The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027789	Bacillus licheniformis strain TAB7 chromosome, complete genome	4367367	694965	703354	4367367		Synechococcus_phage(50.0%)	8	NA	NA
AYC50350.1|694965_696261_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.1	5.9e-19
AYC50351.1|696335_697052_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	42.4	2.4e-46
AYC50352.1|697053_697308_+	phosphoribosylformylglycinamidine synthase, purS protein	NA	NA	NA	NA	NA
AYC50353.1|697304_697988_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYC50354.1|697971_700200_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	3.2e-158
AYC50355.1|700175_701606_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	3.4e-52
AYC50356.1|701729_702770_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
AYC50357.1|702766_703354_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.1	1.4e-28
>prophage 2
CP027789	Bacillus licheniformis strain TAB7 chromosome, complete genome	4367367	915533	923258	4367367	transposase,integrase	Bacillus_phage(66.67%)	10	915656:915673	922262:922279
AYC50546.1|915533_916574_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	27.1	5.9e-38
915656:915673	attL	AATGGAAGAAGATCAGGA	NA	NA	NA	NA
AYC50547.1|917003_917225_-|integrase	integrase	integrase	Q5YAA6	Bacillus_phage	55.3	6.9e-05
AYC50548.1|917424_917724_+	hypothetical protein	NA	NA	NA	NA	NA
AYC50549.1|917694_917904_-	hypothetical protein	NA	NA	NA	NA	NA
AYC50550.1|918861_919050_+	hypothetical protein	NA	NA	NA	NA	NA
AYC50551.1|919107_919323_+	hypothetical protein	NA	D6R3Y4	Bacillus_phage	73.5	7.9e-22
AYC50552.1|919316_919667_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	57.1	4.8e-08
AYC50553.1|919725_920064_-	hypothetical protein	NA	NA	NA	NA	NA
AYC50554.1|920089_921814_-|transposase	transposase	transposase	A0A1L2JY53	Aeribacillus_phage	33.6	8.4e-05
AYC50555.1|922139_923258_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	33.0	3.1e-48
922262:922279	attR	AATGGAAGAAGATCAGGA	NA	NA	NA	NA
>prophage 3
CP027789	Bacillus licheniformis strain TAB7 chromosome, complete genome	4367367	1031203	1051001	4367367	bacteriocin,transposase,coat	Bacillus_phage(50.0%)	18	NA	NA
AYC50662.1|1031203_1033138_-|bacteriocin	bacteriocin biosynthesis protein SagD	bacteriocin	NA	NA	NA	NA
AYC50663.1|1033137_1034991_-|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
AYC50664.1|1035115_1035469_-|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
AYC50665.1|1036198_1036699_-	universal stress protein	NA	NA	NA	NA	NA
AYC50666.1|1037219_1038974_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	1.4e-52
AYC50667.1|1038970_1040989_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.3	2.7e-42
AYC50668.1|1041008_1041656_-	hypothetical protein	NA	NA	NA	NA	NA
AYC54044.1|1041652_1041796_-	hypothetical protein	NA	NA	NA	NA	NA
AYC50669.1|1041965_1042169_-	small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	80.3	6.6e-18
AYC50670.1|1042404_1042629_+	hypothetical protein	NA	NA	NA	NA	NA
AYC50671.1|1042674_1043781_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	7.8e-20
AYC50672.1|1043896_1044778_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
AYC50673.1|1044796_1045006_-	hypothetical protein	NA	NA	NA	NA	NA
AYC50674.1|1045158_1046517_-|coat	endospore coat-associated protein	coat	NA	NA	NA	NA
AYC50675.1|1046513_1047599_-|coat	endospore coat-associated protein	coat	NA	NA	NA	NA
AYC50676.1|1047928_1049059_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
AYC50677.1|1049181_1049535_+	YlbF family regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.7e-06
AYC50678.1|1049570_1051001_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.4	2.2e-120
>prophage 4
CP027789	Bacillus licheniformis strain TAB7 chromosome, complete genome	4367367	1234436	1272720	4367367	tRNA,coat	Organic_Lake_phycodnavirus(25.0%)	42	NA	NA
AYC50855.1|1234436_1235429_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AYC50856.1|1236166_1237792_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYC50857.1|1237887_1238823_+	ABC transporter permease	NA	NA	NA	NA	NA
AYC50858.1|1238827_1239745_+	ABC transporter permease	NA	NA	NA	NA	NA
AYC50859.1|1240827_1241751_+	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	28.3	2.0e-05
AYC50860.1|1241981_1242560_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYC50861.1|1242737_1243133_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AYC50862.1|1243355_1244018_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	37.2	1.3e-27
AYC50863.1|1244303_1244942_+	adaptor protein MecA	NA	NA	NA	NA	NA
AYC50864.1|1245001_1246117_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
AYC50865.1|1246219_1246675_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
AYC50866.1|1246697_1248203_+	transporter	NA	NA	NA	NA	NA
AYC50867.1|1248222_1248939_-	two-component system response regulator	NA	NA	NA	NA	NA
AYC50868.1|1248961_1250557_-	sensor histidine kinase	NA	NA	NA	NA	NA
AYC50869.1|1250674_1251823_+	competence protein CoiA	NA	NA	NA	NA	NA
AYC50870.1|1251861_1253865_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AYC54046.1|1253921_1254089_-	membrane protein (permease)	NA	NA	NA	NA	NA
AYC50871.1|1254500_1255403_-	DsbA family protein	NA	NA	NA	NA	NA
AYC50872.1|1255399_1255798_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
AYC50873.1|1256079_1256733_-	lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	72.4	1.0e-40
AYC50874.1|1256745_1257318_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AYC50875.1|1257448_1257814_+	hypothetical protein	NA	NA	NA	NA	NA
AYC50876.1|1257845_1258481_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AYC50877.1|1258498_1259299_+	NAD kinase	NA	NA	NA	NA	NA
AYC50878.1|1259310_1260201_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AYC50879.1|1260216_1260957_-	bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical]	NA	A0A7D9	Microcystis_virus	28.8	4.5e-16
AYC50880.1|1260953_1261142_-	hypothetical protein	NA	NA	NA	NA	NA
AYC50881.1|1261229_1263074_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AYC50882.1|1263325_1264027_+	thiaminase II	NA	NA	NA	NA	NA
AYC50883.1|1264001_1264613_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AYC50884.1|1264596_1265706_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
AYC50885.1|1265702_1265906_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AYC50886.1|1265912_1266680_+	thiazole synthase	NA	NA	NA	NA	NA
AYC50887.1|1266676_1267687_+	thiamine biosynthesis protein MoeB	NA	NA	NA	NA	NA
AYC50888.1|1267711_1268530_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AYC50889.1|1268686_1269463_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AYC50890.1|1269566_1270046_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
AYC50891.1|1270083_1270533_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYC50892.1|1270683_1271172_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYC50893.1|1271303_1271816_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYC50894.1|1271886_1272285_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYC50895.1|1272333_1272720_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 5
