The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032451	Lactobacillus delbrueckii subsp. bulgaricus strain KLDS1.0207 chromosome, complete genome	1869179	318645	389963	1869179	terminase,holin,integrase,portal,capsid,tRNA	Lactobacillus_phage(82.35%)	77	334927:334942	396213:396228
AYC66140.1|318645_319863_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
AYC66141.1|319865_321023_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X6WFP1	Pacmanvirus	32.9	3.2e-40
AYC66142.1|321108_322827_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
AYC66143.1|323122_323734_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
AYC66144.1|323858_324323_+	DUF1694 domain-containing protein	NA	NA	NA	NA	NA
AYC66145.1|324319_325624_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	52.1	1.2e-107
AYC66146.1|325974_326259_+	hypothetical protein	NA	NA	NA	NA	NA
AYC66147.1|326316_326778_+	universal stress protein	NA	NA	NA	NA	NA
AYC66148.1|326849_328040_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
AYC66149.1|328064_328292_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
AYC66150.1|328304_328592_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	43.4	5.6e-15
AYC66151.1|328594_329584_-	rod shape-determining protein	NA	NA	NA	NA	NA
AYC66152.1|329669_329900_-	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
AYC66153.1|329948_330389_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
AYC66154.1|330400_331840_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
AYC66155.1|331859_332822_-	ATP synthase subunit gamma	NA	NA	NA	NA	NA
AYC66156.1|332832_334344_-	ATP synthase subunit alpha	NA	NA	NA	NA	NA
AYC66157.1|334366_334909_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
AYC66158.1|334908_335415_-	ATP synthase F0 subunit B	NA	NA	NA	NA	NA
334927:334942	attL	AATGAACTGATCAACT	NA	NA	NA	NA
AYC66159.1|335468_335693_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
AYC66160.1|335711_336431_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
AYC66161.1|336540_337170_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AYC66162.1|337269_338265_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	37.5	9.4e-49
AYC66163.1|338264_339107_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AYC66164.1|339099_340185_-	peptide chain release factor 1	NA	NA	NA	NA	NA
AYC66165.1|340208_340811_-	thymidine kinase	NA	C1KFH3	Lactobacillus_virus	49.2	1.7e-45
AYC66166.1|340951_342307_+	Mur ligase family protein	NA	NA	NA	NA	NA
AYC66167.1|342368_342620_-	hypothetical protein	NA	NA	NA	NA	NA
AYC66168.1|342642_343647_-	class A beta-lactamase-related serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	22.2	4.6e-11
AYC66169.1|345682_347023_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYC66170.1|347119_347725_-	VanZ family protein	NA	NA	NA	NA	NA
AYC66171.1|347873_350096_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.1	1.3e-146
AYC66172.1|350142_351708_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.4	9.9e-29
AYC66173.1|351704_352430_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYC66174.1|353182_353512_-	hypothetical protein	NA	U3PBD3	Lactobacillus_phage	100.0	7.8e-53
AYC66175.1|353535_353799_-	hypothetical protein	NA	U3PDM4	Lactobacillus_phage	100.0	2.6e-43
AYC66176.1|353971_354580_-	hypothetical protein	NA	U3PFR8	Lactobacillus_phage	100.0	2.4e-116
AYC66177.1|354691_355576_-	lysin	NA	U3PCM2	Lactobacillus_phage	100.0	5.0e-155
AYC66178.1|355565_355889_-|holin	phage holin	holin	U3PBD0	Lactobacillus_phage	100.0	3.8e-52
AYC66179.1|355866_356196_-	hypothetical protein	NA	U3PDL9	Lactobacillus_phage	98.9	5.6e-35
AYC66180.1|356198_356621_-	hypothetical protein	NA	U3PIR7	Lactobacillus_phage	100.0	1.2e-74
AYC67437.1|356755_357052_-	hypothetical protein	NA	U3PCL7	Lactobacillus_phage	99.0	4.6e-44
AYC67438.1|357204_358521_-	hypothetical protein	NA	U3PBC7	Lactobacillus_phage	100.0	1.1e-222
AYC66181.1|360720_363117_-	hypothetical protein	NA	U3PBG0	Lactobacillus_phage	100.0	0.0e+00
AYC66182.1|363116_365006_-	hypothetical protein	NA	U3PDQ7	Lactobacillus_phage	100.0	0.0e+00
AYC67439.1|365015_366098_-	hypothetical protein	NA	U3PIV2	Lactobacillus_phage	100.0	7.7e-206
AYC66183.1|369005_369548_-	hypothetical protein	NA	U3PFU8	Lactobacillus_phage	100.0	2.2e-100
