The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022924	Klebsiella pneumoniae strain ST307PT01 chromosome, complete genome	5330228	444814	514373	5330228	capsid,tRNA,integrase,portal,tail,head,terminase,protease	uncultured_Caudovirales_phage(61.11%)	76	462601:462618	478596:478613
AYD32743.1|444814_445762_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AYD32744.1|445776_446286_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.5	4.4e-18
AYD32745.1|446414_447539_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AYD32746.1|447510_447984_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AYD32747.1|448010_448553_+	hypothetical protein	NA	NA	NA	NA	NA
AYD32748.1|448557_449130_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AYD32749.1|449133_449952_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AYD32750.1|449948_450206_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AYD32751.1|450181_450736_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AYD32752.1|450938_451121_+	hypothetical protein	NA	NA	NA	NA	NA
AYD32753.1|456514_456742_+	hypothetical protein	NA	NA	NA	NA	NA
AYD32754.1|456710_456932_-	hypothetical protein	NA	NA	NA	NA	NA
AYD32755.1|457224_460335_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AYD32756.1|460347_461487_-	MexX family efflux pump subunit	NA	NA	NA	NA	NA
AYD32757.1|461865_462519_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
462601:462618	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AYD32758.1|462791_464018_+|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AYD32759.1|464110_465052_+	hypothetical protein	NA	NA	NA	NA	NA
AYD32760.1|465233_465518_+	transcriptional regulator	NA	NA	NA	NA	NA
AYD32761.1|465528_466308_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AYD32762.1|466431_466626_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AYD37125.1|466849_467029_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.9	2.6e-26
AYD32763.1|467021_467210_+	hypothetical protein	NA	NA	NA	NA	NA
AYD32764.1|467202_467517_+	hypothetical protein	NA	NA	NA	NA	NA
AYD32765.1|467513_467882_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AYD32766.1|467878_468244_+	hypothetical protein	NA	NA	NA	NA	NA
AYD32767.1|468243_470379_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AYD32768.1|470721_471057_+	hypothetical protein	NA	NA	NA	NA	NA
AYD32769.1|471105_471618_-	hypothetical protein	NA	NA	NA	NA	NA
AYD32770.1|471881_473048_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AYD32771.1|473099_473660_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AYD32772.1|473661_474903_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AYD32773.1|474899_475235_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AYD32774.1|475231_475531_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AYD32775.1|475530_475974_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AYD32776.1|476100_476292_+|terminase	terminase	terminase	NA	NA	NA	NA
AYD32777.1|476249_476606_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AYD32778.1|476589_478251_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AYD32779.1|478253_478445_+	hypothetical protein	NA	NA	NA	NA	NA
AYD32780.1|478598_478895_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
478596:478613	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AYD32781.1|478919_479885_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AYD32782.1|480042_480237_-	hypothetical protein	NA	NA	NA	NA	NA
AYD32783.1|481134_482586_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AYD32784.1|482575_482818_-	hypothetical protein	NA	NA	NA	NA	NA
AYD32785.1|482928_484278_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AYD32786.1|484288_484756_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
AYD32787.1|484778_485231_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AYD32788.1|485454_486063_-	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AYD32789.1|486062_487064_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AYD32790.1|487292_487484_+	hypothetical protein	NA	NA	NA	NA	NA
AYD32791.1|487563_489504_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AYD32792.1|489625_489832_-	hypothetical protein	NA	NA	NA	NA	NA
AYD32793.1|489809_490853_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AYD32794.1|490923_491916_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AYD32795.1|491915_492404_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AYD32796.1|492411_492993_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AYD32797.1|492995_494465_+	ribonuclease E/G	NA	NA	NA	NA	NA
AYD32798.1|494502_498303_+	TIGR02099 family protein	NA	NA	NA	NA	NA
