The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032379	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 chromosome, complete genome	4844213	1152487	1218260	4844213	lysis,portal,integrase,tail,head,plate,transposase,capsid,tRNA	Salmonella_phage(87.8%)	64	1155524:1155539	1168791:1168806
AYB91936.1|1152487_1153598_+|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
AYB91937.1|1154394_1155198_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
1155524:1155539	attL	TCAGCCAGCAGGCTTT	NA	NA	NA	NA
AYB91938.1|1155596_1156190_-	hypothetical protein	NA	NA	NA	NA	NA
AYB91939.1|1156449_1157475_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	99.1	9.2e-201
AYB91940.1|1157478_1158111_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.1e-66
AYB91941.1|1158227_1158467_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
AYB91942.1|1159020_1159254_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
AYB91943.1|1159201_1159660_-	hypothetical protein	NA	NA	NA	NA	NA
AYB91944.1|1159879_1160221_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
AYB91945.1|1160288_1160522_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
AYB91946.1|1160521_1160749_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
AYB91947.1|1160745_1161603_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	99.6	1.5e-164
AYB91948.1|1161599_1163996_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.9	0.0e+00
AYB91949.1|1164151_1164340_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
AYB91950.1|1164408_1164708_-	hypothetical protein	NA	NA	NA	NA	NA
AYB91951.1|1164818_1165625_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.8	6.2e-51
AYB91952.1|1166117_1167272_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYB91953.1|1168051_1169083_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.0	5.0e-170
1168791:1168806	attR	AAAGCCTGCTGGCTGA	NA	NA	NA	NA
AYB91954.1|1169082_1170849_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
AYB91955.1|1170991_1171825_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	84.5	5.9e-121
AYB91956.1|1171841_1172900_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	4.9e-181
AYB91957.1|1172903_1173554_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYB91958.1|1173649_1174114_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
AYB91959.1|1174113_1174317_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYB91960.1|1174320_1174536_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYB95346.1|1174555_1175029_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYB91961.1|1175030_1175408_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	5.1e-16
AYB91962.1|1175404_1175833_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.1	1.3e-47
AYB91963.1|1175762_1175966_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	73.1	8.9e-23
AYB91964.1|1175928_1176360_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
AYB91965.1|1176352_1176799_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.1	3.1e-60
AYB91966.1|1176825_1177692_-	hypothetical protein	NA	NA	NA	NA	NA
AYB91967.1|1177787_1178366_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.8e-92
AYB91968.1|1178362_1178722_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	91.5	3.5e-54
AYB91969.1|1178708_1179617_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	98.0	7.2e-157
AYB91970.1|1179609_1180215_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
AYB91971.1|1180211_1181897_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	50.6	3.5e-128
AYB91972.1|1181899_1182427_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
AYB91973.1|1182557_1183730_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	1.3e-222
AYB91974.1|1183739_1184255_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYB91975.1|1184309_1184612_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
AYB91976.1|1184626_1184746_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
AYB91977.1|1184738_1187546_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.0	0.0e+00
AYB91978.1|1187542_1188028_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
AYB91979.1|1188024_1189125_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.6	9.0e-194
AYB91980.1|1189193_1189412_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
AYB95347.1|1189963_1191127_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYB91981.1|1193306_1194716_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AYB91982.1|1194780_1206000_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AYB95348.1|1206614_1207097_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AYB91983.1|1207246_1207723_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYB91984.1|1207712_1208003_+	RnfH family protein	NA	NA	NA	NA	NA
AYB91985.1|1208168_1208507_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYB91986.1|1208655_1210317_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AYB95350.1|1210402_1211281_-	NAD(+) kinase	NA	NA	NA	NA	NA