AYC66184.1|369582_370026_-	hypothetical protein	NA	U3PCQ6	Lactobacillus_phage	100.0	3.0e-71
AYC66185.1|370082_370574_-	hypothetical protein	NA	U3PBF6	Lactobacillus_phage	100.0	2.6e-76
AYC67440.1|370578_370920_-|capsid	minor capsid protein	capsid	U3PDQ2	Lactobacillus_phage	100.0	2.4e-60
AYC66186.1|370981_371323_-	hypothetical protein	NA	U3PIU9	Lactobacillus_phage	100.0	4.4e-59
AYC66187.1|371322_371679_-	hypothetical protein	NA	U3PFU5	Lactobacillus_phage	100.0	9.7e-65
AYC66188.1|371675_372107_-	hypothetical protein	NA	U3PCQ2	Lactobacillus_phage	100.0	7.3e-75
AYC66189.1|372084_372300_-	hypothetical protein	NA	U3PBF1	Lactobacillus_phage	100.0	2.0e-33
AYC66190.1|372299_373160_-|capsid	capsid protein	capsid	U3PDP8	Lactobacillus_phage	100.0	1.5e-159
AYC66191.1|373164_373701_-	hypothetical protein	NA	U3PIU5	Lactobacillus_phage	100.0	6.5e-81
AYC66192.1|373763_374891_-|capsid	minor capsid protein	capsid	U3PFU0	Lactobacillus_phage	100.0	6.8e-213
AYC66193.1|374893_376411_-|portal	phage portal protein	portal	U3PCP8	Lactobacillus_phage	100.0	5.2e-293
AYC66194.1|376421_377723_-|terminase	PBSX family phage terminase large subunit	terminase	U3PBE8	Lactobacillus_phage	100.0	2.2e-263
AYC66195.1|377712_378141_-|terminase	terminase small subunit	terminase	U3PDP3	Lactobacillus_phage	100.0	3.4e-72
AYC66196.1|378662_379157_-	hypothetical protein	NA	U3PIU0	Lactobacillus_phage	100.0	1.2e-92
AYC66197.1|379833_380097_-	hypothetical protein	NA	U3PBE5	Lactobacillus_phage	100.0	5.0e-50
AYC66198.1|380086_380419_-	VRR-NUC domain-containing protein	NA	U3PDN9	Lactobacillus_phage	100.0	6.2e-58
AYC66199.1|380421_380601_-	hypothetical protein	NA	U3PIT4	Lactobacillus_phage	100.0	1.1e-27
AYC66200.1|380604_380829_-	hypothetical protein	NA	U3PFT2	Lactobacillus_phage	100.0	7.0e-37
AYC66201.1|381082_382399_-	hypothetical protein	NA	U3PCP1	Lactobacillus_phage	100.0	2.0e-256
AYC66202.1|382391_383177_-	DNA primase	NA	U3PBE3	Lactobacillus_phage	100.0	2.4e-148
AYC66203.1|383188_383758_-	hypothetical protein	NA	U3PDN3	Lactobacillus_phage	100.0	3.4e-104
AYC66204.1|383774_384467_-	NTP-binding protein	NA	U3PIS9	Lactobacillus_phage	100.0	1.5e-130
AYC66205.1|384466_385864_-	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	100.0	4.5e-267
AYC66206.1|385827_386115_-	hypothetical protein	NA	U3PCN4	Lactobacillus_phage	100.0	6.2e-46
AYC66207.1|386483_387233_-	phage antirepressor Ant	NA	U3PBD7	Lactobacillus_phage	100.0	2.5e-139
AYC66208.1|387235_387406_-	DNA-binding protein	NA	Q14T69	Lactococcus_phage	82.1	2.0e-20
AYC66209.1|387439_387634_-	XRE family transcriptional regulator	NA	U3PDM7	Lactobacillus_phage	100.0	1.8e-28
AYC66210.1|387790_388456_+	LexA family transcriptional regulator	NA	U3PIS7	Lactobacillus_phage	100.0	5.9e-124
AYC67441.1|388634_388844_+	hypothetical protein	NA	U3PFS2	Lactobacillus_phage	98.6	2.7e-35
AYC66211.1|388856_389963_+|integrase	site-specific integrase	integrase	U3PCM7	Lactobacillus_phage	100.0	7.3e-212
396213:396228	attR	AGTTGATCAGTTCATT	NA	NA	NA	NA
>prophage 2
CP032451	Lactobacillus delbrueckii subsp. bulgaricus strain KLDS1.0207 chromosome, complete genome	1869179	629765	696484	1869179	tRNA,protease,bacteriocin,transposase	Tupanvirus(15.79%)	56	NA	NA
AYC66443.1|629765_630782_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.7	2.9e-45
AYC66444.1|630967_631528_+	hypothetical protein	NA	NA	NA	NA	NA
AYC66445.1|631595_635261_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.7	4.6e-69
AYC67455.1|635276_638942_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	25.0	9.7e-51
AYC66446.1|639152_639314_-	hypothetical protein	NA	NA	NA	NA	NA
AYC66447.1|639313_639502_-	hypothetical protein	NA	NA	NA	NA	NA
AYC66448.1|639526_641986_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	32.8	3.3e-119
AYC66449.1|642009_642471_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AYC66450.1|643076_643703_+	DUF5052 family protein	NA	A0A2K9VCV0	Lactobacillus_phage	44.1	6.3e-43
AYC66451.1|645318_645537_-	hypothetical protein	NA	NA	NA	NA	NA
AYC66452.1|645667_645802_-	diguanylate cyclase	NA	NA	NA	NA	NA
AYC66453.1|645802_646558_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	32.4	1.7e-05
AYC66454.1|646575_647010_-	hypothetical protein	NA	NA	NA	NA	NA
AYC66455.1|647131_648637_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.5	1.7e-86