AYD32799.1|498391_499837_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AYD32800.1|499872_500802_-	transcriptional regulator	NA	NA	NA	NA	NA
AYD32801.1|500933_501137_+	protein AaeX	NA	NA	NA	NA	NA
AYD32802.1|501144_502077_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AYD32803.1|502082_504050_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AYD32804.1|504129_504405_+	hypothetical protein	NA	NA	NA	NA	NA
AYD32805.1|504455_504722_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYD32806.1|504820_505084_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYD32807.1|505459_505930_-	arginine repressor	NA	NA	NA	NA	NA
AYD32808.1|506344_507283_+	malate dehydrogenase	NA	NA	NA	NA	NA
AYD32809.1|507419_508478_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AYD32810.1|508565_509933_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AYD32811.1|510106_510505_-	hypothetical protein	NA	NA	NA	NA	NA
AYD32812.1|510695_511823_+	cell division protein ZapE	NA	NA	NA	NA	NA
AYD32813.1|512088_512517_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AYD32814.1|512532_512925_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AYD32815.1|513034_513238_-	hypothetical protein	NA	NA	NA	NA	NA
AYD32816.1|513236_513875_+	stringent starvation protein A	NA	NA	NA	NA	NA
AYD32817.1|513878_514373_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
CP022924	Klebsiella pneumoniae strain ST307PT01 chromosome, complete genome	5330228	660752	685622	5330228	capsid,transposase,portal,integrase,tail,head,terminase	uncultured_Caudovirales_phage(68.75%)	25	666155:666202	682973:683020
AYD32961.1|660752_663995_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.9	6.6e-35
AYD32962.1|663999_664614_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYD37130.1|664966_665281_+	HdeB family protein	NA	NA	NA	NA	NA
AYD32963.1|665349_665622_-	hypothetical protein	NA	NA	NA	NA	NA
666155:666202	attL	TTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGT	NA	NA	NA	NA
AYD32964.1|666381_667806_+|integrase	integrase	integrase	H7BV31	unidentified_phage	27.2	1.1e-07
AYD32965.1|667798_668632_+	hypothetical protein	NA	NA	NA	NA	NA
AYD32966.1|668773_668983_+	DNA-binding protein	NA	NA	NA	NA	NA
AYD32967.1|668993_669944_+	hypothetical protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	36.6	4.4e-40
AYD32968.1|669936_670134_+	hypothetical protein	NA	NA	NA	NA	NA
AYD32969.1|670126_670354_+	aminotransferase	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	89.2	1.6e-28
AYD32970.1|670350_670719_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	98.4	1.8e-61
AYD32971.1|670715_672080_+	hypothetical protein	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	97.1	5.8e-259
AYD32972.1|672433_672670_+	hypothetical protein	NA	NA	NA	NA	NA
AYD32973.1|673243_674260_-|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AYD32974.1|674942_676103_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	94.8	1.8e-205
AYD32975.1|676154_676715_+	peptidase	NA	A0A2H4JB68	uncultured_Caudovirales_phage	93.0	4.4e-96
AYD37131.1|676725_677952_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	95.3	1.5e-229
AYD32976.1|677948_678290_+|head,tail	head-tail adaptor	head,tail	A0A286S2A2	Klebsiella_phage	46.1	6.3e-21
AYD32977.1|678282_678576_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	85.6	3.8e-43
AYD32978.1|678575_679019_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	88.4	1.5e-75
AYD32979.1|679293_679650_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	97.4	1.6e-59
AYD32980.1|679633_681295_+|terminase	terminase	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.8	0.0e+00
AYD32981.1|681410_682862_+	AAA family ATPase	NA	NA	NA	NA	NA
AYD32982.1|683174_683681_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
682973:683020	attR	TTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGT	NA	NA	NA	NA
AYD32983.1|683780_685622_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
>prophage 3
CP022924	Klebsiella pneumoniae strain ST307PT01 chromosome, complete genome	5330228	1469858	1567347	5330228	capsid,tRNA,holin,portal,integrase,plate,tail,head,terminase,protease	Escherichia_phage(18.75%)	92	1505064:1505088	1544596:1544620
AYD33685.1|1469858_1471208_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AYD33686.1|1471892_1473569_+	OmpA family protein	NA	NA	NA	NA	NA
AYD33687.1|1473571_1474063_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AYD37154.1|1476849_1477392_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AYD33688.1|1477465_1477936_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AYD37155.1|1478278_1480681_+	hypothetical protein	NA	NA	NA	NA	NA