CP027789	Bacillus licheniformis strain TAB7 chromosome, complete genome	4367367	1303102	1377742	4367367	transposase,terminase,protease,tail,capsid,portal,holin	Bacillus_phage(23.53%)	76	NA	NA
AYC50932.1|1303102_1304527_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.6	5.1e-16
AYC50933.1|1304542_1305121_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYC50934.1|1305133_1305469_-	hypothetical protein	NA	NA	NA	NA	NA
AYC50935.1|1305497_1305911_-	hypothetical protein	NA	NA	NA	NA	NA
AYC50936.1|1306285_1306768_-	TIGR01741 family protein	NA	NA	NA	NA	NA
AYC50937.1|1306771_1308820_-	hypothetical protein	NA	O64023	Bacillus_phage	24.5	1.9e-27
AYC50938.1|1309040_1309688_+	hypothetical protein	NA	A0A0Y0AJU6	Bacillus_phage	47.5	4.1e-45
AYC50939.1|1309701_1310358_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	4.0e-40
AYC50940.1|1310546_1310900_-	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.2	6.1e-19
AYC50941.1|1311072_1311333_+	XRE family transcriptional regulator	NA	S5MA07	Brevibacillus_phage	41.2	7.9e-08
AYC50942.1|1311322_1311619_+	hypothetical protein	NA	NA	NA	NA	NA
AYC50943.1|1311619_1312450_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	31.0	1.3e-27
AYC50944.1|1312349_1313150_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	47.7	2.3e-58
AYC54047.1|1313149_1313320_+	phage protein	NA	NA	NA	NA	NA
AYC50945.1|1313420_1313762_+	hypothetical protein	NA	NA	NA	NA	NA
AYC50946.1|1313758_1313962_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	54.7	1.9e-12
AYC50947.1|1314082_1314586_+	Fis family transcriptional regulator	NA	A0A0K2CNQ1	Brevibacillus_phage	38.7	1.4e-21
AYC50948.1|1314728_1315529_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.4	5.7e-65
AYC50949.1|1315525_1316824_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	60.2	7.2e-150
AYC50950.1|1316827_1318342_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.5	3.4e-143
AYC50951.1|1318349_1319198_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	62.8	2.7e-57
AYC50952.1|1319215_1320151_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	64.1	8.1e-103
AYC50953.1|1320238_1320619_+	DUF3199 domain-containing protein	NA	NA	NA	NA	NA
AYC50954.1|1320615_1320972_+	DUF3599 domain-containing protein	NA	NA	NA	NA	NA
AYC50955.1|1320968_1321457_+|portal	phage portal protein	portal	A0A249XXA4	Clostridium_phage	44.6	1.9e-34
AYC50956.1|1321469_1321910_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYC50957.1|1321910_1322135_+	hypothetical protein	NA	NA	NA	NA	NA
AYC50958.1|1322134_1323481_+|tail	phage tail sheath protein	tail	S5MNC1	Brevibacillus_phage	40.2	2.6e-78
AYC50959.1|1323482_1323926_+|portal	phage portal protein	portal	A0A0K2CNG3	Brevibacillus_phage	44.7	2.1e-24
AYC50960.1|1324108_1324558_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.7	4.1e-12
AYC50961.1|1324599_1324737_+	hypothetical protein	NA	NA	NA	NA	NA
AYC50962.1|1324740_1328523_+	lytic transglycosylase	NA	A0A1L2JY60	Aeribacillus_phage	45.3	1.7e-42
AYC50963.1|1328515_1329172_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.6	4.0e-24
AYC50964.1|1329228_1330209_+|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.3	9.2e-41
AYC50965.1|1330205_1330514_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.3	1.0e-06
AYC50966.1|1330532_1330958_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	39.0	5.4e-14
AYC50967.1|1330950_1331994_+|portal	phage portal protein	portal	S6AVU3	Thermus_phage	44.3	9.7e-73
AYC50968.1|1331980_1332901_+	DUF2313 domain-containing protein	NA	A0A0A7RTT8	Clostridium_phage	28.3	5.0e-12
AYC50969.1|1332914_1333301_+	hypothetical protein	NA	NA	NA	NA	NA
AYC50970.1|1333316_1334522_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	48.3	9.3e-27
AYC50971.1|1334559_1335591_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	48.2	1.0e-18
AYC50972.1|1335693_1335963_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.0	1.6e-24
AYC50973.1|1335977_1336241_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	5.3e-28
AYC50974.1|1336291_1337356_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	50.8	2.0e-44
AYC50975.1|1337468_1338899_+|transposase	IS5/IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.7	5.9e-121
AYC50976.1|1339001_1339679_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYC50977.1|1339701_1340718_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AYC50978.1|1340738_1341836_+	Mannonate dehydratase 1	NA	NA	NA	NA	NA
AYC50979.1|1341811_1342660_+	D-mannonate oxidoreductase	NA	M1NMS3	Moumouvirus	33.3	5.6e-10
AYC50980.1|1342686_1343700_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AYC50981.1|1343752_1345024_+	MFS transporter	NA	NA	NA	NA	NA
AYC50982.1|1345313_1345487_-	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
AYC50983.1|1345486_1346233_-	type II toxin-antitoxin system SpoIISA family toxin	NA	NA	NA	NA	NA
AYC50984.1|1346343_1347342_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
AYC50985.1|1347354_1347972_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
AYC50986.1|1348303_1350061_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AYC50987.1|1350189_1350834_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
AYC50988.1|1352837_1355120_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYC50989.1|1355133_1355850_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
AYC50990.1|1355788_1356529_+	DUF1961 domain-containing protein	NA	NA	NA	NA	NA
AYC50991.1|1356543_1357155_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
AYC50992.1|1357337_1359206_+	rhamnogalacturonan lyase	NA	NA	NA	NA	NA
AYC50993.1|1359226_1359697_+	hypothetical protein	NA	NA	NA	NA	NA
AYC50994.1|1359590_1360856_+	carbohydrate esterase	NA	NA	NA	NA	NA
AYC50995.1|1360924_1362811_+	rhamnogalacturonan lyase	NA	NA	NA	NA	NA
AYC50996.1|1362955_1363948_+	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
AYC50997.1|1363964_1364609_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
AYC50998.1|1364605_1366603_+	beta-galactosidase	NA	NA	NA	NA	NA
AYC50999.1|1366708_1369369_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51000.1|1369463_1370978_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51001.1|1371019_1371973_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AYC51002.1|1371991_1372876_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AYC51003.1|1372913_1374242_-	amino acid permease	NA	NA	NA	NA	NA
AYC51004.1|1374561_1375515_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
AYC51005.1|1375907_1376270_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51006.1|1376443_1377742_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.7	7.7e-19
>prophage 6
CP027789	Bacillus licheniformis strain TAB7 chromosome, complete genome	4367367	1406953	1489983	4367367	integrase,terminase,transposase,protease,tail,capsid,portal,holin,head	Bacillus_phage(30.43%)	107	1404702:1404717	1460620:1460635
1404702:1404717	attL	TTTTTCAAGCGCTTCA	NA	NA	NA	NA