AYB95349.1|1211404_1211995_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYB91987.1|1212029_1212635_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYB91988.1|1212755_1213997_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYB91989.1|1214061_1214853_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYB91990.1|1214798_1215095_-	hypothetical protein	NA	NA	NA	NA	NA
AYB91991.1|1215018_1216380_+	signal recognition particle protein	NA	NA	NA	NA	NA
AYB91992.1|1216632_1216881_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYB95351.1|1216899_1217448_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYB91993.1|1217492_1218260_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
CP032379	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 chromosome, complete genome	4844213	1481366	1487405	4844213		Salmonella_virus(50.0%)	6	NA	NA
AYB92208.1|1481366_1481597_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	5.4e-08
AYB92209.1|1481535_1481679_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
AYB92210.1|1482668_1484591_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	76.9	8.1e-299
AYB92211.1|1484608_1484863_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
AYB95359.1|1484831_1485221_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
AYB92212.1|1486463_1487405_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 3
CP032379	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 chromosome, complete genome	4844213	1723602	1732773	4844213	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYB92430.1|1723602_1724550_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AYB92431.1|1724533_1725265_+	ABC transporter permease	NA	NA	NA	NA	NA
AYB92432.1|1725245_1725353_-	protein YohO	NA	NA	NA	NA	NA
AYB92433.1|1725412_1726144_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	2.2e-100
AYB92434.1|1726366_1728052_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.4e-278
AYB92435.1|1728048_1728768_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYB92436.1|1728814_1729282_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	8.8e-74
AYB92437.1|1729338_1729869_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AYB92438.1|1730040_1730499_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	71.2	7.1e-52
AYB92439.1|1730739_1732773_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	2.1e-55
>prophage 4
CP032379	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 chromosome, complete genome	4844213	1799970	1810477	4844213		Enterobacteria_phage(37.5%)	10	NA	NA
AYB92491.1|1799970_1801374_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
AYB92492.1|1801551_1802445_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYB92493.1|1802821_1803907_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYB92494.1|1803906_1804806_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AYB95369.1|1804853_1805732_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
AYB92495.1|1805732_1806284_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
AYB92496.1|1806289_1807264_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AYB92497.1|1807279_1808053_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYB92498.1|1808057_1809137_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
AYB92499.1|1809163_1810477_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
CP032379	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 chromosome, complete genome	4844213	1923405	1969616	4844213	terminase,integrase,tail,head,plate,holin,transposase,capsid	Salmonella_phage(84.91%)	64	1921377:1921391	1941697:1941711
1921377:1921391	attL	TTATCAATGACATCT	NA	NA	NA	NA
AYB95375.1|1923405_1924680_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.1	8.2e-74
AYB92610.1|1925035_1925833_-	protein MtfA	NA	NA	NA	NA	NA
AYB92611.1|1926124_1927114_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
AYB92612.1|1927115_1927358_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	98.8	2.1e-39
AYB92613.1|1927382_1927952_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	91.0	5.8e-104
AYB92614.1|1927948_1928698_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	83.6	1.1e-46
AYB92615.1|1928701_1929175_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.3	5.0e-69
AYB92616.1|1929174_1929912_-	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	86.3	1.8e-52
AYB92617.1|1929982_1930522_-	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
AYB92618.1|1930658_1931486_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	97.5	1.0e-149
AYB92619.1|1931543_1931915_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
AYB92620.1|1932451_1932697_+	hypothetical protein	NA	NA	NA	NA	NA
AYB92621.1|1932614_1932911_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	98.0	1.1e-50
AYB92622.1|1932891_1933143_-	hypothetical protein	NA	NA	NA	NA	NA
AYB92623.1|1933070_1933256_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
AYB92624.1|1933460_1934156_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
AYB92625.1|1934129_1934315_+	amino acid permease	NA	NA	NA	NA	NA
AYB92626.1|1934253_1934478_+	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AYB92627.1|1934506_1935061_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	5.9e-101
AYB92628.1|1935057_1936200_+	peptidase	NA	A0A1C9IHV9	Salmonella_phage	87.6	1.6e-182