AYD33689.1|1480677_1481121_+	hypothetical protein	NA	NA	NA	NA	NA
AYD33690.1|1481278_1481662_+	DUF4087 domain-containing protein	NA	NA	NA	NA	NA
AYD33691.1|1481763_1482132_+	hypothetical protein	NA	NA	NA	NA	NA
AYD33692.1|1482778_1483078_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AYD37156.1|1483140_1483404_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	50.0	1.2e-06
AYD33693.1|1483406_1484615_+	hypothetical protein	NA	NA	NA	NA	NA
AYD33694.1|1484607_1487979_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
AYD33695.1|1488471_1490079_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AYD33696.1|1490112_1491882_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYD33697.1|1491845_1492928_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYD33698.1|1492963_1493488_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AYD33699.1|1493492_1495814_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	2.7e-14
AYD33700.1|1495810_1496314_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.0	1.5e-18
AYD33701.1|1496307_1496652_+	hypothetical protein	NA	NA	NA	NA	NA
AYD37157.1|1496684_1497422_+	hypothetical protein	NA	NA	NA	NA	NA
AYD37158.1|1497664_1498147_+	hypothetical protein	NA	NA	NA	NA	NA
AYD33702.1|1500030_1500915_+	glycine zipper family protein	NA	NA	NA	NA	NA
AYD33703.1|1501056_1501461_+	hypothetical protein	NA	NA	NA	NA	NA
AYD33704.1|1501968_1502367_+	hypothetical protein	NA	NA	NA	NA	NA
AYD33705.1|1503601_1504135_+	hypothetical protein	NA	NA	NA	NA	NA
1505064:1505088	attL	TTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
AYD33706.1|1505282_1506452_+|integrase	integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	86.1	1.9e-202
AYD33707.1|1506826_1507399_+	hypothetical protein	NA	NA	NA	NA	NA
AYD33708.1|1507500_1507701_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	60.0	1.8e-12
AYD33709.1|1507708_1508512_-	hypothetical protein	NA	NA	NA	NA	NA
AYD33710.1|1508508_1509024_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.4	2.9e-70
AYD33711.1|1509023_1509407_-	hypothetical protein	NA	NA	NA	NA	NA
AYD33712.1|1509399_1510476_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.4	2.8e-147
AYD33713.1|1510603_1511389_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	2.9e-61
AYD33714.1|1511388_1511688_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	48.6	1.1e-13
AYD33715.1|1512316_1513012_-	transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	2.7e-87
AYD33716.1|1513109_1513352_+	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
AYD33717.1|1513386_1513848_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
AYD33718.1|1514085_1514265_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
AYD33719.1|1514254_1515208_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	69.0	6.1e-90
AYD33720.1|1515204_1516014_+	DNA methylase	NA	A0A1C9II58	Salmonella_phage	68.9	2.9e-109
AYD33721.1|1516023_1516401_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
AYD33722.1|1516413_1517394_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.5	7.6e-136
AYD33723.1|1517407_1517986_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
AYD33724.1|1518205_1518631_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	83.7	1.9e-59
AYD33725.1|1519281_1519677_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
AYD33726.1|1519663_1519945_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
AYD33727.1|1519944_1520574_+	endolysin	NA	G8C7W0	Escherichia_phage	90.9	1.2e-105
AYD33728.1|1520581_1520857_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	66.3	1.9e-23
AYD33729.1|1520807_1521002_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	83.6	2.7e-21
AYD33730.1|1521058_1521718_-	hypothetical protein	NA	NA	NA	NA	NA
AYD33731.1|1521917_1522268_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	73.7	3.4e-46
AYD33732.1|1522426_1522924_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	2.5e-63
AYD33733.1|1522927_1524679_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.2	6.7e-252
AYD33734.1|1524826_1526053_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
AYD33735.1|1526045_1526645_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	83.0	1.0e-90
AYD33736.1|1526654_1527893_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
AYD33737.1|1527970_1528288_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	4.8e-23
AYD33738.1|1528296_1528635_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	67.9	3.3e-38
AYD33739.1|1528631_1529081_+	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
AYD33740.1|1529077_1529425_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