AYC51038.1|1406953_1407907_-|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	51.9	1.9e-75
AYC54048.1|1408199_1408355_+	transcriptional regulator	NA	NA	NA	NA	NA
AYC51039.1|1408907_1410263_+	magnesium transporter	NA	NA	NA	NA	NA
AYC51040.1|1410355_1410763_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51041.1|1410933_1412073_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	39.2	8.7e-67
AYC51042.1|1412104_1412584_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	41.2	2.0e-28
AYC51043.1|1412696_1413305_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	49.6	7.0e-31
AYC51044.1|1413399_1413666_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51045.1|1413919_1414168_-	XRE family transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	47.6	9.8e-08
AYC51046.1|1414212_1414575_-	XRE family transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	43.0	4.8e-11
AYC51047.1|1414728_1414953_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYC51048.1|1414965_1415292_+	hypothetical protein	NA	S6C476	Thermus_phage	54.4	2.8e-18
AYC51049.1|1415310_1415742_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51050.1|1415754_1416489_+	hypothetical protein	NA	A0A2I7SCU0	Paenibacillus_phage	39.5	7.7e-32
AYC51051.1|1416561_1417080_+	XRE family transcriptional regulator	NA	A0A290FZK9	Caldibacillus_phage	46.4	9.8e-34
AYC51052.1|1417076_1417355_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	50.6	6.7e-21
AYC51053.1|1417476_1417665_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51054.1|1417897_1418836_+	hypothetical protein	NA	A6XMH8	Bacillus_virus	49.2	6.5e-84
AYC51055.1|1418853_1419675_+	recombinase RecT	NA	Q0H279	Geobacillus_phage	57.8	7.6e-81
AYC51056.1|1419810_1420512_+	DnaD domain protein	NA	A0A1L2JY26	Aeribacillus_phage	36.8	2.8e-07
AYC51057.1|1420381_1421362_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	50.6	2.6e-59
AYC51058.1|1421456_1421660_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	57.6	1.3e-13
AYC54049.1|1421673_1421838_+	phage protein	NA	NA	NA	NA	NA
AYC51059.1|1421837_1422056_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51060.1|1422129_1422339_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
AYC54050.1|1422335_1422512_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51061.1|1422686_1423142_+	hypothetical protein	NA	A0A0A7RWK2	Clostridium_phage	34.2	1.1e-09
AYC51062.1|1423141_1423330_+	hypothetical protein	NA	A0A0A0RMX5	Bacillus_phage	64.4	1.5e-13
AYC51063.1|1423502_1423925_+	RusA family crossover junction endodeoxyribonuclease	NA	M4ZS69	Bacillus_phage	55.7	7.2e-35
AYC51064.1|1423903_1424110_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51065.1|1424167_1424665_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51066.1|1424654_1425134_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	58.1	2.0e-41
AYC54051.1|1425146_1425323_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51067.1|1425467_1425833_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51068.1|1425835_1426354_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51069.1|1426289_1426517_+	hypothetical protein	NA	A0A2H4JDM6	uncultured_Caudovirales_phage	64.2	6.9e-16
AYC51070.1|1426682_1427000_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51071.1|1427032_1427470_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	75.0	1.3e-55
AYC51072.1|1427505_1427922_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51073.1|1428137_1428593_+	hypothetical protein	NA	A0A290FZR5	Caldibacillus_phage	60.4	5.6e-41
AYC51074.1|1429341_1429572_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51075.1|1429807_1430515_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	59.1	1.8e-62
AYC51076.1|1430511_1431789_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	68.8	5.8e-152
AYC51077.1|1431785_1433201_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	59.9	1.1e-148
AYC51078.1|1433184_1434102_+|head	phage head morphogenesis protein	head	A0A1Q1PVS0	Bacillus_phage	53.7	1.9e-88
AYC54052.1|1434249_1434396_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51079.1|1434388_1434718_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51080.1|1434719_1435364_+	hypothetical protein	NA	U5PTS2	Bacillus_phage	50.6	2.2e-19
AYC51081.1|1435603_1436185_+	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	52.3	1.6e-48
AYC51082.1|1436200_1437121_+|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	64.6	7.4e-109
AYC51083.1|1437124_1437463_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51084.1|1437464_1437734_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51085.1|1437747_1438056_+	hypothetical protein	NA	A0A1W6JQJ1	Staphylococcus_phage	44.0	2.5e-13
AYC51086.1|1438055_1438397_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AYC51087.1|1438396_1438801_+	hypothetical protein	NA	O48447	Bacillus_phage	62.5	9.3e-40
AYC51088.1|1438797_1439211_+	DUF3168 domain-containing protein	NA	A0A0C5AEH4	Paenibacillus_phage	38.3	2.7e-10
AYC51089.1|1439223_1439769_+|tail	phage major tail protein, TP901-1 family	tail	Q597U9	Lactobacillus_virus	31.4	1.0e-17
AYC51090.1|1439659_1440031_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	64.4	6.2e-22
AYC51091.1|1440098_1440596_+	hypothetical protein	NA	O48453	Bacillus_phage	30.3	9.8e-07
AYC51092.1|1440613_1440940_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51093.1|1440959_1444031_+	hypothetical protein	NA	Q4ZC60	Staphylococcus_virus	28.9	4.6e-46
AYC51094.1|1444027_1444831_+|tail	phage tail family protein	tail	NA	NA	NA	NA
AYC51095.1|1444843_1448353_+	hypothetical protein	NA	Q5YA57	Bacillus_phage	45.6	2.2e-124
AYC51096.1|1448366_1448666_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51097.1|1448728_1448998_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	58.4	3.8e-21
AYC51098.1|1449013_1449277_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	75.9	3.6e-32
AYC51099.1|1449334_1450219_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A142F1B8	Bacillus_phage	49.0	4.9e-57
AYC51100.1|1450252_1450588_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51101.1|1450613_1452128_-|transposase	transposase	transposase	NA	NA	NA	NA
AYC51102.1|1452478_1453117_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51103.1|1453109_1453592_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51104.1|1453912_1454245_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AYC51105.1|1454437_1454593_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51106.1|1454699_1454879_+	stress protein	NA	NA	NA	NA	NA
AYC51107.1|1455052_1455514_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYC51108.1|1455519_1457370_-	DNA ligase D	NA	NA	NA	NA	NA
AYC51109.1|1457373_1458246_-	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	34.4	1.3e-38
AYC51110.1|1458399_1460052_-	diguanylate cyclase	NA	NA	NA	NA	NA
AYC51111.1|1460341_1460983_+	DedA family protein	NA	NA	NA	NA	NA
1460620:1460635	attR	TGAAGCGCTTGAAAAA	NA	NA	NA	NA
AYC51112.1|1461254_1462022_+	hypothetical protein	NA	A0A068EP98	Bacillus_phage	43.4	5.2e-31