AYC66456.1|648653_649688_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AYC66457.1|649801_651088_-	peptidase T	NA	NA	NA	NA	NA
AYC66458.1|651097_652723_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYC66459.1|653176_654058_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
AYC66460.1|654102_656316_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	40.9	2.8e-109
AYC66461.1|656386_657682_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	R4TVK3	Phaeocystis_globosa_virus	28.5	4.8e-13
AYC66462.1|657729_658083_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
AYC66463.1|658082_658463_-	septum formation initiator family protein	NA	NA	NA	NA	NA
AYC66464.1|658528_658771_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
AYC66465.1|658839_662316_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AYC66466.1|662332_662890_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AYC66467.1|663113_663812_+	CBS domain-containing protein	NA	NA	NA	NA	NA
AYC66468.1|663865_664996_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.6e-23
AYC66469.1|664992_665406_-	holo-ACP synthase	NA	NA	NA	NA	NA
AYC66470.1|665490_666942_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.2	3.0e-64
AYC66471.1|666951_668319_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AYC66472.1|668426_668678_-	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AYC66473.1|668777_670049_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AYC66474.1|670168_671788_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.2	4.5e-133
AYC66475.1|671904_672471_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
AYC66476.1|672516_672915_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
AYC66477.1|673054_674368_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	35.6	1.6e-32
AYC66478.1|674439_675420_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.1	2.1e-45
AYC66479.1|675649_676390_-	hypothetical protein	NA	NA	NA	NA	NA
AYC66480.1|676559_677945_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	34.0	3.6e-30
AYC66481.1|678006_678837_-	pur operon repressor	NA	NA	NA	NA	NA
AYC66482.1|678942_679194_-	hypothetical protein	NA	NA	NA	NA	NA
AYC66483.1|679253_680144_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
AYC66484.1|680118_680691_-	ribonuclease M5	NA	NA	NA	NA	NA
AYC66485.1|680674_681454_-	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
AYC66486.1|681453_683436_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.0	2.9e-94
AYC66487.1|683571_686262_-	magnesium-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	25.3	1.5e-40
AYC66488.1|686620_687235_-	methanol dehydrogenase	NA	NA	NA	NA	NA
AYC66489.1|687215_687698_-	competence protein ComE	NA	A7KUY9	Bacillus_phage	55.5	5.4e-34
AYC66490.1|687699_688725_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AYC66491.1|689045_689714_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYC66492.1|691356_691641_-	hypothetical protein	NA	NA	NA	NA	NA
AYC66493.1|691662_691908_-	arginine deiminase	NA	NA	NA	NA	NA
AYC66494.1|692728_693529_+	ABC transporter permease	NA	NA	NA	NA	NA
AYC66495.1|693530_694151_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYC66496.1|694628_694916_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYC66497.1|695185_696484_-|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	39.0	3.9e-71
>prophage 3
CP032451	Lactobacillus delbrueckii subsp. bulgaricus strain KLDS1.0207 chromosome, complete genome	1869179	713800	731179	1869179		Phaeocystis_globosa_virus(16.67%)	16	NA	NA
AYC67456.1|713800_715411_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	27.2	2.4e-17
AYC66512.1|715559_717113_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.2	3.5e-18
AYC66513.1|717112_718270_-	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	38.6	1.2e-47
AYC66514.1|718624_719194_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AYC66515.1|719223_720516_+	purine permease	NA	Q9KX94	Enterobacteria_phage	30.7	8.2e-29
AYC66516.1|720585_720945_-	hypothetical protein	NA	E3W8I0	Leuconostoc_phage	34.8	7.8e-06
AYC66517.1|720937_722245_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	40.6	3.0e-87
AYC66518.1|722373_723366_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	68.4	1.8e-132
AYC66519.1|723551_724841_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	38.4	3.2e-73