AYD33741.1|1529481_1530186_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.5	9.5e-80
AYD33742.1|1530216_1530621_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.2	1.9e-32
AYD33743.1|1530623_1530929_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
AYD33744.1|1531002_1531236_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
AYD33745.1|1531297_1534684_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.5	4.0e-301
AYD33746.1|1534705_1535179_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
AYD33747.1|1535165_1535642_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	64.6	5.3e-50
AYD33748.1|1535654_1536035_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	83.3	2.0e-60
AYD33749.1|1541792_1542887_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.5	1.4e-178
AYD33750.1|1542921_1544022_-	acyltransferase	NA	C6ZR20	Salmonella_phage	27.2	1.8e-05
AYD33751.1|1544177_1544498_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	1.1e-22
AYD33752.1|1544708_1545638_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
1544596:1544620	attR	TTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
AYD33753.1|1545927_1546689_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AYD33754.1|1546750_1548079_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AYD33755.1|1548446_1548731_+	hypothetical protein	NA	NA	NA	NA	NA
AYD33756.1|1548890_1550201_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AYD33757.1|1550200_1552345_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AYD33758.1|1552554_1553040_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AYD33759.1|1553059_1553611_-	endonuclease SmrB	NA	NA	NA	NA	NA
AYD33760.1|1553778_1554711_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AYD33761.1|1554751_1555837_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
AYD33762.1|1556662_1557472_+	hypothetical protein	NA	NA	NA	NA	NA
AYD33763.1|1557471_1558020_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AYD37159.1|1558051_1558333_+	hypothetical protein	NA	NA	NA	NA	NA
AYD33764.1|1558394_1560383_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AYD33765.1|1560541_1561762_+	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AYD33766.1|1561971_1563147_+	arabinose transporter	NA	NA	NA	NA	NA
AYD33767.1|1563233_1564211_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AYD33768.1|1564321_1565458_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
AYD33769.1|1565521_1566535_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYD33770.1|1566534_1567347_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 4
CP022924	Klebsiella pneumoniae strain ST307PT01 chromosome, complete genome	5330228	2740423	2751310	5330228		Escherichia_phage(87.5%)	9	NA	NA
AYD34826.1|2740423_2743531_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AYD34827.1|2743585_2744851_+	MFS transporter	NA	NA	NA	NA	NA
AYD34828.1|2744881_2745970_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	1.8e-210
AYD34829.1|2746056_2746317_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AYD34830.1|2746614_2747475_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
AYD34831.1|2747495_2748257_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AYD34832.1|2748517_2749420_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AYD34833.1|2749431_2750697_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
AYD34834.1|2750689_2751310_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
CP022924	Klebsiella pneumoniae strain ST307PT01 chromosome, complete genome	5330228	3421070	3430544	5330228	tRNA,protease	Brazilian_cedratvirus(16.67%)	9	NA	NA
AYD35427.1|3421070_3422792_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AYD35428.1|3422836_3423538_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYD35429.1|3423891_3424110_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYD35430.1|3424240_3426520_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AYD35431.1|3426550_3426868_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AYD35432.1|3427193_3427415_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AYD35433.1|3427369_3427552_-	hypothetical protein	NA	NA	NA	NA	NA
AYD35434.1|3427491_3429432_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	41.0	5.0e-38
AYD35435.1|3429428_3430544_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 6
CP022924	Klebsiella pneumoniae strain ST307PT01 chromosome, complete genome	5330228	3914054	3967732	5330228	tRNA,holin,lysis,integrase,tail,head,terminase,protease	Salmonella_phage(34.78%)	75	3913419:3913464	3954980:3955025
3913419:3913464	attL	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AYD35847.1|3914054_3915149_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.3	1.2e-177