AYC51113.1|1462314_1463070_+	RNA polymerase sigma-I factor	NA	NA	NA	NA	NA
AYC51114.1|1463066_1464158_+	anti-sigma factor	NA	NA	NA	NA	NA
AYC51115.1|1464170_1464368_-	small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	62.1	2.3e-12
AYC51116.1|1464498_1465218_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
AYC51117.1|1465359_1466253_+|protease	protease HtpX	protease	NA	NA	NA	NA
AYC51118.1|1466399_1467749_+	Ktr system potassium uptake protein D	NA	NA	NA	NA	NA
AYC51119.1|1467861_1469862_+	penicillin-binding transpeptidase domain-containing protein	NA	NA	NA	NA	NA
AYC51120.1|1469909_1470125_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51121.1|1470121_1470310_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51122.1|1470362_1471388_-	acyltransferase	NA	NA	NA	NA	NA
AYC51123.1|1471697_1473908_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AYC51124.1|1473915_1474413_+	cysteine methyltransferase	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	51.4	1.8e-21
AYC51125.1|1474624_1475686_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
AYC51126.1|1475691_1476888_-	methylthioribose kinase	NA	NA	NA	NA	NA
AYC51127.1|1477199_1477979_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
AYC51128.1|1478074_1479265_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AYC51129.1|1479471_1480716_+	2,3-diketo-5-methylthiopentyl-1-phosphate enolase	NA	NA	NA	NA	NA
AYC51130.1|1480712_1481996_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
AYC51131.1|1482016_1482556_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AYC51132.1|1482580_1483045_-	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	52.6	9.1e-31
AYC51133.1|1483031_1483361_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
AYC51134.1|1483579_1483822_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
AYC51135.1|1483883_1485395_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AYC51136.1|1485632_1486088_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYC51137.1|1486112_1486892_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
AYC51138.1|1486884_1487688_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
AYC51139.1|1487886_1489983_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.6	1.2e-125
>prophage 7
CP027789	Bacillus licheniformis strain TAB7 chromosome, complete genome	4367367	1494461	1535953	4367367	transposase,integrase,tail,capsid,portal,plate,holin	Bacillus_phage(29.63%)	61	1493647:1493706	1536025:1536281
1493647:1493706	attL	TCACGAAGACTGCATGAACATCATCATGAACGATTTAATTGAGCTGATGGACCCGCGCTA	NA	NA	NA	NA
AYC51145.1|1494461_1495520_+|integrase	integrase	integrase	A0A142F1N9	Bacillus_phage	25.8	9.1e-26
AYC51146.1|1495528_1496245_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AYC51147.1|1496289_1496505_+|integrase	integrase	integrase	NA	NA	NA	NA
AYC51148.1|1496653_1496986_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51149.1|1496997_1498437_-	lipase	NA	NA	NA	NA	NA
AYC51150.1|1498494_1498809_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AYC51151.1|1498840_1499014_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	89.1	4.0e-24
AYC54053.1|1499060_1499237_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51152.1|1499338_1499521_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51153.1|1499593_1499926_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51154.1|1499918_1500119_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51155.1|1500589_1500808_+	XRE family transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	65.7	5.6e-07
AYC51156.1|1501042_1501405_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51157.1|1501416_1502940_-|transposase	transposase	transposase	NA	NA	NA	NA
AYC51158.1|1503249_1503435_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYC51159.1|1503620_1503971_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51160.1|1503967_1504306_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51161.1|1504302_1504500_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51162.1|1504496_1504844_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51163.1|1504830_1505226_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51164.1|1506587_1506764_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYC51165.1|1506866_1507238_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	44.1	1.5e-15
AYC51166.1|1507305_1507641_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51167.1|1507671_1507944_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51168.1|1507982_1508171_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51169.1|1508208_1508655_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51170.1|1509699_1509894_+	hypothetical protein	NA	NA	NA	NA	NA
AYC54054.1|1509890_1510037_+	hypothetical protein	NA	A0A2H4J4P7	uncultured_Caudovirales_phage	68.1	3.1e-09
AYC51171.1|1510060_1510333_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51172.1|1510449_1510737_+	hypothetical protein	NA	A6MAI4	Lactococcus_virus	59.8	2.8e-22
AYC51173.1|1510872_1511097_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51174.1|1511093_1511639_-|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	44.1	8.5e-28
AYC51175.1|1511744_1513499_+	hypothetical protein	NA	A0A2H4J484	uncultured_Caudovirales_phage	72.6	4.0e-252
AYC51176.1|1513514_1513943_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	52.2	6.4e-31
AYC51177.1|1513945_1515553_+|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	58.0	8.9e-166
AYC51178.1|1515552_1516377_+|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	54.2	1.8e-77
AYC51179.1|1516373_1516928_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51180.1|1517042_1517774_+	OmpH family outer membrane protein	NA	A0A2H4IZP8	uncultured_Caudovirales_phage	59.5	2.1e-26
AYC51181.1|1517827_1518919_+	hypothetical protein	NA	A0A2H4J2M3	uncultured_Caudovirales_phage	66.6	1.3e-128
AYC51182.1|1518970_1519186_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51183.1|1519200_1519587_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	48.8	1.9e-26
AYC51184.1|1519587_1519926_+	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	43.8	1.9e-17
AYC51185.1|1519922_1520333_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	54.4	1.1e-30
AYC51186.1|1520336_1520711_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51187.1|1520749_1521295_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	63.0	6.2e-55
AYC51188.1|1521352_1521721_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51189.1|1521819_1522056_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51190.1|1522504_1523110_+	hypothetical protein	NA	A0A1X9SG40	Bacillus_phage	52.2	7.7e-22
AYC51191.1|1523254_1525708_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	40.7	2.1e-73
AYC51192.1|1525707_1526568_+|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	44.6	1.4e-61
AYC51193.1|1526578_1527949_+	endopeptidase	NA	A6M966	Geobacillus_virus	35.5	6.6e-45
AYC51194.1|1529556_1530780_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	61.1	6.0e-130
