The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP023775	Burkholderia pseudomallei strain BPHN1 chromosome 1, complete sequence	4075641	650719	661674	4075641	protease	Streptococcus_phage(16.67%)	10	NA	NA
AYE26555.1|650719_652834_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
AYE26556.1|653131_653641_-	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
AYE26557.1|653832_654051_-	hypothetical protein	NA	NA	NA	NA	NA
AYE26558.1|654313_654892_-	pseudouridine synthase	NA	NA	NA	NA	NA
AYE26559.1|655159_656419_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	63.0	5.2e-12
AYE26560.1|656391_656574_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AYE26561.1|656586_658197_+	copper oxidase	NA	NA	NA	NA	NA
AYE26562.1|658326_658530_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
AYE26563.1|659062_659377_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
AYE26564.1|659373_661674_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
>prophage 2
CP023775	Burkholderia pseudomallei strain BPHN1 chromosome 1, complete sequence	4075641	1222553	1229347	4075641	integrase	Burkholderia_virus(33.33%)	11	1223935:1223950	1228137:1228152
AYE27068.1|1222553_1223255_-	peptidase	NA	A0A292GJG6	Xanthomonas_phage	44.8	9.9e-13
AYE27069.1|1223551_1224460_-	aldose epimerase	NA	NA	NA	NA	NA
1223935:1223950	attL	CGGCCGACGCGCGCTT	NA	NA	NA	NA
AYE27070.1|1224655_1224763_+	UDP pyrophosphate phosphatase	NA	NA	NA	NA	NA
AYE27071.1|1225007_1225838_+	undecaprenyl-diphosphatase 1	NA	NA	NA	NA	NA
AYE27072.1|1226131_1226575_-|integrase	integrase	integrase	B9UDL9	Salmonella_phage	42.6	1.3e-18
AYE27073.1|1226525_1226732_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	86.7	3.1e-15
AYE27074.1|1226752_1227466_-	LysR family transcriptional regulator	NA	A4PE26	Ralstonia_virus	43.8	1.5e-32
AYE29676.1|1227474_1227981_-	hypothetical protein	NA	NA	NA	NA	NA
AYE27075.1|1227952_1228426_-	hypothetical protein	NA	NA	NA	NA	NA
1228137:1228152	attR	AAGCGCGCGTCGGCCG	NA	NA	NA	NA
AYE27076.1|1228418_1228925_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	3.0e-19
AYE27077.1|1228921_1229347_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	48.3	4.9e-15
>prophage 3
CP023775	Burkholderia pseudomallei strain BPHN1 chromosome 1, complete sequence	4075641	2101986	2106470	4075641		Burkholderia_virus(57.14%)	9	NA	NA
AYE27770.1|2101986_2102220_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	60.6	4.3e-13
AYE27771.1|2102255_2102483_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	75.8	3.8e-22
AYE27772.1|2102736_2103132_+	hypothetical protein	NA	NA	NA	NA	NA
AYE27773.1|2103412_2103838_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	46.0	1.4e-14
AYE27774.1|2103834_2104341_+	hypothetical protein	NA	A4PE24	Ralstonia_virus	40.9	1.0e-19
AYE27775.1|2104682_2105285_+	hypothetical protein	NA	NA	NA	NA	NA
AYE29771.1|2105705_2106017_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	60.2	4.5e-26
AYE29772.1|2106037_2106223_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.2	4.4e-21
AYE27776.1|2106206_2106470_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.5	2.2e-26
>prophage 4
CP023775	Burkholderia pseudomallei strain BPHN1 chromosome 1, complete sequence	4075641	2682073	2690911	4075641		Tanapox_virus(16.67%)	8	NA	NA
AYE28270.1|2682073_2682916_+	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.2	7.2e-18