AYD35848.1|3917869_3918643_-	hypothetical protein	NA	A0A248SL44	Klebsiella_phage	43.8	3.1e-31
AYD35849.1|3918642_3919416_-	hypothetical protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	52.9	5.3e-68
AYD35850.1|3919412_3920612_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	75.1	1.3e-161
AYD35851.1|3920611_3920965_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	1.3e-50
AYD35852.1|3920966_3921620_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	56.7	4.7e-73
AYD35853.1|3921686_3922055_-	hypothetical protein	NA	NA	NA	NA	NA
AYD35854.1|3922064_3922310_-	hypothetical protein	NA	NA	NA	NA	NA
AYD35855.1|3922306_3922867_-	hypothetical protein	NA	NA	NA	NA	NA
AYD35856.1|3922984_3923326_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	65.8	2.4e-20
AYD35857.1|3923322_3924390_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	68.5	3.4e-137
AYD37264.1|3924392_3924620_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.0	5.6e-18
AYD35858.1|3924695_3925274_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	66.0	6.6e-63
AYD35859.1|3925270_3927187_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	57.9	6.1e-198
AYD37265.1|3927176_3927353_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	67.3	2.7e-12
AYD35860.1|3927364_3927793_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.3	8.1e-42
AYD35861.1|3927796_3928240_-	DUF3277 domain-containing protein	NA	A0A0M5M1K6	Salmonella_phage	79.3	1.6e-61
AYD35862.1|3928249_3929395_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.4	6.3e-166
AYD35863.1|3929398_3929839_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AYD35864.1|3929933_3930320_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
AYD35865.1|3930319_3930934_-	hypothetical protein	NA	NA	NA	NA	NA
AYD35866.1|3930930_3931350_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	2.6e-40
AYD35867.1|3931318_3931600_-	hypothetical protein	NA	NA	NA	NA	NA
AYD35868.1|3931639_3932581_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.4	1.3e-137
AYD35869.1|3932592_3933087_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.1	1.2e-49
AYD35870.1|3933090_3934293_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	55.7	8.8e-110
AYD35871.1|3934302_3934497_-	hypothetical protein	NA	NA	NA	NA	NA
AYD37266.1|3934542_3935091_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
AYD35872.1|3935146_3936598_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AYD35873.1|3936836_3938237_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	2.1e-187
AYD37267.1|3938187_3938964_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	67.9	6.4e-13
AYD35874.1|3939036_3939528_+	hypothetical protein	NA	NA	NA	NA	NA
AYD35875.1|3939614_3939857_-	DUF1378 domain-containing protein	NA	NA	NA	NA	NA
AYD35876.1|3939868_3940339_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	59.1	2.8e-43
AYD37268.1|3940335_3940833_-	lysozyme	NA	K7P7Q3	Enterobacteria_phage	83.6	4.8e-78
AYD35877.1|3940810_3941080_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
AYD35878.1|3941530_3942109_-	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	56.7	4.2e-49
AYD35879.1|3942105_3942765_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	80.0	6.3e-102
AYD35880.1|3942757_3943066_-	hypothetical protein	NA	Q6V7S4	Burkholderia_virus	57.6	2.1e-23
AYD35881.1|3943306_3943576_-	hypothetical protein	NA	H6WRY4	Salmonella_phage	80.7	3.5e-35
AYD35882.1|3943622_3944018_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	77.9	8.0e-52
AYD35883.1|3944007_3945039_-	hypothetical protein	NA	S4TSR6	Salmonella_phage	62.2	3.3e-57
AYD35884.1|3945035_3945263_-	hypothetical protein	NA	NA	NA	NA	NA
AYD35885.1|3945262_3945853_-	hypothetical protein	NA	NA	NA	NA	NA
AYD35886.1|3945806_3946598_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	52.9	1.1e-65
AYD35887.1|3946590_3946812_-	hypothetical protein	NA	NA	NA	NA	NA
AYD35888.1|3946811_3947207_-	hypothetical protein	NA	NA	NA	NA	NA
AYD35889.1|3947233_3948262_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	51.5	2.6e-30
AYD35890.1|3948258_3948513_-	hypothetical protein	NA	NA	NA	NA	NA
AYD35891.1|3948526_3948952_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AYD35892.1|3948955_3949207_-	transcriptional regulator	NA	NA	NA	NA	NA
AYD35893.1|3949315_3949717_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	47.0	1.8e-11
AYD35894.1|3949861_3950266_+	hypothetical protein	NA	NA	NA	NA	NA
AYD35895.1|3950294_3950504_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	9.4e-28
AYD35896.1|3950714_3950933_+	hypothetical protein	NA	NA	NA	NA	NA