AYC51195.1|1530795_1531089_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.0e-40
AYC51196.1|1531089_1531284_+	XkdX family protein	NA	NA	NA	NA	NA
AYC51197.1|1531287_1531551_+|holin	holin	holin	NA	NA	NA	NA
AYC51198.1|1531617_1532610_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	72.4	8.1e-69
AYC51199.1|1532630_1532861_+|holin	phage holin	holin	A0A1D6Z272	Staphylococcus_phage	59.2	1.1e-18
AYC51200.1|1533103_1533373_+	hypothetical protein	NA	U5PSW1	Bacillus_phage	72.5	4.3e-09
AYC51201.1|1533362_1533941_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51202.1|1534232_1534481_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51203.1|1534807_1535953_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	33.6	3.6e-44
1536025:1536281	attR	TCACGAAGACTGCATGAACATCATCATGAACGATTTAATTGAGCTGATGGACCCGCGCTACATCGAAGTCTGGGGCAAATTCACGCCGAGGGGCGGAATCTCGATCGACCCGTACACCAACTACGGCAAGCCCGGCACAAAGTATGAAAAAATGGCCGAGTATCGGATGATGAACCATGATCTGTATCCGGAGACGATTGATAATCGGTGATGATGCGGGCAGATGAAGCGAAGGTTTGTGATCGATGTGTGACCGA	NA	NA	NA	NA
>prophage 8
CP027789	Bacillus licheniformis strain TAB7 chromosome, complete genome	4367367	2241949	2276249	4367367		Bacillus_phage(94.44%)	50	NA	NA
AYC51909.1|2241949_2242540_-	hypothetical protein	NA	A0A1P8CX67	Bacillus_phage	81.2	6.7e-87
AYC51910.1|2242565_2242763_-	hypothetical protein	NA	O64193	Bacillus_phage	50.9	1.9e-06
AYC51911.1|2242740_2243190_-	DUF1768 domain-containing protein	NA	A0A172JI41	Bacillus_phage	66.2	1.8e-47
AYC51912.1|2243229_2243457_-	hypothetical protein	NA	A0A0E3D9Q5	Bacillus_phage	46.2	5.6e-10
AYC51913.1|2243484_2243841_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51914.1|2243900_2244074_-	hypothetical protein	NA	O64190	Bacillus_phage	89.5	2.7e-20
AYC51915.1|2244314_2244659_-	hypothetical protein	NA	O64111	Bacillus_phage	60.4	1.4e-31
AYC51916.1|2244756_2244960_+	spore protein	NA	Q77YX0	Bacillus_phage	83.3	2.6e-22
AYC51917.1|2245109_2246183_-	hypothetical protein	NA	R4JEY6	Bacillus_phage	56.9	2.1e-99
AYC51918.1|2246175_2246553_-	hypothetical protein	NA	R4JDR8	Bacillus_phage	96.0	2.0e-68
AYC51919.1|2246569_2246953_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51920.1|2246936_2247323_-	hypothetical protein	NA	R4JGJ3	Bacillus_phage	35.5	4.3e-10
AYC54061.1|2247323_2247497_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51921.1|2247863_2248103_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51922.1|2248092_2248455_-	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	45.8	2.9e-16
AYC51923.1|2248608_2249460_-	thymidylate synthase	NA	U5J9N5	Bacillus_phage	40.8	1.1e-50
AYC51924.1|2249461_2249749_-	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	42.2	2.9e-11
AYC51925.1|2249745_2249928_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51926.1|2250312_2250747_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1P8CX51	Bacillus_phage	87.3	4.2e-70
AYC51927.1|2250790_2251225_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51928.1|2251214_2251544_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51929.1|2251830_2252811_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	80.9	4.2e-150
AYC51930.1|2252825_2253062_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51931.1|2253049_2255587_-	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	83.2	0.0e+00
AYC51932.1|2255830_2256559_-	ribonucleotide-diphosphate reductase subunit alpha	NA	S6B1K0	Bacillus_phage	86.1	6.5e-116
AYC51933.1|2256515_2256917_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S6ANL8	Bacillus_phage	63.2	6.6e-38
AYC51934.1|2256916_2257264_-	antitoxin endoai	NA	O64171	Bacillus_phage	40.0	1.5e-14
AYC51935.1|2257316_2257577_-	hypothetical protein	NA	NA	NA	NA	NA
AYC54062.1|2257816_2257990_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51936.1|2258383_2258698_+	hypothetical protein	NA	S6B1N1	Thermus_phage	43.6	7.3e-16
AYC51937.1|2258932_2259304_-	hypothetical protein	NA	A0A1I9S6H8	Bacillus_phage	33.3	9.6e-07
AYC51938.1|2259310_2259802_-	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	38.0	1.2e-17
AYC54063.1|2261019_2261229_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51939.1|2261289_2261490_-	hypothetical protein	NA	O64158	Bacillus_phage	40.7	2.8e-05
AYC54064.1|2261486_2261666_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51940.1|2261795_2262140_+	hypothetical protein	NA	NA	NA	NA	NA
AYC51941.1|2262160_2262748_-	hypothetical protein	NA	A7KV03	Bacillus_phage	38.1	6.3e-29
AYC54065.1|2262741_2262903_-	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	51.0	1.9e-07
AYC51942.1|2263071_2263287_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51943.1|2263291_2264008_-	hypothetical protein	NA	O64147	Bacillus_phage	43.5	6.1e-42
AYC51944.1|2264018_2265455_-	hypothetical protein	NA	A0A1P8CX14	Bacillus_phage	76.3	4.1e-215
AYC51945.1|2265441_2266212_-	hypothetical protein	NA	R9QM99	Lactococcus_phage	32.6	8.1e-16
AYC51946.1|2266395_2268960_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	87.9	0.0e+00
AYC51947.1|2268975_2270697_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	64.8	4.1e-217
AYC51948.1|2270700_2271834_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	69.7	1.3e-158
AYC51949.1|2271850_2273365_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	81.0	6.9e-237
AYC51950.1|2273379_2273850_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	69.2	2.0e-57
AYC51951.1|2273896_2274868_-	hypothetical protein	NA	A0A1P8CX29	Bacillus_phage	85.7	1.3e-156
AYC51952.1|2274921_2275833_-	hypothetical protein	NA	A0A1P8CX09	Bacillus_phage	66.3	8.7e-110
AYC51953.1|2275916_2276249_-	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	48.6	2.0e-16
>prophage 9
CP027789	Bacillus licheniformis strain TAB7 chromosome, complete genome	4367367	2279412	2292899	4367367	integrase	Bacillus_phage(100.0%)	25	2275856:2275871	2300224:2300239
2275856:2275871	attL	TTTTAATTAGTGTATA	NA	NA	NA	NA
AYC54066.1|2279412_2279580_-	hypothetical protein	NA	A0A0A0RMX5	Bacillus_phage	63.0	3.7e-11
AYC51957.1|2279579_2279969_-	hypothetical protein	NA	R4JMS5	Bacillus_phage	60.6	8.7e-35
AYC51958.1|2280086_2280449_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51959.1|2280445_2280670_-	hypothetical protein	NA	O64132	Bacillus_phage	63.4	3.1e-21
AYC51960.1|2280763_2281576_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	75.8	7.7e-118
AYC51961.1|2281585_2281834_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51962.1|2281881_2282553_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51963.1|2282690_2283500_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	54.1	2.0e-65
AYC51964.1|2283520_2283748_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51965.1|2283819_2284005_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51966.1|2283991_2284216_-	hypothetical protein	NA	A0A142F1P8	Bacillus_phage	69.4	2.5e-18
AYC51967.1|2284281_2284455_-	DNA strand exchange inhibitor protein	NA	A0A1B1P7C0	Bacillus_phage	71.9	1.3e-14
