The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP023140	Acinetobacter baumannii strain XH906 chromosome, complete genome	3891370	1165680	1180486	3891370		Acinetobacter_phage(100.0%)	10	NA	NA
AYC01176.1|1165680_1166235_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	2.7e-98
AYC01177.1|1166491_1167991_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	100.0	6.1e-286
AYC01178.1|1167992_1170368_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	100.0	0.0e+00
AYC01179.1|1170374_1171358_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	100.0	2.0e-189
AYC01180.1|1171368_1172064_-	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
AYC01181.1|1172073_1172880_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	100.0	7.9e-147
AYC03637.1|1172889_1173939_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
AYC01182.1|1174294_1177027_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	99.9	0.0e+00
AYC01183.1|1177106_1179806_+	aminopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	100.0	0.0e+00
AYC01184.1|1179901_1180486_-	type 1 glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	1.7e-111
>prophage 2
CP023140	Acinetobacter baumannii strain XH906 chromosome, complete genome	3891370	1508863	1574182	3891370	tail,transposase,integrase,terminase,head,holin,capsid	Acinetobacter_phage(94.64%)	79	1524133:1524150	1574690:1574707
AYC01470.1|1508863_1511092_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AYC01471.1|1511140_1511575_-	thioesterase	NA	NA	NA	NA	NA
AYC01472.1|1511574_1512732_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AYC03648.1|1512963_1514202_+	lactonase	NA	NA	NA	NA	NA
AYC01473.1|1514502_1515006_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AYC01474.1|1515025_1516060_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
AYC01475.1|1516064_1517195_+	hypothetical protein	NA	NA	NA	NA	NA
AYC01476.1|1517194_1518223_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYC01477.1|1518264_1519938_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
AYC01478.1|1520102_1521440_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AYC01479.1|1522050_1522623_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYC01480.1|1522946_1523810_+	hypothetical protein	NA	NA	NA	NA	NA
1524133:1524150	attL	GGATTCTACTTCTTTTAT	NA	NA	NA	NA
AYC01481.1|1524310_1525573_+|integrase	integrase	integrase	A0A0P0IKP2	Acinetobacter_phage	99.3	1.6e-247
AYC01482.1|1525578_1525848_-	DNA-binding protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
AYC01483.1|1525848_1526106_-	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	94.1	4.7e-45
AYC01484.1|1526109_1526394_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	94.7	1.7e-43
AYC01485.1|1526390_1526600_-	hypothetical protein	NA	A0A0P0IVS1	Acinetobacter_phage	98.6	6.3e-32
AYC01486.1|1526602_1526848_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.8	3.3e-40
AYC01487.1|1526849_1527926_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	75.4	6.0e-142
AYC01488.1|1527922_1529044_-	AAA family ATPase	NA	A0A0D4DBX7	Acinetobacter_phage	99.7	1.3e-211
AYC01489.1|1529054_1529378_-	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	79.4	1.5e-43
AYC01490.1|1529370_1529820_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	95.9	5.5e-73
AYC01491.1|1530022_1530889_-	hypothetical protein	NA	NA	NA	NA	NA
AYC01492.1|1530889_1531780_-	hypothetical protein	NA	NA	NA	NA	NA
AYC01493.1|1531852_1532542_-	geranylgeranyl reductase	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	73.1	5.3e-59
AYC01494.1|1532669_1532846_+	hypothetical protein	NA	NA	NA	NA	NA
AYC01495.1|1532842_1533106_+	hypothetical protein	NA	NA	NA	NA	NA
AYC01496.1|1533149_1533440_+	hypothetical protein	NA	NA	NA	NA	NA
AYC01497.1|1533436_1534483_+	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.9	1.7e-109
AYC01498.1|1534479_1535430_+	DUF1376 domain-containing protein	NA	A0A0P0I481	Acinetobacter_phage	63.3	1.6e-98
AYC01499.1|1535422_1536172_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	98.4	1.2e-136
AYC01500.1|1536289_1536712_+	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