AYD35897.1|3951566_3951860_+	hypothetical protein	NA	NA	NA	NA	NA
AYD35898.1|3952161_3952389_+	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	48.4	2.1e-09
AYD35899.1|3952385_3952610_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	60.8	1.5e-18
AYD35900.1|3952606_3953356_+	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	59.9	6.7e-84
AYD35901.1|3953352_3953571_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	52.2	2.6e-12
AYD35902.1|3953801_3954962_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	91.3	8.8e-208
AYD35903.1|3955395_3956262_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
3954980:3955025	attR	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AYD35904.1|3956263_3956476_+	ribosome-associated protein	NA	NA	NA	NA	NA
AYD35905.1|3956521_3957907_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
AYD35906.1|3958082_3958577_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AYD35907.1|3958580_3959303_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AYD35908.1|3959410_3959749_+	hypothetical protein	NA	NA	NA	NA	NA
AYD35909.1|3959745_3959913_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYD35910.1|3959845_3960355_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AYD35911.1|3960351_3961419_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AYD35912.1|3961529_3962606_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AYD35913.1|3962713_3963859_-	porin	NA	NA	NA	NA	NA
AYD35914.1|3964040_3966455_-	ABC transporter permease	NA	NA	NA	NA	NA
AYD37269.1|3966451_3967138_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.6e-31
AYD37270.1|3967105_3967732_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 1
CP022926	Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence	258210	5122	61772	258210	holin,transposase,integrase	Escherichia_phage(18.18%)	42	NA	NA
AYD37360.1|5122_6838_-|integrase	integrase	integrase	NA	NA	NA	NA
AYD37361.1|6947_9977_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
AYD37362.1|10083_11109_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AYD37363.1|11105_11885_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AYD37364.1|11881_12121_+	hypothetical protein	NA	NA	NA	NA	NA
AYD37365.1|12172_13054_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AYD37366.1|13303_14623_-|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AYD37367.1|14899_16084_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AYD37368.1|16587_16947_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
AYD37369.1|18112_18733_-	serine recombinase	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
AYD37370.1|18821_21719_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
AYD37371.1|21791_22496_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYD37372.1|24239_25100_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYD37373.1|25597_25906_+	hypothetical protein	NA	NA	NA	NA	NA
AYD37374.1|25800_26364_-	SAM-dependent methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
AYD37375.1|26411_27767_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AYD37376.1|27818_28049_-	hypothetical protein	NA	NA	NA	NA	NA
AYD37377.1|28140_28368_-	hypothetical protein	NA	NA	NA	NA	NA
AYD37378.1|29094_29412_-	hypothetical protein	NA	NA	NA	NA	NA
AYD37596.1|29446_29701_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	8.8e-12
AYD37379.1|29937_30363_-	antirestriction protein	NA	NA	NA	NA	NA
AYD37380.1|30500_30713_-	hypothetical protein	NA	NA	NA	NA	NA
AYD37597.1|30882_31113_-	hypothetical protein	NA	NA	NA	NA	NA
AYD37381.1|31346_32855_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.2	1.1e-24
AYD37382.1|32854_33106_-	hypothetical protein	NA	NA	NA	NA	NA
AYD37383.1|33259_33685_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
AYD37384.1|33684_34956_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	1.5e-155
AYD37385.1|35033_35285_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AYD37386.1|35529_37482_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYD37387.1|37478_38759_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYD37388.1|43444_44416_-	plasmid-partitioning protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
AYD37389.1|44415_45582_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	4.0e-224
AYD37390.1|46333_47344_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
AYD37391.1|48061_48802_-	recombinase	NA	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AYD37392.1|49945_50893_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	2.3e-12
AYD37393.1|50919_51231_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AYD37394.1|51295_52219_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	7.1e-176