AYC66520.1|724924_725386_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
AYC66521.1|725613_726039_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AYC66522.1|726135_727449_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.5	1.2e-62
AYC66523.1|727500_728814_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.7	3.3e-62
AYC66524.1|728984_729086_-	DUF975 family protein	NA	NA	NA	NA	NA
AYC66525.1|729167_730121_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	4.6e-21
AYC66526.1|730135_731179_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	4.7e-19
>prophage 4
CP032451	Lactobacillus delbrueckii subsp. bulgaricus strain KLDS1.0207 chromosome, complete genome	1869179	973136	981577	1869179	transposase	Planktothrix_phage(33.33%)	9	NA	NA
AYC66710.1|973136_974447_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.5	2.2e-50
AYC66711.1|974665_975412_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-27
AYC66712.1|975431_976892_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
AYC66713.1|977183_977882_-	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	47.9	1.8e-54
AYC66714.1|977899_978547_-	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	48.8	1.2e-49
AYC66715.1|978758_979277_+	hypothetical protein	NA	NA	NA	NA	NA
AYC66716.1|979278_979932_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.2	6.2e-25
AYC66717.1|979959_980262_+	hypothetical protein	NA	NA	NA	NA	NA
AYC67471.1|980326_981577_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.8	2.5e-51
>prophage 5
CP032451	Lactobacillus delbrueckii subsp. bulgaricus strain KLDS1.0207 chromosome, complete genome	1869179	1134649	1140432	1869179		Streptomyces_phage(42.86%)	7	NA	NA
AYC66843.1|1134649_1135192_+	guanylate kinase	NA	U5J9X2	Bacillus_phage	35.4	1.7e-12
AYC66844.1|1135316_1135802_+	NlpC/P60 family protein	NA	A0A2L1IW19	Streptomyces_phage	41.1	2.3e-16
AYC66845.1|1136085_1137132_+	lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	29.4	1.8e-26
AYC66846.1|1137301_1137775_+	NlpC/P60 family protein	NA	A0A2L1IW19	Streptomyces_phage	42.7	4.2e-15
AYC66847.1|1137963_1138746_+	NlpC/P60 family protein	NA	A0A2L1IW19	Streptomyces_phage	42.7	1.0e-13
AYC66848.1|1138899_1139607_+	NlpC/P60 family protein	NA	A0A0A8WF62	Clostridium_phage	38.9	1.1e-14
AYC66849.1|1139652_1140432_+	hydrolase	NA	A0A1V0DZX6	Clostridioides_phage	36.9	1.1e-07
>prophage 6
CP032451	Lactobacillus delbrueckii subsp. bulgaricus strain KLDS1.0207 chromosome, complete genome	1869179	1588022	1596594	1869179		Prochlorococcus_phage(33.33%)	8	NA	NA
AYC67205.1|1588022_1589318_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	1.4e-20
AYC67206.1|1589641_1590364_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	36.8	1.3e-36
AYC67207.1|1590368_1590617_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AYC67208.1|1590616_1591291_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYC67209.1|1591290_1593513_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	1.1e-142
AYC67210.1|1593488_1594967_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.2	3.9e-51
AYC67496.1|1594969_1596013_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.3	8.3e-64
AYC67211.1|1596012_1596594_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.4	1.1e-25
>prophage 7
CP032451	Lactobacillus delbrueckii subsp. bulgaricus strain KLDS1.0207 chromosome, complete genome	1869179	1742600	1820130	1869179	tRNA,protease,transposase,integrase	Streptococcus_phage(20.0%)	60	1783713:1783772	1809777:1809850
AYC67329.1|1742600_1743500_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	39.8	1.2e-50
AYC67330.1|1743580_1744771_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	48.2	1.4e-43
AYC67331.1|1744796_1745459_-	hemolysin III family protein	NA	NA	NA	NA	NA
AYC67332.1|1745593_1746439_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	45.0	1.0e-19
AYC67333.1|1746442_1746673_+	YozE family protein	NA	NA	NA	NA	NA
AYC67334.1|1746747_1747605_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
AYC67335.1|1747594_1748365_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	37.2	5.6e-25
AYC67336.1|1748462_1749302_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	37.6	4.1e-29
AYC67337.1|1749428_1751612_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	34.8	2.7e-93