AYC03649.1|1536761_1537124_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
AYC01501.1|1537340_1537742_+	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	100.0	1.9e-69
AYC01502.1|1537752_1538505_+	hypothetical protein	NA	A0A0P0J081	Acinetobacter_phage	100.0	8.7e-140
AYC01503.1|1538648_1538867_+	hypothetical protein	NA	NA	NA	NA	NA
AYC01504.1|1539133_1539487_+	hypothetical protein	NA	NA	NA	NA	NA
AYC01505.1|1539686_1539923_+	hypothetical protein	NA	NA	NA	NA	NA
AYC01506.1|1540585_1541047_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	89.4	3.2e-76
AYC01507.1|1541098_1541575_+	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	75.5	6.2e-59
AYC01508.1|1541534_1542176_+	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	87.8	2.2e-112
AYC01509.1|1542234_1542705_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	99.4	6.7e-82
AYC01510.1|1542694_1544122_+|terminase	terminase	terminase	A0A0D4DCE6	Acinetobacter_phage	89.7	2.5e-257
AYC01511.1|1544118_1545564_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	95.6	6.8e-274
AYC01512.1|1545570_1546674_+|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	90.2	2.1e-190
AYC01513.1|1546670_1546895_+	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	93.2	4.7e-33
AYC01514.1|1547134_1547449_+	hypothetical protein	NA	X5I2L0	Pseudomonas_phage	48.5	1.2e-13
AYC01515.1|1547563_1548331_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	99.6	1.7e-119
AYC01516.1|1548358_1549315_+|capsid	phage capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	100.0	2.1e-178
AYC01517.1|1549381_1550047_+	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	90.0	9.8e-103
AYC01518.1|1550051_1550441_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	99.2	2.5e-66
AYC01519.1|1550442_1550811_+	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	95.9	7.2e-63
AYC01520.1|1550848_1551490_+	hypothetical protein	NA	NA	NA	NA	NA
AYC01521.1|1551711_1552116_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	94.0	1.5e-66
AYC01522.1|1552087_1552456_+	hypothetical protein	NA	A0A0P0IDX0	Acinetobacter_phage	94.4	2.3e-53
AYC01523.1|1552457_1552856_+	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	97.7	3.5e-71
AYC01524.1|1552857_1553076_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	91.7	2.0e-28
AYC01525.1|1553134_1553488_+	hypothetical protein	NA	J7I469	Acinetobacter_phage	97.4	8.7e-58
AYC01526.1|1553487_1554474_+|tail	phage tail protein	tail	A0A0D4DCQ4	Acinetobacter_phage	51.8	5.7e-91
AYC01527.1|1554526_1555444_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	97.4	2.5e-165
AYC03650.1|1555515_1556031_+	hypothetical protein	NA	A0A0P0J095	Acinetobacter_phage	97.8	1.2e-71
AYC03651.1|1555958_1556288_+	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	59.0	3.7e-26
AYC01528.1|1556356_1556539_+	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
AYC01529.1|1556631_1557036_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
AYC01530.1|1557134_1557653_+	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	35.9	4.4e-26
AYC01531.1|1557717_1558218_+	hypothetical protein	NA	NA	NA	NA	NA
AYC01532.1|1558650_1563564_+|tail	phage tail protein	tail	J7I4Q7	Acinetobacter_phage	85.7	0.0e+00
AYC01533.1|1563638_1564391_+	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	34.4	1.2e-32
AYC01534.1|1564394_1564787_+	hypothetical protein	NA	NA	NA	NA	NA
AYC01535.1|1564851_1565250_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	99.2	6.3e-73
AYC01536.1|1565249_1565756_+	DUF1833 domain-containing protein	NA	A0A0P0IKN4	Acinetobacter_phage	95.2	5.5e-90
AYC01537.1|1565752_1566115_+	hypothetical protein	NA	J7I4R1	Acinetobacter_phage	99.2	1.2e-65
AYC01538.1|1566107_1569554_+	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	99.9	0.0e+00
AYC01539.1|1569666_1570056_+	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	100.0	1.1e-66
AYC01540.1|1570098_1570644_+	hypothetical protein	NA	A0A0N7IRF5	Acinetobacter_phage	100.0	1.8e-102
AYC01541.1|1570832_1571513_+	hypothetical protein	NA	A0A0P0IKS6	Acinetobacter_phage	100.0	4.6e-116