AYB92629.1|1936196_1936421_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AYB92630.1|1936417_1937392_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	98.1	1.2e-165
AYB92631.1|1937388_1937862_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	93.8	6.6e-53
AYB92632.1|1937858_1938740_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	1.1e-170
AYB92633.1|1938748_1939138_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
AYB92634.1|1939109_1940015_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.0	2.8e-161
AYB95376.1|1940022_1941012_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	3.0e-188
AYB92635.1|1941025_1941778_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	2.4e-134
1941697:1941711	attR	AGATGTCATTGATAA	NA	NA	NA	NA
AYB92636.1|1941809_1941998_+	hypothetical protein	NA	NA	NA	NA	NA
AYB92637.1|1942066_1942309_+	hypothetical protein	NA	NA	NA	NA	NA
AYB92638.1|1942440_1942794_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	88.7	1.0e-50
AYB92639.1|1942797_1943274_+	lysozyme	NA	Q8SBE0	Shigella_phage	96.8	1.7e-85
AYB92640.1|1943257_1943650_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	92.3	1.6e-57
AYB92641.1|1943534_1943807_+	peptidase	NA	Q8SBD8	Shigella_phage	77.6	3.8e-29
AYB92642.1|1944175_1944610_+	hypothetical protein	NA	NA	NA	NA	NA
AYB92643.1|1944737_1945088_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	8.0e-64
AYB92644.1|1945205_1945709_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	3.6e-89
AYB92645.1|1945705_1947439_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.8	0.0e+00
AYB92646.1|1947450_1947633_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
AYB92647.1|1949515_1950721_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
AYB92648.1|1950771_1950972_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
AYB92649.1|1950974_1951298_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
AYB92650.1|1951294_1951699_+|head,tail	head-tail adaptor protein	head,tail	A0A192Y6C2	Salmonella_phage	99.3	5.4e-72
AYB92651.1|1951670_1952183_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
AYB92652.1|1952179_1952740_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	99.5	8.8e-105
AYB92653.1|1952743_1952908_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
AYB92654.1|1952897_1954394_+|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	99.8	6.1e-278
AYB92655.1|1954393_1954750_+|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
AYB92656.1|1954746_1955073_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
AYB92657.1|1955157_1957086_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.7	0.0e+00
AYB92658.1|1957119_1958460_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
AYB92659.1|1958456_1959521_+|plate	baseplate protein	plate	Q8HAC0	Salmonella_phage	95.1	4.2e-188
AYB92660.1|1959513_1960047_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
AYB92661.1|1960051_1960465_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
AYB92662.1|1960457_1961537_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.7	2.5e-204
AYB92663.1|1961539_1962127_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
AYB92664.1|1962113_1963676_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	100.0	2.6e-287
AYB92665.1|1963675_1964245_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
AYB92666.1|1964529_1965537_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
AYB92667.1|1965749_1965971_+	DNA-binding protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
AYB92668.1|1966334_1966517_+	hypothetical protein	NA	NA	NA	NA	NA
AYB92669.1|1966909_1967287_+	hypothetical protein	NA	NA	NA	NA	NA
AYB92670.1|1967313_1968132_+	hypothetical protein	NA	NA	NA	NA	NA
AYB92671.1|1968593_1969616_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP032379	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 chromosome, complete genome	4844213	2661812	2760346	4844213	lysis,protease,terminase,portal,integrase,tail,holin,tRNA	Enterobacteria_phage(24.0%)	108	2691595:2691610	2760347:2760511
AYB93339.1|2661812_2662508_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AYB93340.1|2662565_2664476_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
AYB93341.1|2664606_2664951_+	RidA family protein	NA	NA	NA	NA	NA
AYB93342.1|2664956_2665136_-	YoaH family protein	NA	NA	NA	NA	NA
AYB93343.1|2665216_2666581_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	34.5	3.6e-43
AYB93344.1|2666584_2667163_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AYB93345.1|2667426_2668791_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AYB93346.1|2668928_2670530_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AYB93347.1|2670551_2672111_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
AYB93348.1|2672098_2672434_-	hypothetical protein	NA	NA	NA	NA	NA
AYB93349.1|2672583_2673552_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AYB93350.1|2673604_2674405_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AYB93351.1|2674417_2675269_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AYB93352.1|2675327_2675786_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AYB95408.1|2676141_2676762_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