AYE28271.1|2683258_2684182_-	deacetylase	NA	A0A2K9KZC4	Tupanvirus	36.5	8.4e-44
AYE28272.1|2684309_2685662_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AYE29825.1|2685888_2686791_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
AYE28273.1|2687115_2687433_-	competence protein ComE	NA	NA	NA	NA	NA
AYE28274.1|2687504_2688497_-	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
AYE28275.1|2688555_2689542_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.8	6.7e-15
AYE28276.1|2689510_2690911_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	1.1e-79
>prophage 5
CP023775	Burkholderia pseudomallei strain BPHN1 chromosome 1, complete sequence	4075641	3026427	3035682	4075641		unidentified_phage(16.67%)	7	NA	NA
AYE28576.1|3026427_3027975_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
AYE28577.1|3028011_3028539_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AYE28578.1|3028535_3029219_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
AYE28579.1|3029283_3030099_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
AYE28580.1|3030290_3032300_-	chloride transporter	NA	S4VT78	Pandoravirus	34.4	2.2e-52
AYE28581.1|3032333_3033464_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	3.8e-22
AYE28582.1|3033729_3035682_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
>prophage 6
CP023775	Burkholderia pseudomallei strain BPHN1 chromosome 1, complete sequence	4075641	3322035	3380365	4075641	bacteriocin,plate,tail,tRNA,protease	Burkholderia_phage(27.27%)	63	NA	NA
AYE28839.1|3322035_3323334_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AYE28840.1|3323400_3324483_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	6.7e-08
AYE28841.1|3324526_3325384_+	protein-(glutamine-N5) methyltransferase, release factor-specific	NA	NA	NA	NA	NA
AYE28842.1|3325463_3325772_+	monothiol glutaredoxin, Grx4 family	NA	NA	NA	NA	NA
AYE28843.1|3325786_3326374_+	3-octaprenyl-4-hydroxybenzoate carboxy-lyase	NA	NA	NA	NA	NA
AYE28844.1|3326657_3327446_+	dioxygenase	NA	NA	NA	NA	NA
AYE28845.1|3327569_3328025_+	hypothetical protein	NA	NA	NA	NA	NA
AYE28846.1|3327958_3329560_-	APC family permease	NA	NA	NA	NA	NA
AYE28847.1|3329993_3330197_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	73.1	6.3e-21
AYE28848.1|3330183_3330321_-	branched-chain amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYE28849.1|3330383_3331646_-	Hsp70 family protein	NA	NA	NA	NA	NA
AYE28850.1|3332283_3332889_-	nitroreductase	NA	NA	NA	NA	NA
AYE28851.1|3332850_3333426_+	restriction endonuclease subunit R	NA	NA	NA	NA	NA
AYE28852.1|3333385_3334669_-	MFS transporter	NA	NA	NA	NA	NA
AYE28853.1|3334827_3335472_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYE28854.1|3335462_3335813_+	hypothetical protein	NA	NA	NA	NA	NA
AYE28855.1|3335809_3336433_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
AYE28856.1|3336517_3337414_-	methyltransferase	NA	NA	NA	NA	NA
AYE28857.1|3337541_3338732_-	methyltransferase	NA	NA	NA	NA	NA
AYE29888.1|3338674_3338890_-	hypothetical protein	NA	NA	NA	NA	NA
AYE28858.1|3338837_3338960_+	aromatic ring-opening dioxygenase LigA	NA	NA	NA	NA	NA
AYE28859.1|3339034_3340153_-	acyltransferase	NA	NA	NA	NA	NA
AYE28860.1|3340151_3340631_+	hypothetical protein	NA	NA	NA	NA	NA
AYE29889.1|3340590_3341037_-	water stress/hypersensitive response domain-containing protein	NA	NA	NA	NA	NA