AYC01542.1|1571523_1572171_+	hypothetical protein	NA	J7I4R4	Acinetobacter_phage	100.0	3.6e-118
AYC01543.1|1572177_1572771_+	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	100.0	5.1e-103
AYC01544.1|1573016_1574182_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	7.1e-165
1574690:1574707	attR	GGATTCTACTTCTTTTAT	NA	NA	NA	NA
>prophage 3
CP023140	Acinetobacter baumannii strain XH906 chromosome, complete genome	3891370	1696620	1743493	3891370	transposase,holin,integrase,tRNA	Moraxella_phage(20.0%)	46	1696571:1696587	1733241:1733257
1696571:1696587	attL	ATAACTCATTGAAATAA	NA	NA	NA	NA
AYC01654.1|1696620_1697710_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYC01655.1|1697712_1698684_+|integrase	integrase	integrase	A0A0R6PGY7	Moraxella_phage	42.4	5.5e-62
AYC01656.1|1699268_1700168_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYC01657.1|1700257_1700695_+	hypothetical protein	NA	NA	NA	NA	NA
AYC01658.1|1700752_1702168_-	cytosine permease	NA	NA	NA	NA	NA
AYC01659.1|1702420_1702885_-	hypothetical protein	NA	NA	NA	NA	NA
AYC03662.1|1702997_1703915_-	EamA family transporter	NA	NA	NA	NA	NA
AYC01660.1|1704021_1704873_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYC01661.1|1704912_1705092_-	hypothetical protein	NA	NA	NA	NA	NA
AYC01662.1|1705668_1706688_-	fimbrial protein	NA	NA	NA	NA	NA
AYC01663.1|1706684_1709114_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AYC01664.1|1709273_1710014_-	pilus assembly protein	NA	NA	NA	NA	NA
AYC01665.1|1710084_1710621_-	ferrous iron transporter B	NA	NA	NA	NA	NA
AYC01666.1|1711066_1711417_+	hypothetical protein	NA	NA	NA	NA	NA
AYC01667.1|1711480_1711693_+	hypothetical protein	NA	NA	NA	NA	NA
AYC01668.1|1711739_1712729_-	biotin synthase	NA	NA	NA	NA	NA
AYC01669.1|1712828_1713917_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AYC01670.1|1713945_1715406_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AYC01671.1|1715417_1715963_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
AYC01672.1|1716192_1716786_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYC01673.1|1716782_1717328_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYC01674.1|1717396_1718221_-	OXA-51 family carbapenem-hydrolyzing class D beta-lactamase OXA-66	NA	NA	NA	NA	NA
AYC01675.1|1718619_1719180_+	FxsA protein	NA	NA	NA	NA	NA
AYC01676.1|1719243_1719429_-	hypothetical protein	NA	NA	NA	NA	NA
AYC01677.1|1719687_1719936_+	hypothetical protein	NA	NA	NA	NA	NA
AYC01678.1|1720059_1721226_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	61.6	1.4e-125
AYC01679.1|1721749_1723738_+	transketolase	NA	NA	NA	NA	NA
AYC01680.1|1723792_1724200_-	peroxiredoxin	NA	NA	NA	NA	NA
AYC01681.1|1724414_1725005_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AYC01682.1|1725050_1725641_-|holin	phosphatidylcholine--retinol O-acyltransferase	holin	NA	NA	NA	NA
AYC01683.1|1725826_1726573_+	hypothetical protein	NA	NA	NA	NA	NA
AYC01684.1|1726608_1726839_-	hypothetical protein	NA	NA	NA	NA	NA
AYC01685.1|1727087_1728173_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AYC01686.1|1728276_1728750_-	hypothetical protein	NA	NA	NA	NA	NA
AYC01687.1|1728855_1732623_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYC01688.1|1732732_1733221_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYC01689.1|1733253_1734744_-	sodium/proline symporter PutP	NA	A0A240F3J2	Aeromonas_phage	23.7	2.4e-08
1733241:1733257	attR	TTATTTCAATGAGTTAT	NA	NA	NA	NA
AYC03664.1|1735151_1735451_-	hypothetical protein	NA	NA	NA	NA	NA
AYC03663.1|1735421_1736126_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYC01690.1|1736294_1736642_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AYC01691.1|1736635_1737475_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AYC01692.1|1737879_1739421_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYC03665.1|1740819_1741593_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
AYC01693.1|1741573_1741855_-	hypothetical protein	NA	NA	NA	NA	NA
AYC01694.1|1742074_1742260_-	hypothetical protein	NA	NA	NA	NA	NA
AYC01695.1|1742308_1743493_+|transposase	IS4 family transposase ISEc29	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