AYC67338.1|1751743_1753063_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
AYC67339.1|1753062_1753950_+	tyrosine recombinase XerC	NA	S5W9T9	Leptospira_phage	30.2	1.4e-24
AYC67340.1|1754059_1754593_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
AYC67341.1|1754595_1755990_+	HslU--HslV peptidase ATPase subunit	NA	A0A1B2IB03	Erwinia_phage	26.2	8.5e-32
AYC67342.1|1756071_1756968_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
AYC67343.1|1757291_1757516_+	hypothetical protein	NA	NA	NA	NA	NA
AYC67344.1|1757915_1758611_+	hypothetical protein	NA	NA	NA	NA	NA
AYC67345.1|1758967_1760278_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
AYC67346.1|1760459_1761644_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYC67347.1|1761885_1762197_+	hypothetical protein	NA	NA	NA	NA	NA
AYC67348.1|1762205_1762406_+	hypothetical protein	NA	NA	NA	NA	NA
AYC67349.1|1762402_1763245_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AYC67350.1|1763551_1764436_+	YitT family protein	NA	NA	NA	NA	NA
AYC67351.1|1764552_1764774_+	hypothetical protein	NA	NA	NA	NA	NA
AYC67352.1|1764833_1765691_-	pyruvate, phosphate dikinase regulatory protein	NA	NA	NA	NA	NA
AYC67353.1|1765860_1766037_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AYC67354.1|1766190_1767138_+	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	48.8	4.0e-49
AYC67355.1|1767137_1767662_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
AYC67356.1|1767663_1768083_+	cytidine deaminase	NA	NA	NA	NA	NA
AYC67357.1|1768066_1768972_+	GTPase Era	NA	NA	NA	NA	NA
AYC67358.1|1768971_1769721_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AYC67359.1|1769985_1770897_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AYC67360.1|1770889_1772956_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYC67361.1|1772987_1774826_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.7	2.4e-58
AYC67362.1|1774797_1775916_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	2.4e-37
AYC67363.1|1777113_1778250_+	sigma-70 family RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	35.9	1.6e-36
AYC67507.1|1780290_1782528_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.2	2.4e-60
1783713:1783772	attL	GCAGCCAGCTCAGTCTTCTTGTATCCAGTTCTAGAGTAGAGCGAATCGTCAAAGACGAAG	NA	NA	NA	NA
AYC67364.1|1786419_1786767_+	hypothetical protein	NA	NA	NA	NA	NA
AYC67365.1|1787042_1788266_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.0	3.0e-97
AYC67366.1|1788474_1788936_+	hypothetical protein	NA	NA	NA	NA	NA
AYC67367.1|1789205_1789445_+	XRE family transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	55.9	3.6e-15
AYC67368.1|1789478_1791503_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	29.0	1.1e-19
AYC67369.1|1791502_1792849_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AYC67370.1|1792851_1795944_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
AYC67371.1|1796902_1797292_+	hypothetical protein	NA	NA	NA	NA	NA
AYC67372.1|1797381_1797825_+	hypothetical protein	NA	NA	NA	NA	NA
AYC67373.1|1797905_1798778_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYC67374.1|1800667_1801723_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	46.0	1.8e-18
AYC67375.1|1801768_1802596_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
AYC67376.1|1802595_1803036_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
AYC67377.1|1803179_1803872_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYC67378.1|1803864_1804662_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AYC67379.1|1804705_1805944_+	peptidase T	NA	NA	NA	NA	NA
AYC67380.1|1806334_1806520_-	hypothetical protein	NA	NA	NA	NA	NA
AYC67381.1|1806589_1807156_-	signal peptidase I	NA	NA	NA	NA	NA
AYC67382.1|1807198_1808035_-|integrase	integrase	integrase	NA	NA	NA	NA
AYC67383.1|1808214_1808526_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYC67384.1|1810799_1812023_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	1.6e-98
1809777:1809850	attR	CTTCGTCTTTGACGATTCGCTCTACTCTAGAACTGGATACAAGAAGACTGAGCTGGCTGCCAAAGTATTCGACC	NA	NA	NA	NA
AYC67385.1|1812638_1814522_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AYC67386.1|1814525_1817552_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	32.9	1.3e-141
AYC67387.1|1818825_1820130_+|transposase	ISL3-like element ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.0	1.4e-57