AYE28861.1|3341397_3341520_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AYE28862.1|3341563_3341659_-	hypothetical protein	NA	NA	NA	NA	NA
AYE28863.1|3341697_3343863_+	peptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.1	1.9e-46
AYE28864.1|3343820_3344081_-	hypothetical protein	NA	NA	NA	NA	NA
AYE28865.1|3344444_3344843_+	hypothetical protein	NA	NA	NA	NA	NA
AYE28866.1|3344885_3345155_+	hypothetical protein	NA	NA	NA	NA	NA
AYE28867.1|3345257_3345488_+	hypothetical protein	NA	NA	NA	NA	NA
AYE28868.1|3345564_3345747_-	hypothetical protein	NA	NA	NA	NA	NA
AYE29890.1|3345721_3346078_-	hypothetical protein	NA	NA	NA	NA	NA
AYE28869.1|3346103_3347372_+|bacteriocin	bacteriocin secretion protein	bacteriocin	NA	NA	NA	NA
AYE28870.1|3347386_3349648_+	colicin V biosynthesis protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.9	2.3e-10
AYE28871.1|3349644_3351093_+	TolC family protein	NA	NA	NA	NA	NA
AYE28872.1|3351077_3351227_+	flagellar protein FliO	NA	NA	NA	NA	NA
AYE28873.1|3351302_3352289_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYE28874.1|3352300_3353266_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AYE28875.1|3353283_3353562_+	hypothetical protein	NA	NA	NA	NA	NA
AYE28876.1|3353537_3357431_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AYE28877.1|3357427_3358417_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
AYE28878.1|3358421_3359354_+	OmpA family protein	NA	NA	NA	NA	NA
AYE28879.1|3359552_3360674_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AYE28880.1|3360763_3363433_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.1	1.7e-89
AYE28881.1|3363466_3364567_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYE29891.1|3364530_3366357_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYE28882.1|3366448_3366961_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AYE28883.1|3366988_3367492_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AYE28884.1|3367564_3369055_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AYE28885.1|3369071_3369590_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AYE28886.1|3369626_3370298_-	lipoprotein	NA	NA	NA	NA	NA
AYE28887.1|3370671_3371286_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AYE28888.1|3371394_3372741_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AYE28889.1|3372737_3373523_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AYE28890.1|3373624_3373990_+	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	88.4	1.9e-52
AYE28891.1|3374093_3374600_-	hypothetical protein	NA	NA	NA	NA	NA
AYE28892.1|3375079_3375682_-	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	88.5	1.9e-81
AYE28893.1|3375579_3375993_-|tail	phage tail protein I	tail	K4NXA0	Burkholderia_phage	99.2	2.3e-70
AYE28894.1|3376134_3376608_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	49.2	1.9e-28
AYE28895.1|3376532_3377048_+	hypothetical protein	NA	A0A218M4I3	Erwinia_phage	52.5	4.0e-27
AYE28896.1|3377006_3379304_-|protease	serine protease	protease	NA	NA	NA	NA
AYE28897.1|3379360_3380365_-	AAA family ATPase	NA	Q677Q6	Lymphocystis_disease_virus	31.7	2.6e-14
>prophage 7
CP023775	Burkholderia pseudomallei strain BPHN1 chromosome 1, complete sequence	4075641	3862566	3942290	4075641	plate,tail,holin,tRNA,head,capsid,portal,transposase,terminase,protease	Burkholderia_phage(57.89%)	87	NA	NA
AYE29351.1|3862566_3863580_+|portal	phage portal protein	portal	A4JWV0	Burkholderia_virus	99.4	1.3e-194