>prophage 4
CP023140	Acinetobacter baumannii strain XH906 chromosome, complete genome	3891370	2657572	2709495	3891370	tail,integrase,terminase,head,capsid	Acinetobacter_phage(90.91%)	66	2657372:2657431	2709993:2710052
2657372:2657431	attL	TGAACTTTAGGGTTCAAGGGTAACGACATGCAGCGGCATCTTCGGAGCATTTATTTTTAA	NA	NA	NA	NA
AYC02502.1|2657572_2658946_+|integrase	integrase	integrase	A0A0R6PGY7	Moraxella_phage	41.5	1.9e-76
AYC02503.1|2659035_2659524_+	hypothetical protein	NA	NA	NA	NA	NA
AYC02504.1|2659834_2661481_-	lipid A phosphoethanolamine transferase	NA	NA	NA	NA	NA
AYC02505.1|2661762_2664081_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AYC03706.1|2664562_2665108_-	hypothetical protein	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
AYC02506.1|2665149_2665539_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
AYC02507.1|2665606_2669053_-	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	99.0	0.0e+00
AYC02508.1|2669045_2669408_-	hypothetical protein	NA	J7I4R1	Acinetobacter_phage	99.2	1.2e-65
AYC02509.1|2669404_2669911_-	DUF1833 domain-containing protein	NA	A0A0P0IKN4	Acinetobacter_phage	95.2	5.5e-90
AYC02510.1|2669910_2670309_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	100.0	1.3e-73
AYC02511.1|2670373_2670766_-	hypothetical protein	NA	NA	NA	NA	NA
AYC02512.1|2670769_2671522_-	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	34.4	1.2e-32
AYC02513.1|2671596_2676579_-|tail	phage tail tape measure protein	tail	A0A220VZA0	Acinetobacter_phage	80.7	0.0e+00
AYC02514.1|2677192_2677537_-	hypothetical protein	NA	NA	NA	NA	NA
AYC02515.1|2677691_2677973_+	peptidase	NA	A0A0M3LQB1	Mannheimia_phage	53.8	1.2e-22
AYC02516.1|2678002_2678287_+	addiction module antidote protein, HigA family	NA	NA	NA	NA	NA
AYC02517.1|2678329_2678650_-	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	62.1	2.0e-24
AYC03707.1|2678577_2679087_-	hypothetical protein	NA	A0A0D4DBX8	Acinetobacter_phage	86.3	6.0e-68
AYC02518.1|2679157_2680075_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	95.4	1.8e-163
AYC02519.1|2680169_2681153_-|tail	phage tail protein	tail	A0A0D4DCQ4	Acinetobacter_phage	49.6	3.8e-87
AYC02520.1|2681152_2681503_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	89.7	6.4e-53
AYC02521.1|2681598_2681817_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	90.3	5.6e-31
AYC02522.1|2681818_2682262_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	81.6	9.2e-65
AYC02523.1|2682218_2682587_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	1.8e-53
AYC02524.1|2682558_2682966_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	71.6	7.7e-50
AYC03708.1|2683188_2683644_-	hypothetical protein	NA	A0A1W6JT96	Pseudomonas_phage	29.4	8.7e-10
AYC02525.1|2683643_2684063_-	hypothetical protein	NA	NA	NA	NA	NA
AYC02526.1|2684119_2684488_-	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	95.1	4.6e-62
AYC02527.1|2684489_2684879_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	96.1	1.5e-63
AYC02528.1|2684883_2685549_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	92.3	1.1e-106
AYC02529.1|2685615_2686572_-|capsid	phage capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	100.0	2.1e-178
AYC02530.1|2686599_2687367_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	99.2	3.0e-119
AYC02531.1|2687481_2687796_-	hypothetical protein	NA	X5I2L0	Pseudomonas_phage	48.5	1.2e-13
AYC02532.1|2688035_2688260_-	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	93.2	4.7e-33
AYC02533.1|2688256_2689360_-|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	90.2	2.1e-190
AYC02534.1|2689366_2690812_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	95.6	6.8e-274
AYC02535.1|2690808_2692236_-|terminase	terminase	terminase	A0A0D4DCE6	Acinetobacter_phage	89.7	2.5e-257
AYC02536.1|2692225_2692696_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	99.4	6.7e-82
AYC02537.1|2692754_2693396_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	87.8	2.2e-112
AYC02538.1|2693355_2693832_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	75.5	6.2e-59