AYB93353.1|2676758_2677568_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AYB93354.1|2677633_2679379_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
AYB93355.1|2679598_2679808_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AYB93356.1|2679820_2679964_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AYB93357.1|2680612_2680900_-	hypothetical protein	NA	NA	NA	NA	NA
AYB93358.1|2680970_2681114_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AYB93359.1|2681271_2681511_+	hypothetical protein	NA	NA	NA	NA	NA
AYB93360.1|2681722_2682514_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AYB93361.1|2682689_2684063_+	MFS transporter	NA	NA	NA	NA	NA
AYB93362.1|2684110_2684992_-|protease	protease HtpX	protease	NA	NA	NA	NA
AYB93363.1|2685184_2687233_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AYB93364.1|2687252_2687939_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYB93365.1|2688036_2688621_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AYB93366.1|2688662_2689946_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYB93367.1|2689908_2692548_+	PqiB family protein	NA	NA	NA	NA	NA
2691595:2691610	attL	CCGGAATATCGCCACC	NA	NA	NA	NA
AYB95409.1|2692625_2694065_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
2691595:2691610	attL	CCGGAATATCGCCACC	NA	NA	NA	NA
AYB93368.1|2694179_2694419_+	DUF1480 family protein	NA	NA	NA	NA	NA
AYB93369.1|2694529_2694721_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYB93370.1|2694739_2695390_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
AYB93371.1|2695613_2695778_-	hypothetical protein	NA	NA	NA	NA	NA
AYB93372.1|2696062_2696785_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AYB93373.1|2697468_2697810_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AYB93374.1|2698191_2698668_+	hypothetical protein	NA	NA	NA	NA	NA
AYB93375.1|2699040_2699460_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYB93376.1|2699588_2699783_-	hypothetical protein	NA	NA	NA	NA	NA
AYB93377.1|2699829_2700099_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
AYB93378.1|2700264_2700405_+	hypothetical protein	NA	NA	NA	NA	NA
AYB95410.1|2702713_2702914_-	hypothetical protein	NA	NA	NA	NA	NA
AYB93379.1|2704580_2704739_+	hypothetical protein	NA	NA	NA	NA	NA
AYB93380.1|2704748_2705363_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
AYB93381.1|2706115_2706382_-	hypothetical protein	NA	NA	NA	NA	NA
AYB93382.1|2706510_2706636_-	arsenic transporter	NA	NA	NA	NA	NA
AYB93383.1|2706897_2707002_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYB93384.1|2707203_2707404_+	phage virulence factor	NA	NA	NA	NA	NA
AYB93385.1|2708862_2709054_+	hypothetical protein	NA	NA	NA	NA	NA
AYB93386.1|2709118_2709286_+	lytic enzyme	NA	NA	NA	NA	NA
AYB93387.1|2709542_2710076_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	3.2e-11
AYB93388.1|2710072_2710360_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.9	1.6e-38
AYB93389.1|2711493_2712573_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	1.1e-98
AYB93390.1|2713526_2714327_+	hypothetical protein	NA	NA	NA	NA	NA
AYB93391.1|2714806_2715529_+	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AYB93392.1|2715730_2716300_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	90.5	3.4e-96
AYB93393.1|2716299_2718717_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.8	4.7e-86
2717199:2717214	attR	CCGGAATATCGCCACC	NA	NA	NA	NA
AYB93394.1|2718770_2719013_-	hypothetical protein	NA	NA	NA	NA	NA
2717199:2717214	attR	CCGGAATATCGCCACC	NA	NA	NA	NA
AYB93395.1|2719051_2719915_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
AYB93396.1|2722475_2723180_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
AYB93397.1|2723083_2723815_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	1.0e-113
AYB93398.1|2723824_2724520_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
AYB93399.1|2724609_2725143_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AYB93400.1|2725259_2725757_-	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	35.9	1.4e-16
AYB93401.1|2725855_2726188_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
AYB95411.1|2726184_2729172_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	2.8e-266
AYB93402.1|2729251_2729581_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AYB93403.1|2729577_2729976_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AYB93404.1|2730021_2730771_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	4.8e-90
AYB93405.1|2730782_2731184_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
AYB93406.1|2731180_2731747_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
AYB93407.1|2731727_2732027_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AYB93408.1|2732019_2732343_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AYB95413.1|2732433_2734515_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
AYB95412.1|2734438_2735956_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.7	4.9e-174