AYC51968.1|2284481_2284826_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51969.1|2284867_2285065_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51970.1|2285595_2285778_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51971.1|2285797_2286466_-	DUF1273 domain-containing protein	NA	A0A1P8CWY2	Bacillus_phage	74.4	1.2e-95
AYC51972.1|2286491_2286713_-	hypothetical protein	NA	A0A217ER97	Bacillus_phage	50.8	2.0e-12
AYC51973.1|2286761_2287916_-	hypothetical protein	NA	A0A223LDI7	Bacillus_phage	39.2	1.0e-67
AYC51974.1|2287996_2288221_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51975.1|2288192_2288375_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51976.1|2288522_2288717_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51977.1|2288729_2288984_-	hypothetical protein	NA	NA	NA	NA	NA
AYC51978.1|2289355_2290357_-|integrase	site-specific integrase	integrase	O64101	Bacillus_phage	39.8	4.1e-60
AYC51979.1|2290360_2291737_-	hypothetical protein	NA	O64100	Bacillus_phage	42.4	3.5e-94
AYC51980.1|2291804_2292899_-|integrase	integrase	integrase	O64099	Bacillus_phage	43.0	4.6e-73
2300224:2300239	attR	TTTTAATTAGTGTATA	NA	NA	NA	NA
>prophage 10
CP027789	Bacillus licheniformis strain TAB7 chromosome, complete genome	4367367	2318187	2376681	4367367	tail,transposase,holin,integrase	Bacillus_phage(82.05%)	59	2331628:2331645	2356621:2356638
AYC52011.1|2318187_2320962_+	hypothetical protein	NA	H7BV05	unidentified_phage	30.4	2.5e-107
AYC52012.1|2320958_2321759_+	hypothetical protein	NA	NA	NA	NA	NA
AYC52013.1|2321864_2322140_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	74.4	3.9e-29
AYC54067.1|2322160_2322310_+	hypothetical protein	NA	NA	NA	NA	NA
AYC52014.1|2322935_2323451_+	hypothetical protein	NA	A0A0A0PL66	Bacillus_phage	49.1	2.0e-34
AYC52015.1|2323786_2325217_-|transposase	IS5/IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.7	5.9e-121
AYC52016.1|2325510_2325702_+	hypothetical protein	NA	A0A1P8CWT3	Bacillus_phage	87.3	3.4e-24
AYC52017.1|2325714_2326908_+	hypothetical protein	NA	A0A0N9SK37	Staphylococcus_phage	38.2	1.4e-67
AYC52018.1|2327265_2327895_-	hypothetical protein	NA	NA	NA	NA	NA
AYC52019.1|2328177_2329110_+	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	76.4	1.8e-139
AYC52020.1|2329093_2330863_+	hypothetical protein	NA	O64069	Bacillus_phage	91.9	0.0e+00
AYC52021.1|2330880_2332401_+	hypothetical protein	NA	O64068	Bacillus_phage	83.0	8.7e-248
2331628:2331645	attL	CATAAAAAGAAACTCAAA	NA	NA	NA	NA
AYC52022.1|2332435_2333875_+	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	65.5	9.3e-175
AYC52023.1|2333898_2334501_+	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	83.0	7.6e-78
AYC52024.1|2334541_2335558_+	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	84.9	1.4e-161
AYC52025.1|2335592_2336063_+	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	80.8	1.3e-69
AYC52026.1|2336074_2336473_+	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	62.1	1.7e-41
AYC52027.1|2336469_2336700_+	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	52.8	6.3e-09
AYC52028.1|2336686_2337346_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	65.7	3.7e-78
AYC52029.1|2337342_2337873_+	hypothetical protein	NA	O64060	Bacillus_phage	63.6	6.9e-59
AYC52030.1|2337869_2338580_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	38.6	9.0e-38
AYC52031.1|2338611_2339445_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	42.5	4.2e-26
AYC52032.1|2339484_2339877_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	46.8	2.1e-12
AYC52033.1|2339985_2340351_+	lysozyme	NA	NA	NA	NA	NA
AYC52034.1|2340353_2341982_+	DNA-packaging protein	NA	A0A1P8CWR7	Bacillus_phage	31.7	5.1e-28
AYC52035.1|2341994_2342321_+	hypothetical protein	NA	NA	NA	NA	NA
AYC52036.1|2342317_2342509_+	XkdX family protein	NA	NA	NA	NA	NA
AYC52037.1|2342547_2343033_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	34.4	1.7e-16
AYC52038.1|2343032_2343452_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	56.3	7.9e-42
AYC52039.1|2343466_2344468_+|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	85.9	1.3e-170
AYC52040.1|2344575_2345397_+	NYN domain-containing protein	NA	NA	NA	NA	NA
AYC52041.1|2345780_2347103_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	50.6	1.4e-121
AYC52042.1|2347095_2347308_-	hypothetical protein	NA	NA	NA	NA	NA
AYC52043.1|2347339_2348050_-	hypothetical protein	NA	NA	NA	NA	NA
AYC52044.1|2348138_2348732_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYC54068.1|2349292_2349478_+	hypothetical protein	NA	NA	NA	NA	NA
AYC52045.1|2349578_2349881_-	hypothetical protein	NA	NA	NA	NA	NA
AYC52046.1|2350437_2350941_+	hypothetical protein	NA	NA	NA	NA	NA
AYC52047.1|2351017_2351734_+	hypothetical protein	NA	D2XR29	Bacillus_phage	33.6	5.5e-27
AYC52048.1|2351979_2352438_+	hypothetical protein	NA	NA	NA	NA	NA
AYC52049.1|2352720_2353641_-	hypothetical protein	NA	NA	NA	NA	NA
AYC52050.1|2353897_2354593_+	immunity protein	NA	Q37974	Bacillus_phage	46.5	3.2e-48
AYC52051.1|2354602_2354836_-	XRE family transcriptional regulator	NA	A0A2I7SC34	Paenibacillus_phage	51.6	1.7e-09
AYC52052.1|2354997_2355246_+	hypothetical protein	NA	NA	NA	NA	NA
AYC52053.1|2355223_2357521_+	hypothetical protein	NA	A0A0H3UZB6	Geobacillus_virus	24.1	1.2e-27
2356621:2356638	attR	CATAAAAAGAAACTCAAA	NA	NA	NA	NA
AYC52054.1|2357504_2357756_+	hypothetical protein	NA	NA	NA	NA	NA
AYC52055.1|2359880_2360162_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	52.1	1.8e-13
AYC52056.1|2360417_2365289_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	59.2	0.0e+00
AYC52057.1|2365346_2366108_+|tail	phage tail protein	tail	A0A1P8CWP8	Bacillus_phage	59.4	3.2e-81
AYC52058.1|2366111_2368751_+	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	51.4	4.0e-248
AYC52059.1|2368766_2369564_+	hypothetical protein	NA	O64043	Bacillus_phage	58.6	8.8e-74
AYC52060.1|2369582_2372201_+	hypothetical protein	NA	D6R401	Bacillus_phage	38.1	6.3e-145
AYC54069.1|2372221_2372380_+	hypothetical protein	NA	NA	NA	NA	NA
AYC52061.1|2372530_2373619_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	62.1	1.4e-106
AYC52062.1|2373750_2374137_+	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	72.7	3.1e-40
AYC52063.1|2374155_2374410_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	77.1	2.3e-28
AYC52064.1|2374428_2374728_+	hypothetical protein	NA	NA	NA	NA	NA
AYC52065.1|2374937_2375015_+	hydrophobic toxin	NA	NA	NA	NA	NA
AYC52066.1|2375574_2376681_-	hypothetical protein	NA	D6R410	Bacillus_phage	26.3	2.7e-28
>prophage 11
CP027789	Bacillus licheniformis strain TAB7 chromosome, complete genome	4367367	2541664	2553844	4367367		Staphylococcus_phage(55.56%)	14	NA	NA
AYC52247.1|2541664_2542258_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	3.4e-14
AYC52248.1|2542247_2543003_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
AYC52249.1|2543401_2543923_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AYC52250.1|2543933_2544308_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYC52251.1|2544409_2544874_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	70.7	1.7e-45
AYC52252.1|2544908_2546105_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.9	3.7e-116