AYD37395.1|52891_53149_-	hypothetical protein	NA	NA	NA	NA	NA
AYD37396.1|53750_55205_+	diguanylate cyclase	NA	NA	NA	NA	NA
AYD37397.1|56187_57465_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AYD37398.1|57527_59531_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AYD37598.1|60564_61772_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
>prophage 2
CP022926	Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence	258210	100949	178159	258210	transposase,protease,integrase	Escherichia_phage(28.57%)	72	98630:98644	176823:176837
98630:98644	attL	TTTTCTGCTTTTCAC	NA	NA	NA	NA
AYD37601.1|100949_102296_+|transposase	transposase	transposase	NA	NA	NA	NA
AYD37438.1|102344_102740_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYD37439.1|104229_105192_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AYD37440.1|105178_105928_-	diguanylate cyclase	NA	NA	NA	NA	NA
AYD37441.1|106165_106363_-	hypothetical protein	NA	NA	NA	NA	NA
AYD37442.1|106362_109158_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.0	5.2e-129
AYD37443.1|109281_109851_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AYD37602.1|109885_110167_-	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
AYD37444.1|112102_113110_-	formamidase	NA	NA	NA	NA	NA
AYD37445.1|113145_113835_-	urea ABC transporter ATP-binding subunit UrtE	NA	G9BWD6	Planktothrix_phage	29.6	8.5e-17
AYD37446.1|113845_114595_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	2.4e-17
AYD37447.1|114591_115707_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
AYD37448.1|115716_116643_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYD37603.1|116699_117890_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYD37449.1|118194_121575_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	30.3	1.7e-41
AYD37450.1|121537_122458_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.1	2.0e-13
AYD37451.1|123454_124423_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.0e-173
AYD37452.1|124696_125701_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYD37453.1|125882_126059_-|integrase	integrase	integrase	T1S9J3	Salmonella_phage	68.6	1.0e-06
AYD37454.1|126388_127204_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AYD37455.1|127264_128068_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AYD37456.1|128067_128904_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AYD37457.1|128985_129690_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYD37458.1|130660_131365_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYD37459.1|131657_131972_-|transposase	transposase	transposase	NA	NA	NA	NA
AYD37460.1|131910_132924_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYD37461.1|133070_133553_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AYD37462.1|133773_134040_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AYD37463.1|134182_134947_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AYD37464.1|134988_135201_+	resolvase	NA	NA	NA	NA	NA
AYD37465.1|135213_136422_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AYD37466.1|136455_137889_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AYD37467.1|138207_138912_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYD37468.1|138981_141774_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.9	0.0e+00
AYD37469.1|141790_142123_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AYD37470.1|142169_143045_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AYD37471.1|143427_144132_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYD37472.1|145325_145868_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AYD37473.1|145880_146741_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
AYD37474.1|146847_147552_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYD37604.1|147695_148250_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AYD37605.1|148380_149211_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AYD37475.1|149842_150547_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYD37606.1|152168_152411_+	relaxase	NA	NA	NA	NA	NA
AYD37476.1|152442_153120_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYD37477.1|153198_154398_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AYD37478.1|154429_155314_-	EamA family transporter	NA	NA	NA	NA	NA
AYD37607.1|155451_155844_-	cysteine hydrolase	NA	NA	NA	NA	NA
AYD37479.1|156620_157226_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
AYD37480.1|157320_160218_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AYD37481.1|162625_163270_+	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
