985.1|288263_288461_-	hypothetical protein	NA	NA	NA	NA	NA
AYB29054.1|288482_288662_-	hypothetical protein	NA	NA	NA	NA	NA
288696:288755	attL	CTTGACGTATAGGAAATTGAAAAACCAGTCGATACCATTGTCCACGCCTTATGCCACGTG	NA	NA	NA	NA
AYB28986.1|288870_290070_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYB28987.1|290079_290268_-	hypothetical protein	NA	NA	NA	NA	NA
AYB28988.1|290624_291440_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.9	4.3e-161
AYB28989.1|291834_292293_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AYB28990.1|292310_292673_+	transcriptional regulator	NA	NA	NA	NA	NA
AYB28991.1|292669_292906_+	mercury resistance protein	NA	NA	NA	NA	NA
AYB28992.1|292902_293610_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYB28993.1|293648_295364_+|transposase	transposase	transposase	NA	NA	NA	NA
AYB28994.1|295366_296227_+|transposase	transposase	transposase	NA	NA	NA	NA
AYB28995.1|297944_299468_+|transposase	IS21 family transposase IS1326	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
AYB29055.1|299457_300240_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
AYB28996.1|300774_301275_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYB28997.1|301293_301473_+	hypothetical protein	NA	NA	NA	NA	NA
AYB28998.1|301402_302242_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AYB28999.1|302235_302583_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AYB29056.1|302746_303538_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA12	NA	NA	NA	NA	NA
AYB29000.1|303683_304697_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYB29001.1|304635_305250_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AYB29002.1|305375_305936_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYB29003.1|305938_308905_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYB29004.1|308983_309988_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AYB29005.1|310268_310601_+	hypothetical protein	NA	NA	NA	NA	NA
AYB29006.1|310557_310746_+	hypothetical protein	NA	NA	NA	NA	NA
AYB29007.1|311234_311477_+	relaxase	NA	NA	NA	NA	NA
AYB29008.1|311508_312186_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYB29009.1|312264_313464_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AYB29010.1|313730_314036_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB29011.1|314063_315278_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	3.2e-19
AYB29012.1|315494_316379_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AYB29013.1|316409_317903_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYB29014.1|318113_318338_-	hypothetical protein	NA	NA	NA	NA	NA
AYB29015.1|318334_319072_-	resolvase	NA	NA	NA	NA	NA
AYB29016.1|319178_319670_+	hypothetical protein	NA	NA	NA	NA	NA
AYB29017.1|319703_320408_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB29018.1|320958_321663_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
323995:325687	attR	CACGTGGCATAAGGCGTGGACAATGGTATCGACTGGTTTTTCAATTTCCTATACGTCAAGCATCGACATAATTATTTTCCTCCCCAGGGCACAAGTTTTGTCGAATATCCAAGCATTAGTGGGTGCTTCGGGTCCCCCGAACCAGTCACGCCAAATGCCAATACCGGCTTCCCAGATGCAACGAGCTGCTCTAAAAGCCTGTCCAAATGAACATGCAAAGACTTAGGCAGCTTAGTTCGGCTCCCCCAGCAGGGCACCAAGACATCAGCATCCCGAATAATCCTTTCCAAGTGGATTTCATTTTCAGGCCCGACAGGATCAACCGCCGTAGCCAGCTCTCGAACGTCGGTCGCCCGAAAAGCAAAAGCATTACCGACTATGAATCGCCTCCCTCCGTTGACCTTGGTAAACCCTATCCACTTTCTGACCGTGTGATCGTCCTCGGTGGCCGTGGCCGTAGAGCCGTTTACACCAAAATAACCGAACACAAGGCCTTCGGGTTGCACATCCCTTTCCAGACGGTATCTGTACATGCCGCACTTGCTGATAATTGCACTCAAAGTGTCACCTCTTTTTGAATGAAAAATGCCCTTTCACAGTTGCATTTTTTAATGCTGTGATAGGATAAAAGTGTAAGTTGAAAAGGAGAGATGACCATGAAACATGTACTGAATATCGCGCTGATGGCTGTTGTTATTCTTGGCCTGGCTATGCTTGAGGCCACCAACTGGGGTTACGCAGTGCTGGCTATCCCGGCAGTGATTTGGGCCAAGTCGGTGCTCAACCTTCTGCACAAACTGCCGGTTCTGGCTGCTGCTTTTTGGATTCTGGTTGCTGTTTTCGCGTGGCAAGCGGCACTTGTTGGTATCCTGTTCTATGGCGTACTTGCGACCCCTAAAGCGCCAGCAAACACCAATGGCAAGAAAAGCCGAAAAGCCAATCTGATGGGCACTTACAGCTACGACTTTAAAACCGGCGAATGCTTTAGCTAAGACTGGCTCCACGGTTATTTCTCCTCAGCCTTCCTGATGGGCGCTCTCAGCGCTCTCAGGACAGCTTCTTCAAGAGCTGCGGCCCCTGCCCTATCACGTCGCTTTGTTAATGCCCCATATTGCTTCCTGATGGGTAGCATCAGCTCTTCGAGTTCATTGCGCTTCCTATCGTCGGCTTCAAGTTTCTCGCTTCGCGCCAAGGCTTCGGCTTGCTCGCTTTTTGCTTGCCACTCTATCTTGTCGCCTTGCACTTCCCATGCTTTAACGTAATGAGCATCATCCAGACCTTTTGCTCCGTTGTCCGAAAACGAGGCCCCTGAGTAAATGCCACCGACAACCCAGCGCCTTTTGCTTTTTCCCTTTGAGAAATACATCTCACGGCCTAAAACACCATCGCGCAAAGTGGCTACCGAGATAAATAGCCCAGCGTCCCCTTTCCTAAAGCCGCAGAACACAAACTCAAGCGGTTCGTATAAATCACTCATGCTGATCACTCCGAAGAACAGACAAGACCTTCTCAGCTCGCTCCTGGAGGTCTATGAGTTCGGCAGCATCATTACCGCTCAATGACATGTCCCCGCCATAGAGGCGATACTCAACGCTGTCCATCGCCTGGCGAAGCAATCCTAGAAGAGCATTCACGTTTGCCGGTGTTGATAGGGCGACGGCTTCACCTTTCAGCTCACGTCCATTAAATTCCG	NA	NA	NA	NA