AYB93409.1|2735982_2736189_-	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AYB93410.1|2736185_2738324_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
AYB93411.1|2738280_2738814_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	7.8e-34
AYB95415.1|2739021_2739501_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AYB93412.1|2739518_2739971_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AYB95414.1|2739954_2740284_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AYB93413.1|2740559_2741246_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
AYB93414.1|2741606_2742056_+	hypothetical protein	NA	NA	NA	NA	NA
AYB95416.1|2742429_2742954_-	hypothetical protein	NA	NA	NA	NA	NA
AYB93415.1|2743050_2743740_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
AYB93416.1|2743869_2744097_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
AYB93417.1|2744093_2744693_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
AYB93418.1|2744756_2745062_-	hypothetical protein	NA	NA	NA	NA	NA
AYB93419.1|2745484_2745676_+	hypothetical protein	NA	NA	NA	NA	NA
AYB93420.1|2745693_2747673_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
AYB93421.1|2748069_2749200_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AYB93422.1|2749486_2749882_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	9.8e-18
AYB93423.1|2749894_2750356_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	75.5	3.5e-67
AYB93424.1|2750348_2751347_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.3	4.1e-121
AYB93425.1|2751393_2751888_-	hypothetical protein	NA	NA	NA	NA	NA
AYB93426.1|2751874_2752129_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
AYB93427.1|2752227_2752626_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
AYB93428.1|2753028_2753295_+	hypothetical protein	NA	NA	NA	NA	NA
AYB93429.1|2753643_2753919_+	hypothetical protein	NA	NA	NA	NA	NA
AYB93430.1|2753922_2754129_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
AYB93431.1|2754204_2754540_+	hypothetical protein	NA	NA	NA	NA	NA
AYB93432.1|2754680_2757371_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	72.8	4.0e-118
AYB93433.1|2757363_2758194_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	2.5e-103
AYB93434.1|2758240_2758426_+	DUF1187 family protein	NA	NA	NA	NA	NA
AYB95417.1|2758716_2758953_+	hypothetical protein	NA	NA	NA	NA	NA
AYB93435.1|2759013_2759292_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.8e-10
AYB93436.1|2759266_2760346_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	1.5e-100
2760347:2760511	attR	TACTCCAATTTTCGTTGTGAAATAAATGTTAAATTTAATTTGATTGTGATATAACCAAAAAGACCGGAATACAGAAATTCGGAAAAATTTCGGAAAATTTCGGAAAACGGATCGTAAGCGACTGTTTTATAAGAAAAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
CP032379	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 chromosome, complete genome	4844213	2862445	2872153	4844213		Burkholderia_phage(28.57%)	12	NA	NA
AYB93544.1|2862445_2864158_-	cellulose synthesis regulatory protein	NA	A0A127AWB9	Bacillus_phage	37.4	1.6e-19
AYB93545.1|2864322_2864568_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AYB93546.1|2864584_2865502_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AYB93547.1|2865671_2866592_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AYB93548.1|2866580_2867051_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
AYB93549.1|2867031_2868462_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
AYB93550.1|2868535_2869231_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AYB93551.1|2869310_2869622_-	hypothetical protein	NA	NA	NA	NA	NA
AYB93552.1|2870271_2870829_+	porin	NA	Q1MVN1	Enterobacteria_phage	68.4	2.0e-64
AYB93553.1|2871084_2871483_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	55.0	2.7e-31
AYB95423.1|2871741_2871930_-	cold-shock protein	NA	NA	NA	NA	NA
AYB93554.1|2871940_2872153_-	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
>prophage 8
CP032379	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 chromosome, complete genome	4844213	2957073	3001036	4844213	tail,protease	Escherichia_phage(33.33%)	44	NA	NA
AYB93636.1|2957073_2957754_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.4	1.6e-84
AYB93637.1|2958392_2959052_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYB93638.1|2959138_2959468_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AYB93639.1|2959464_2959746_-	acylphosphatase	NA	NA	NA	NA	NA
AYB93640.1|2959794_2960574_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYB93641.1|2960599_2961148_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AYB93642.1|2961362_2962574_+	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AYB93643.1|2962631_2962949_+	heat-shock protein HspQ	NA	NA	NA	NA	NA
AYB93644.1|2962993_2963410_-	CoA-binding protein	NA	NA	NA	NA	NA
AYB93645.1|2963580_2964243_+	DUF2057 family protein	NA	NA	NA	NA	NA
AYB93646.1|2964337_2964796_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AYB93647.1|2964831_2966886_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYB93648.1|2967009_2967456_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AYB93649.1|2967474_2969628_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AYB93650.1|2969614_2970220_-	DNA transformation protein	NA	NA	NA	NA	NA