AYE29352.1|3863653_3863938_-	hypothetical protein	NA	NA	NA	NA	NA
AYE29353.1|3863934_3864417_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
AYE29354.1|3864954_3865959_-	hypothetical protein	NA	NA	NA	NA	NA
AYE29355.1|3866831_3867236_+	PaaI family thioesterase	NA	NA	NA	NA	NA
AYE29356.1|3867273_3868143_+	Patatin	NA	NA	NA	NA	NA
AYE29357.1|3868265_3869282_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
AYE29358.1|3869720_3870776_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYE29359.1|3870997_3873607_-	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	24.8	3.5e-18
AYE29360.1|3873817_3874189_-	thioredoxin	NA	NA	NA	NA	NA
AYE29361.1|3874248_3875439_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
AYE29362.1|3875667_3876171_+	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.1e-12
AYE29943.1|3876202_3877186_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
AYE29363.1|3877306_3877942_+	LysE family translocator	NA	NA	NA	NA	NA
AYE29364.1|3878051_3878909_+|protease	protease HtpX	protease	NA	NA	NA	NA
AYE29365.1|3879462_3880872_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
AYE29366.1|3880868_3881459_+	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
AYE29367.1|3881460_3883869_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AYE29368.1|3883869_3884553_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYE29369.1|3885580_3885931_-	DNA-binding protein	NA	NA	NA	NA	NA
AYE29370.1|3886622_3889415_-	hypothetical protein	NA	K4NXL6	Burkholderia_phage	99.1	0.0e+00
AYE29371.1|3889426_3889681_-	hypothetical protein	NA	A4JWQ9	Burkholderia_virus	100.0	2.6e-40
AYE29372.1|3889677_3890046_-	hypothetical protein	NA	K4NXB4	Burkholderia_phage	99.2	2.3e-61
AYE29373.1|3890039_3890246_-	hypothetical protein	NA	K4NZT3	Burkholderia_phage	100.0	2.7e-35
AYE29374.1|3890414_3890654_-	hypothetical protein	NA	K4PAZ5	Burkholderia_phage	100.0	1.4e-35
AYE29375.1|3890657_3890867_-	phage-encoded membrane protein	NA	K4NXL1	Burkholderia_phage	100.0	4.5e-30
AYE29376.1|3890895_3891093_-	hypothetical protein	NA	K4NZY3	Burkholderia_phage	98.5	6.1e-29
AYE29377.1|3891098_3891317_-	hypothetical protein	NA	K4NXB1	Burkholderia_phage	100.0	1.1e-34
AYE29378.1|3891332_3891878_-	transcriptional regulator	NA	K4NZS9	Burkholderia_phage	100.0	7.8e-98
AYE29379.1|3891963_3892212_-	transcriptional regulator	NA	K4PAZ0	Burkholderia_phage	100.0	3.0e-41
AYE29380.1|3892199_3892496_-	phage DNA-binding protein	NA	E5E3P2	Burkholderia_phage	84.3	5.4e-37
AYE29944.1|3892499_3892694_-	hypothetical protein	NA	K4NZX7	Burkholderia_phage	96.9	1.6e-26
AYE29381.1|3893329_3894079_+	phage-encoded membrane protein	NA	E5E3P5	Burkholderia_phage	43.1	4.7e-53
AYE29382.1|3894121_3894622_+	hypothetical protein	NA	NA	NA	NA	NA
AYE29383.1|3894629_3895727_-	late control protein	NA	K4PAY4	Burkholderia_phage	98.9	1.2e-198
AYE29384.1|3895726_3896152_-|tail	bacteriophage tail-related protein	tail	A4JWS2	Burkholderia_virus	99.3	3.3e-72
AYE29385.1|3896169_3899136_-	hypothetical protein	NA	A4JWS3	Burkholderia_virus	98.9	0.0e+00
AYE29386.1|3899132_3899246_-|tail	GpE family phage tail protein	tail	A4JWX5	Burkholderia_virus	100.0	1.9e-14
AYE29387.1|3899254_3899599_-|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	100.0	1.0e-55
AYE29388.1|3899656_3900166_-|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	100.0	4.9e-94