AYD37482.1|164069_164774_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYD37483.1|164820_166125_-|integrase	integrase	integrase	NA	NA	NA	NA
AYD37484.1|166163_166871_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AYD37485.1|166867_167104_-	mercury resistance protein	NA	NA	NA	NA	NA
AYD37486.1|167100_167463_-	transcriptional regulator	NA	NA	NA	NA	NA
AYD37487.1|167480_169175_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYD37608.1|169226_169649_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AYD37609.1|169684_169810_-	mercury transporter	NA	NA	NA	NA	NA
AYD37488.1|170541_171252_-	AAA family ATPase	NA	NA	NA	NA	NA
AYD37489.1|171325_171742_-	PIN domain nuclease	NA	NA	NA	NA	NA
AYD37490.1|171738_171969_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AYD37491.1|171952_172387_+	hypothetical protein	NA	NA	NA	NA	NA
AYD37610.1|172621_172828_+	hypothetical protein	NA	NA	NA	NA	NA
AYD37492.1|172873_173182_+	hypothetical protein	NA	NA	NA	NA	NA
AYD37493.1|173209_173539_+	hypothetical protein	NA	NA	NA	NA	NA
AYD37494.1|173606_173963_+	hypothetical protein	NA	NA	NA	NA	NA
AYD37495.1|173969_174302_+	hypothetical protein	NA	NA	NA	NA	NA
AYD37496.1|174301_175084_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
AYD37497.1|175938_176133_-	hypothetical protein	NA	NA	NA	NA	NA
AYD37498.1|176297_176771_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AYD37499.1|176890_178159_-|transposase	ISL3 family transposase ISKpn25	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
176823:176837	attR	TTTTCTGCTTTTCAC	NA	NA	NA	NA
>prophage 3
CP022926	Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence	258210	182734	194826	258210		Enterobacteria_phage(25.0%)	13	NA	NA
AYD37502.1|182734_184762_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
AYD37503.1|184873_185089_-	hypothetical protein	NA	NA	NA	NA	NA
AYD37504.1|185313_185646_-	hypothetical protein	NA	NA	NA	NA	NA
AYD37505.1|185665_185851_-	hypothetical protein	NA	NA	NA	NA	NA
AYD37506.1|186022_186997_-	chromosome partitioning protein ParB	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
AYD37507.1|186993_188199_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
AYD37508.1|188520_189417_-	replication initiation protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
AYD37509.1|189817_191089_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
AYD37510.1|191088_191520_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
AYD37511.1|191751_192723_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AYD37512.1|192725_193397_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AYD37513.1|193457_193688_+	hypothetical protein	NA	NA	NA	NA	NA
AYD37514.1|194124_194826_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
>prophage 1
CP022925	Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B sequence	25082	12835	25082	25082	integrase	Salmonella_phage(33.33%)	21	8120:8132	20667:20679
8120:8132	attL	CGGCGATTGTCGA	NA	NA	NA	NA
AYD37332.1|12835_13930_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.3	1.2e-177
AYD37333.1|14583_15744_-|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	91.3	8.8e-208
AYD37334.1|15974_16193_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	52.2	2.6e-12
AYD37335.1|16189_16939_-	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	59.9	6.7e-84
AYD37336.1|16935_17160_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	60.8	1.5e-18
AYD37337.1|17156_17384_-	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	48.4	2.1e-09
AYD37338.1|17684_17978_-	hypothetical protein	NA	NA	NA	NA	NA
AYD37339.1|18610_18829_-	hypothetical protein	NA	NA	NA	NA	NA
AYD37340.1|19037_19247_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	9.4e-28
AYD37341.1|19319_19679_-	hypothetical protein	NA	NA	NA	NA	NA
AYD37342.1|19822_20224_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	47.0	1.8e-11
AYD37343.1|20332_20584_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	47.9	1.3e-12
AYD37344.1|20587_21013_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
20667:20679	attR	CGGCGATTGTCGA	NA	NA	NA	NA
AYD37345.1|21026_21281_+	hypothetical protein	NA	NA	NA	NA	NA
AYD37346.1|21277_22306_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	51.5	2.6e-30
AYD37347.1|22481_22727_+	hypothetical protein	NA	NA	NA	NA	NA
AYD37348.1|22726_22936_+	hypothetical protein	NA	NA	NA	NA	NA
AYD37349.1|22939_23731_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	52.9	1.1e-65
AYD37350.1|23922_24273_+	hypothetical protein	NA	NA	NA	NA	NA
AYD37351.1|24272_24500_+	hypothetical protein	NA	NA	NA	NA	NA
AYD37352.1|24496_25082_+	hypothetical protein	NA	S4TSR6	Salmonella_phage	66.0	3.2e-49