AYB93651.1|2970436_2970946_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AYB93652.1|2971302_2972355_+	outer membrane protein A	NA	NA	NA	NA	NA
AYB93653.1|2972426_2972879_-	macrodomain Ter protein	NA	NA	NA	NA	NA
AYB93654.1|2973064_2974825_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AYB93655.1|2974893_2975412_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AYB93656.1|2975511_2975679_-	ribosome modulation factor	NA	NA	NA	NA	NA
AYB93657.1|2975934_2976498_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AYB93658.1|2976494_2978135_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AYB93659.1|2978139_2979393_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
AYB93660.1|2979407_2981315_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
AYB93661.1|2981327_2983436_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AYB93662.1|2983534_2984644_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYB93663.1|2984640_2985183_-	cell division protein ZapC	NA	NA	NA	NA	NA
AYB93664.1|2985348_2986359_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AYB93665.1|2986566_2989179_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
AYB93666.1|2989605_2989797_+	DinI family protein	NA	S4TNM0	Salmonella_phage	93.7	1.8e-25
AYB93667.1|2990067_2990754_+	virulence protein	NA	NA	NA	NA	NA
AYB93668.1|2991113_2991740_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AYB93669.1|2992387_2993356_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.1	3.3e-192
AYB93670.1|2993581_2993830_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
AYB93671.1|2993833_2994415_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AYB93672.1|2994414_2996124_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
AYB93673.1|2996120_2996747_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
AYB93674.1|2996730_2997957_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	63.6	3.2e-147
AYB93675.1|2997953_2998286_-	hypothetical protein	NA	NA	NA	NA	NA
AYB93676.1|2998282_2998999_-	hypothetical protein	NA	NA	NA	NA	NA
AYB93677.1|2998995_3000048_-	hypothetical protein	NA	NA	NA	NA	NA
AYB93678.1|3000047_3000323_-	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	33.3	1.6e-06
AYB93679.1|3000538_3001036_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	38.0	8.9e-24
>prophage 9
CP032379	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 chromosome, complete genome	4844213	3007978	3033612	4844213	terminase,holin	Salmonella_phage(72.41%)	32	NA	NA
AYB93687.1|3007978_3009010_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.2	2.5e-73
AYB93688.1|3009027_3009900_-	hypothetical protein	NA	NA	NA	NA	NA
AYB93689.1|3009920_3011495_-	NUDIX hydrolase	NA	Q6UJ14	Burkholderia_virus	48.6	2.2e-20
AYB93690.1|3011495_3012371_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	45.5	1.5e-55
AYB93691.1|3012342_3013773_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.9	2.6e-92
AYB93692.1|3013772_3015044_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.3	1.1e-83
AYB93693.1|3015033_3016008_-|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	37.3	1.6e-29
AYB93694.1|3016069_3016483_-	hypothetical protein	NA	NA	NA	NA	NA
AYB93695.1|3016472_3017024_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AYB93696.1|3017020_3017635_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.1	1.2e-107
AYB93697.1|3017637_3017985_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	1.3e-45
AYB93698.1|3018383_3019181_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	4.4e-150
AYB93699.1|3019170_3019317_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AYB93700.1|3019313_3019925_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
AYB93701.1|3019927_3020134_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AYB93702.1|3020133_3020736_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
AYB93703.1|3020775_3021081_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYB93704.1|3021070_3021310_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYB93705.1|3021465_3021732_-	hypothetical protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYB93706.1|3021825_3022398_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYB93707.1|3022401_3022875_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	4.7e-67
AYB93708.1|3022874_3023399_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYB93709.1|3023395_3023743_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYB93710.1|3023753_3024503_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYB93711.1|3024505_3025489_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
AYB93712.1|3025573_3025948_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYB93713.1|3025913_3026150_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
AYB93714.1|3026279_3026684_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYB93715.1|3027393_3030582_+	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	74.0	0.0e+00
AYB93716.1|3031746_3031986_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AYB93717.1|3032026_3032275_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYB93718.1|3032319_3033612_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.3e-252