AYC52253.1|2546126_2546774_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.5	9.7e-39
AYC52254.1|2546785_2547874_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.1	5.1e-64
AYC52255.1|2548234_2548579_-	hypothetical protein	NA	NA	NA	NA	NA
AYC52256.1|2548841_2551028_-	phosphatase	NA	A0A220BYT7	Staphylococcus_phage	41.3	1.4e-150
AYC52257.1|2551154_2551592_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AYC52258.1|2551750_2552056_-	hypothetical protein	NA	NA	NA	NA	NA
AYC52259.1|2552045_2553176_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	43.3	1.4e-77
AYC52260.1|2553406_2553844_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	44.6	5.4e-17
>prophage 12
CP027789	Bacillus licheniformis strain TAB7 chromosome, complete genome	4367367	2966447	3025319	4367367	tRNA,transposase,integrase,protease,coat	Bacillus_phage(35.71%)	59	3019398:3019423	3025404:3025429
AYC52697.1|2966447_2966789_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
AYC52698.1|2966801_2967110_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AYC52699.1|2967266_2968133_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
AYC52700.1|2968125_2968917_-	M23 family peptidase	NA	NA	NA	NA	NA
AYC52701.1|2969062_2969491_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
AYC52702.1|2969490_2969811_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYC52703.1|2969855_2970662_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
AYC52704.1|2970664_2971345_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
AYC52705.1|2971399_2971918_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AYC52706.1|2971914_2972823_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AYC52707.1|2972853_2973864_-	rod shape-determining protein	NA	NA	NA	NA	NA
AYC52708.1|2973951_2974626_-	JAB domain-containing protein	NA	NA	NA	NA	NA
AYC52709.1|2974680_2975253_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AYC52710.1|2975406_2976438_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
AYC52711.1|2976641_2977391_-	prepilin peptidase	NA	NA	NA	NA	NA
AYC52712.1|2977533_2978838_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AYC52713.1|2978913_2981556_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	2.8e-161
AYC52714.1|2982017_2982209_+	hypothetical protein	NA	NA	NA	NA	NA
AYC52715.1|2982228_2983251_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
AYC52716.1|2983278_2984778_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AYC52717.1|2984926_2986222_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AYC52718.1|2986247_2987222_-	porphobilinogen synthase	NA	NA	NA	NA	NA
AYC52719.1|2987225_2988017_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AYC52720.1|2988006_2988948_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AYC52721.1|2988987_2989818_-	cytochrome C assembly protein	NA	NA	NA	NA	NA
AYC52722.1|2989823_2991185_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AYC52723.1|2991373_2991859_+	hypothetical protein	NA	NA	NA	NA	NA
AYC52724.1|2991907_2992495_-	GTP-binding protein	NA	NA	NA	NA	NA
AYC52725.1|2992491_2994816_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.2	1.0e-186
AYC52726.1|2995034_2996690_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	35.7	1.4e-17
AYC52727.1|2996872_2998138_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.5	7.2e-147
AYC52728.1|2998406_2999681_-	trigger factor	NA	NA	NA	NA	NA
AYC52729.1|2999907_3000915_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AYC52730.1|3001044_3001644_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AYC52731.1|3001656_3003075_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AYC52732.1|3003108_3004221_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AYC52733.1|3004248_3005805_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.6	2.5e-08
AYC52734.1|3005791_3006820_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AYC52735.1|3006843_3007362_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AYC52736.1|3007358_3009083_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.2	1.5e-62
AYC52737.1|3009507_3010422_-	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
AYC52738.1|3010879_3011107_+	hypothetical protein	NA	NA	NA	NA	NA
AYC52739.1|3011149_3012532_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
AYC52740.1|3012944_3013199_+	hypothetical protein	NA	NA	NA	NA	NA
AYC52741.1|3013242_3013734_-	hypothetical protein	NA	NA	NA	NA	NA
AYC52742.1|3013747_3013948_-	hypothetical protein	NA	NA	NA	NA	NA
AYC52743.1|3014164_3014386_-	hypothetical protein	NA	NA	NA	NA	NA
AYC52744.1|3016568_3016817_-	hypothetical protein	NA	A8ATN7	Listeria_phage	39.7	3.2e-06
AYC52745.1|3016956_3017730_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
AYC52746.1|3017785_3018061_-	hypothetical protein	NA	A0A1B1P7C6	Bacillus_phage	70.3	6.4e-32
AYC52747.1|3018035_3018806_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1B1P7C6	Bacillus_phage	62.2	5.7e-86
AYC52748.1|3018814_3019171_-	hypothetical protein	NA	A0A1B1P7B5	Bacillus_phage	52.0	1.8e-23
AYC52749.1|3019201_3019489_-	hypothetical protein	NA	NA	NA	NA	NA
3019398:3019423	attL	GTGTCCGCAGGCTCTCCGTCTTGGAC	NA	NA	NA	NA
AYC52750.1|3019583_3020745_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.2	1.5e-34
AYC52751.1|3020872_3021352_-	TIGR01741 family protein	NA	NA	NA	NA	NA
AYC52752.1|3021357_3023352_-|integrase	integrase	integrase	A0A1P8CWI7	Bacillus_phage	23.6	2.1e-15
AYC52753.1|3023546_3024737_+	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	28.1	6.2e-39
AYC52754.1|3024733_3024865_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
AYC52755.1|3024959_3025319_-	ArpU family transcriptional regulator	NA	A0A2H4J748	uncultured_Caudovirales_phage	44.0	1.4e-18
3025404:3025429	attR	GTGTCCGCAGGCTCTCCGTCTTGGAC	NA	NA	NA	NA
>prophage 13
CP027789	Bacillus licheniformis strain TAB7 chromosome, complete genome	4367367	3589229	3636614	4367367	integrase,terminase,protease,tail,capsid,coat,portal,plate,holin,head	Bacillus_phage(60.0%)	61	3588786:3588803	3630286:3630303
3588786:3588803	attL	TGGAGACGGTGGGAGTCG	NA	NA	NA	NA
AYC53297.1|3589229_3589820_+	hypothetical protein	NA	Q9ZXD6	Bacillus_phage	62.2	2.6e-62
AYC53298.1|3590703_3591414_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AYC53299.1|3591621_3592473_+	DUF2202 domain-containing protein	NA	NA	NA	NA	NA
AYC53300.1|3592628_3593222_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	67.6	6.4e-53
AYC53301.1|3593342_3594296_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	41.7	1.6e-58
AYC53302.1|3594343_3594607_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	73.6	2.0e-30
AYC53303.1|3594622_3594892_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	62.9	4.3e-25
AYC53304.1|3594954_3595140_-	XkdX family protein	NA	NA	NA	NA	NA
AYC53305.1|3595136_3595460_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	47.4	2.0e-13
AYC53306.1|3595472_3596810_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	68.7	5.5e-113
AYC53307.1|3596830_3597385_-	hypothetical protein	NA	NA	NA	NA	NA