AYC02539.1|2693883_2694345_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	89.4	3.2e-76
AYC02540.1|2695007_2695244_-	hypothetical protein	NA	NA	NA	NA	NA
AYC02541.1|2695443_2695797_-	hypothetical protein	NA	NA	NA	NA	NA
AYC02542.1|2696063_2696282_-	hypothetical protein	NA	NA	NA	NA	NA
AYC02543.1|2696425_2697178_-	hypothetical protein	NA	A0A0P0J081	Acinetobacter_phage	100.0	8.7e-140
AYC02544.1|2697188_2697590_-	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	100.0	1.9e-69
AYC02545.1|2697589_2697814_-	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
AYC03709.1|2697806_2698169_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
AYC02546.1|2698218_2698641_-	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
AYC02547.1|2698758_2699508_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	98.4	1.2e-136
AYC02548.1|2699500_2700451_-	DUF1376 domain-containing protein	NA	A0A0P0I481	Acinetobacter_phage	63.3	1.6e-98
AYC02549.1|2700447_2701494_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.9	1.7e-109
AYC02550.1|2701490_2701781_-	hypothetical protein	NA	NA	NA	NA	NA
AYC02551.1|2701836_2702157_-	transcriptional regulator	NA	A0A0P0HSE9	Acinetobacter_phage	88.7	3.2e-43
AYC02552.1|2702167_2702419_-	hypothetical protein	NA	A0A0N7IRE1	Acinetobacter_phage	94.0	4.1e-38
AYC02553.1|2702527_2703292_+	phage repressor protein	NA	A0A0P0J076	Acinetobacter_phage	98.8	1.6e-144
AYC02554.1|2703306_2703522_+	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	100.0	2.5e-31
AYC02555.1|2703572_2704574_+	hypothetical protein	NA	A0A0P0IRH5	Acinetobacter_phage	100.0	4.2e-182
AYC02556.1|2704576_2705080_+	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	82.6	1.2e-65
AYC02557.1|2705286_2705727_+	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	95.9	3.1e-73
AYC02558.1|2705729_2706053_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	96.3	9.7e-56
AYC02559.1|2706064_2707186_+	AAA family ATPase	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	2.8e-211
AYC02560.1|2707182_2708115_+	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
AYC02561.1|2708116_2708368_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
AYC02562.1|2708368_2708776_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
AYC02563.1|2708772_2709495_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
2709993:2710052	attR	TGAACTTTAGGGTTCAAGGGTAACGACATGCAGCGGCATCTTCGGAGCATTTATTTTTAA	NA	NA	NA	NA
>prophage 5
CP023140	Acinetobacter baumannii strain XH906 chromosome, complete genome	3891370	2918664	2931448	3891370		Acinetobacter_phage(50.0%)	18	NA	NA
AYC02751.1|2918664_2919120_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	68.9	2.2e-53
AYC02752.1|2919575_2920109_-	hypothetical protein	NA	NA	NA	NA	NA
AYC02753.1|2920105_2920870_-	DNA replication protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.8	6.7e-63
AYC02754.1|2920866_2921910_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
AYC02755.1|2921986_2923057_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	59.6	4.6e-110
AYC03719.1|2923128_2923491_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	99.2	3.3e-68
AYC02756.1|2923540_2923963_-	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
AYC02757.1|2924080_2924830_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	98.4	1.2e-136
AYC02758.1|2924822_2925773_-	DUF1376 domain-containing protein	NA	A0A0P0I481	Acinetobacter_phage	64.2	2.9e-100
AYC02759.1|2925769_2926816_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.9	4.5e-110
AYC02760.1|2926812_2928483_-	multidrug DMT transporter	NA	Q5QF27	Pseudomonas_virus	46.2	2.4e-153
AYC02761.1|2928488_2929127_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	46.2	1.1e-47
AYC02762.1|2929123_2929579_-	hypothetical protein	NA	NA	NA	NA	NA
AYC02763.1|2929575_2929761_-	hypothetical protein	NA	NA	NA	NA	NA
AYC02764.1|2929757_2929958_-	hypothetical protein	NA	NA	NA	NA	NA
AYC02765.1|2929991_2930366_-	hypothetical protein	NA	NA	NA	NA	NA
AYC02766.1|2930398_2930632_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYC02767.1|2930758_2931448_+	peptidase S24	NA	A0A0R6PCY1	Moraxella_phage	37.1	5.0e-25