>prophage 10
CP032379	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 chromosome, complete genome	4844213	3104581	3111894	4844213	protease,integrase	Ralstonia_phage(16.67%)	7	3099637:3099651	3110630:3110644
3099637:3099651	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYB93772.1|3104581_3104959_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
AYB93773.1|3105120_3105318_+	hypothetical protein	NA	NA	NA	NA	NA
AYB93774.1|3105530_3107807_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AYB93775.1|3107837_3108158_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYB93776.1|3108481_3108703_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYB93777.1|3108832_3110779_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.9	2.0e-39
3110630:3110644	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
AYB93778.1|3110775_3111894_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	8.1e-09
>prophage 11
CP032379	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 chromosome, complete genome	4844213	3449351	3494988	4844213	lysis,coat,protease,terminase,portal,integrase,tail,holin	Salmonella_phage(71.64%)	68	3449018:3449058	3495006:3495046
3449018:3449058	attL	GCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGA	NA	NA	NA	NA
AYB94074.1|3449351_3449714_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
AYB94075.1|3449710_3450637_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	96.7	1.4e-168
AYB94076.1|3450617_3452270_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	38.0	1.5e-83
AYB94077.1|3453753_3454116_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
AYB94078.1|3454112_3455045_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
AYB94079.1|3455034_3456492_+	hypothetical protein	NA	E7C9N7	Salmonella_phage	99.8	1.7e-240
AYB94080.1|3456550_3458554_-	endorhamnosidase	NA	E7C9U9	Salmonella_phage	99.9	0.0e+00
AYB94081.1|3458689_3458941_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
AYB94082.1|3459040_3459220_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
AYB94083.1|3459233_3459599_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
AYB94084.1|3459629_3459959_+	hypothetical protein	NA	NA	NA	NA	NA
AYB94085.1|3459976_3461890_-	DNA transfer protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
AYB94086.1|3461889_3463194_-	acyltransferase	NA	E7C9U5	Salmonella_phage	96.3	7.8e-213
AYB94087.1|3463204_3463894_-	DNA transfer protein	NA	E7C9U4	Salmonella_phage	99.6	1.2e-108
AYB94088.1|3463896_3464352_-	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
AYB94089.1|3464351_3465053_-|tail	phage tail protein	tail	B8K1I3	Salmonella_phage	98.3	8.8e-70
AYB94090.1|3465056_3466475_-	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.3	3.3e-273
AYB94091.1|3466434_3466935_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.8	5.5e-90
AYB94092.1|3466918_3467479_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	98.9	1.4e-102
AYB94093.1|3467519_3468812_-|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.8	1.1e-243
AYB94094.1|3468811_3469723_-	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	100.0	4.9e-161
AYB94095.1|3469736_3471914_-|portal	portal protein	portal	I6R968	Salmonella_phage	98.3	0.0e+00
AYB94096.1|3471913_3473413_-|terminase	terminase	terminase	A8CGE0	Salmonella_phage	99.8	6.9e-306
AYB94097.1|3473390_3473879_-	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
AYB94098.1|3473882_3474287_-	Decoration protein	NA	C6ZR73	Salmonella_phage	100.0	5.3e-67
AYB94099.1|3474286_3474676_-	hypothetical protein	NA	C6ZR72	Salmonella_phage	99.2	1.5e-74
AYB94100.1|3474679_3474922_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AYB94101.1|3475180_3475711_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	96.6	4.0e-91
AYB94102.1|3475664_3475889_-	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	90.3	7.2e-26
AYB94103.1|3475923_3476394_-|lysis	lysis protein	lysis	H6WRZ5	Salmonella_phage	87.2	1.2e-62
AYB94104.1|3476390_3476828_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
AYB94105.1|3476811_3477138_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
AYB94106.1|3477273_3477471_-	hypothetical protein	NA	C6ZR63	Salmonella_phage	96.2	5.0e-23
AYB94107.1|3477517_3478006_-	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
AYB94108.1|3478075_3478279_-	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	94.0	5.7e-30
AYB94109.1|3478275_3478671_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	96.9	2.9e-70
AYB94110.1|3478667_3478964_-	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	98.9	7.5e-47
AYB94111.1|3478926_3479103_-	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	96.6	1.8e-27
AYB94112.1|3479099_3479282_-	NinE family protein	NA	Q716C5	Shigella_phage	96.7	1.8e-27
AYB94113.1|3479248_3479422_-	protein ninD	NA	C6ZR56	Salmonella_phage	93.0	7.0e-29
AYB94114.1|3479418_3480291_-	hypothetical protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
AYB94115.1|3480287_3480746_-	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	98.6	3.0e-79