AYC53308.1|3598912_3600625_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	66.6	6.0e-221
AYC53309.1|3600637_3601474_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	69.3	5.5e-111
AYC53310.1|3601473_3605946_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.4	1.2e-71
AYC53311.1|3606154_3606517_-	hypothetical protein	NA	NA	NA	NA	NA
AYC53312.1|3606570_3607188_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYC53313.1|3607202_3607586_-	hypothetical protein	NA	NA	NA	NA	NA
AYC53314.1|3607582_3607981_-	hypothetical protein	NA	NA	NA	NA	NA
AYC53315.1|3607980_3608289_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AYC53316.1|3608278_3608581_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	1.2e-12
AYC53317.1|3608601_3609027_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	57.8	9.3e-14
AYC53318.1|3609050_3610334_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	44.5	1.3e-79
AYC53319.1|3610371_3611103_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	53.7	1.2e-56
AYC53320.1|3611047_3612358_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.7	4.9e-106
AYC53321.1|3612358_3612550_-	DUF1056 domain-containing protein	NA	NA	NA	NA	NA
AYC53322.1|3612561_3614271_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.0	2.7e-205
AYC53323.1|3614267_3614783_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	45.8	9.8e-34
AYC53324.1|3614801_3614990_-	hypothetical protein	NA	NA	NA	NA	NA
AYC53325.1|3615012_3615387_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	2.4e-29
AYC53326.1|3615413_3615722_-	hypothetical protein	NA	NA	NA	NA	NA
AYC53327.1|3615942_3616167_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYC53328.1|3616916_3617297_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	82.9	8.8e-48
AYC53329.1|3617409_3617808_-	hypothetical protein	NA	A0A1B1P7W5	Bacillus_phage	38.6	2.5e-05
AYC53330.1|3617823_3618339_-	hypothetical protein	NA	D6R425	Bacillus_phage	82.5	9.6e-82
AYC53331.1|3618342_3618513_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	56.6	3.0e-08
AYC53332.1|3618509_3619049_-	nuclease	NA	Q9ZXC2	Bacillus_phage	89.9	6.5e-89
AYC53333.1|3619045_3619483_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	74.5	4.7e-61
AYC53334.1|3619460_3619724_-	hypothetical protein	NA	NA	NA	NA	NA
AYC53335.1|3619999_3622432_-	DNA primase	NA	D6R422	Bacillus_phage	80.0	0.0e+00
AYC53336.1|3622492_3622930_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	92.4	9.7e-75
AYC53337.1|3622929_3623862_-	hypothetical protein	NA	Q9ZXC7	Bacillus_phage	87.5	9.4e-152
AYC53338.1|3623865_3624423_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	72.4	6.3e-71
AYC53339.1|3624515_3624758_-	hypothetical protein	NA	NA	NA	NA	NA
AYC53340.1|3624845_3625112_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	53.5	1.0e-18
AYC53341.1|3625171_3625552_+	DUF2513 domain-containing protein	NA	A0A2I7SCV0	Paenibacillus_phage	41.6	7.0e-21
AYC54084.1|3625543_3625714_-	phage protein	NA	NA	NA	NA	NA
AYC53342.1|3626057_3626612_-	hypothetical protein	NA	A0A288WGQ2	Bacillus_phage	42.7	1.3e-31
AYC53343.1|3626669_3626858_-	hypothetical protein	NA	NA	NA	NA	NA
AYC53344.1|3626989_3627178_-	transcriptional regulator	NA	NA	NA	NA	NA
AYC53345.1|3627174_3627969_-	hypothetical protein	NA	A0A2I7SCV5	Paenibacillus_phage	52.4	3.7e-64
AYC53346.1|3627992_3628211_-	XRE family transcriptional regulator	NA	Q8SBM9	Clostridium_phage	59.7	2.3e-16
AYC53347.1|3628387_3629026_+	XRE family transcriptional regulator	NA	A0A2I7SCV6	Paenibacillus_phage	47.7	1.8e-45
AYC53348.1|3629096_3630191_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	52.5	1.4e-98
AYC53349.1|3630754_3631228_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	61.1	1.0e-45
3630286:3630303	attR	TGGAGACGGTGGGAGTCG	NA	NA	NA	NA
AYC53350.1|3631340_3633644_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.7	6.9e-95
AYC53351.1|3633657_3634404_-	carboxylesterase	NA	NA	NA	NA	NA
AYC53352.1|3634544_3634775_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AYC53353.1|3634945_3635230_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	52.7	5.8e-12
AYC53354.1|3635258_3635492_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYC53355.1|3635644_3636046_+	transcriptional regulator	NA	S6C481	Thermus_phage	45.3	4.2e-16
AYC53356.1|3636209_3636614_+	XRE family transcriptional regulator	NA	S6C481	Thermus_phage	49.5	2.1e-15
>prophage 1
CP027791	Bacillus licheniformis strain TAB7 plasmid pTAB7B, complete sequence	31204	5189	30999	31204	protease,portal,capsid,tail,head,terminase	Staphylococcus_phage(22.73%)	27	NA	NA
AYC54141.1|5189_5537_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	48.7	2.0e-22
AYC54142.1|6068_6557_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JCT0	uncultured_Caudovirales_phage	39.5	8.1e-22
AYC54143.1|6549_8274_+|terminase	terminase large subunit	terminase	A0A1Q1PVU8	Staphylococcus_phage	45.9	5.4e-137
AYC54144.1|8481_9711_+|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.8	6.1e-66
AYC54145.1|9707_10280_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1Q1PVX3	Staphylococcus_phage	56.3	2.3e-47
AYC54146.1|10505_11702_+|capsid	phage major capsid protein	capsid	A0A2H4J2Q9	uncultured_Caudovirales_phage	36.0	2.5e-48
AYC54147.1|11758_12049_+	DNA packaging protein	NA	A0A0D4DBY0	Staphylococcus_phage	35.5	3.4e-07
AYC54148.1|12035_12368_+|head,tail	head-tail adaptor protein	head,tail	V5UQC7	Enterococcus_phage	37.7	5.4e-09
AYC54149.1|12368_12743_+|tail	phage tail protein	tail	A0A2D1GPI2	Lactobacillus_phage	37.3	3.1e-13
AYC54150.1|12739_13123_+	hypothetical protein	NA	NA	NA	NA	NA
AYC54151.1|13145_13745_+|tail	phage tail protein	tail	A0A249XUT9	Enterococcus_phage	38.7	3.1e-23
AYC54152.1|13828_14179_+	hypothetical protein	NA	A0A0M4R2F4	Enterococcus_phage	36.9	5.7e-09
AYC54153.1|14475_19035_+|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	44.7	1.2e-95
AYC54154.1|19038_19860_+|tail	phage tail family protein	tail	A8ASK7	Listeria_phage	37.9	9.4e-47
AYC54155.1|19875_20949_+	hypothetical protein	NA	Q9T1A5	Listeria_phage	45.0	9.0e-82
AYC54156.1|20952_22008_+	hypothetical protein	NA	Q9T1A4	Listeria_phage	30.7	1.0e-37
AYC54157.1|22004_23585_+|tail	phage tail protein	tail	M4ZRP1	Bacillus_phage	43.2	1.0e-28
AYC54158.1|23597_23921_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	44.3	7.3e-11
AYC54159.1|23917_24112_+	XkdX family protein	NA	NA	NA	NA	NA
AYC54167.1|24098_24263_+	Phage xkdX protein	NA	NA	NA	NA	NA
AYC54160.1|24278_24740_+	hypothetical protein	NA	M9Q253	Clostridium_phage	38.5	2.6e-14
AYC54161.1|24766_25594_+	hypothetical protein	NA	Q938J4	Temperate_phage	48.4	2.7e-33
AYC54162.1|25755_26550_+	chromosome partitioning protein ParA	NA	F0PIG8	Enterococcus_phage	25.0	3.3e-12
AYC54163.1|26564_26897_+	hypothetical protein	NA	A0A1Z1LZL0	Bacillus_phage	48.6	9.8e-11
AYC54164.1|27009_27540_+	hypothetical protein	NA	NA	NA	NA	NA
AYC54165.1|28908_29154_+	hypothetical protein	NA	NA	NA	NA	NA
AYC54166.1|29166_30999_+	hypothetical protein	NA	A0A1Z1LZK7	Bacillus_phage	33.7	3.0e-93