AYB94116.1|3480801_3482178_-	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	99.3	4.8e-253
AYB94117.1|3482986_3483133_-	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AYB94118.1|3483167_3483449_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
AYB94119.1|3483559_3483775_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
AYB94120.1|3483885_3484575_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
AYB94121.1|3484663_3485587_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	100.0	1.5e-181
AYB94122.1|3485622_3485832_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	5.5e-28
AYB94123.1|3486195_3486528_+	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	100.0	2.2e-55
AYB94124.1|3486606_3486807_+	restriction endonuclease	NA	A0A1R3Y5S4	Salmonella_virus	100.0	1.0e-31
AYB94125.1|3486846_3487146_+	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	99.0	3.3e-50
AYB94126.1|3487469_3487610_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	2.0e-18
AYB94127.1|3487602_3487716_+	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
AYB94128.1|3487712_3487901_+	hypothetical protein	NA	C6ZR38	Salmonella_phage	100.0	1.3e-28
AYB94129.1|3487909_3488617_+	recombinase	NA	E7C9Q0	Salmonella_phage	89.8	9.7e-125
AYB94130.1|3488617_3489124_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	98.8	3.8e-91
AYB94131.1|3489132_3489681_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
AYB94132.1|3489696_3489990_+	DUF2856 family protein	NA	A0A1V0E5L7	Salmonella_phage	100.0	5.5e-50
AYB94133.1|3490000_3490171_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AYB94134.1|3490167_3490749_+	Eae-like protein	NA	A0A0N6WGF1	Salmonella_phage	71.5	5.2e-68
AYB94135.1|3491133_3491427_+	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	99.0	4.2e-50
AYB94136.1|3491423_3492506_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.2	6.5e-80
AYB94137.1|3492450_3492780_+	ASCH domain-containing protein	NA	Q9XJG9	Enterobacteria_phage	94.2	1.0e-52
AYB94138.1|3492861_3493173_+	hypothetical protein	NA	A0A1I9LJL8	Stx_converting_phage	99.0	7.9e-55
AYB95447.1|3493250_3493595_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	97.4	1.1e-57
AYB94139.1|3493597_3493969_+	DNA-binding protein	NA	B9UDM0	Salmonella_phage	80.5	2.1e-46
AYB94140.1|3493824_3494988_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	97.1	1.0e-219
3495006:3495046	attR	GCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGA	NA	NA	NA	NA
>prophage 1
CP032380	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU1-USMARC-69807, complete sequence	96567	37158	65303	96567	transposase,head,integrase,tail	Escherichia_phage(30.0%)	34	43241:43255	66005:66019
AYB95552.1|37158_37863_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB95553.1|38413_39118_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB95554.1|39151_39643_-	hypothetical protein	NA	NA	NA	NA	NA
AYB95555.1|39749_40487_+	resolvase	NA	NA	NA	NA	NA
AYB95556.1|40483_40708_+	hypothetical protein	NA	NA	NA	NA	NA
AYB95557.1|40918_42412_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYB95558.1|42442_43327_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
43241:43255	attL	CGCCAACTCGGCCGC	NA	NA	NA	NA
AYB95559.1|43543_44758_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AYB95560.1|44785_45091_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB95561.1|45357_46557_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AYB95562.1|46635_47313_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYB95563.1|47344_47587_-	relaxase	NA	NA	NA	NA	NA
AYB95564.1|47892_48729_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AYB95565.1|48728_49532_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AYB95566.1|49592_50408_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AYB95567.1|50714_51026_+	hypothetical protein	NA	NA	NA	NA	NA
AYB95568.1|51199_51985_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
AYB95569.1|51988_53170_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
AYB95570.1|53218_53491_+	hypothetical protein	NA	NA	NA	NA	NA
AYB95571.1|53543_54179_-	restriction endonuclease subunit M	NA	NA	NA	NA	NA
AYB95572.1|54740_55118_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
AYB95573.1|55110_55392_+	hypothetical protein	NA	NA	NA	NA	NA
AYB95574.1|55366_56041_+	thymidylate kinase	NA	NA	NA	NA	NA
AYB95626.1|56108_56540_+	hypothetical protein	NA	NA	NA	NA	NA
AYB95575.1|56524_56857_+	hypothetical protein	NA	NA	NA	NA	NA
AYB95576.1|56865_57366_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
AYB95577.1|57369_58797_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
AYB95578.1|58796_59453_+	hypothetical protein	NA	NA	NA	NA	NA
AYB95579.1|59508_60126_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AYB95580.1|60126_60333_+	hypothetical protein	NA	NA	NA	NA	NA
AYB95581.1|60337_60637_+	ASCH domain-containing protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
AYB95582.1|60727_61216_-	hypothetical protein	NA	NA	NA	NA	NA
AYB95583.1|63247_63952_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB95584.1|63998_65303_-|integrase	integrase	integrase	NA	NA	NA	NA
66005:66019	attR	CGCCAACTCGGCCGC	NA	NA	NA	NA