AYE29389.1|3900181_3901354_-|tail	phage tail protein	tail	Q45YG5	Burkholderia_virus	100.0	6.8e-224
AYE29390.1|3901409_3902081_-|tail	tail assembly chaperone	tail	A4JWS8	Burkholderia_virus	96.0	6.8e-112
AYE29391.1|3902097_3904470_-|tail	phage tail protein	tail	K4NZW8	Burkholderia_phage	98.4	0.0e+00
AYE29392.1|3904471_3905026_-|tail	phage tail protein I	tail	A4JWT0	Burkholderia_virus	97.8	6.1e-98
AYE29393.1|3905018_3905924_-|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	98.3	3.5e-159
AYE29394.1|3905920_3906283_-|plate	bacteriophage baseplate assembly protein W	plate	K4PAX6	Burkholderia_phage	100.0	1.7e-61
AYE29395.1|3906279_3906960_-|plate	phage baseplate assembly protein V	plate	A4JWY4	Burkholderia_virus	97.3	4.1e-120
AYE29396.1|3907034_3907910_+	site-specific DNA-methyltransferase	NA	A4JWY5	Burkholderia_virus	98.6	2.2e-166
AYE29397.1|3908075_3908606_-	hypothetical protein	NA	K4NX96	Burkholderia_phage	100.0	3.0e-94
AYE29398.1|3908732_3909200_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	99.4	3.4e-78
AYE29399.1|3909196_3909613_-|tail	bacteriophage tail completion protein R	tail	A4JWT7	Burkholderia_virus	100.0	3.3e-72
AYE29945.1|3909605_3909740_-	peptidase	NA	K4PAX1	Burkholderia_phage	100.0	7.4e-18
AYE29400.1|3909717_3910158_-	bacteriophage protein	NA	K4NXJ2	Burkholderia_phage	100.0	3.8e-71
AYE29401.1|3910154_3910967_-	bacteriophage-acquired protein	NA	A4JWZ0	Burkholderia_virus	100.0	1.2e-150
AYE29402.1|3910963_3911236_-|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	100.0	8.8e-42
AYE29403.1|3911237_3911582_-	hypothetical protein	NA	K4NZQ3	Burkholderia_phage	100.0	2.9e-50
AYE29404.1|3911596_3911803_-|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	100.0	2.4e-31
AYE29405.1|3911799_3912051_-	hypothetical protein	NA	K4NXI9	Burkholderia_phage	100.0	7.6e-40
AYE29406.1|3912050_3912530_-|head	bacteriophage head completion/stabilization protein	head	K4NZV5	Burkholderia_phage	100.0	5.8e-81
AYE29407.1|3912629_3913319_-|terminase	terminase	terminase	K4NX86	Burkholderia_phage	97.4	3.0e-115
AYE29408.1|3913315_3914329_-|capsid	phage major capsid protein, P2 family	capsid	K4NZP8	Burkholderia_phage	99.1	8.0e-189
AYE29409.1|3914362_3915172_-|capsid	phage capsid scaffolding protein	capsid	K4PAW2	Burkholderia_phage	100.0	4.2e-148
AYE29946.1|3915315_3917085_+|terminase	terminase	terminase	K4NXI4	Burkholderia_phage	99.3	0.0e+00
AYE29410.1|3917081_3918137_+|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	99.7	2.6e-206
AYE29411.1|3918243_3918516_+	BrnT family toxin	NA	K4NX81	Burkholderia_phage	100.0	1.0e-45
AYE29412.1|3918475_3918748_+	hypothetical protein	NA	K4NZP3	Burkholderia_phage	100.0	6.3e-48
AYE29413.1|3919277_3919805_-	DUF4411 domain-containing protein	NA	NA	NA	NA	NA
AYE29414.1|3919776_3920928_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AYE29415.1|3921259_3922012_+	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	39.3	5.5e-09
AYE29416.1|3922523_3922814_+	hypothetical protein	NA	NA	NA	NA	NA
AYE29417.1|3922810_3923545_+	7-cyano-7-deazaguanine synthase	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
AYE29418.1|3923638_3924271_+	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
AYE29419.1|3924290_3924743_+	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
AYE29420.1|3925163_3925949_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
AYE29421.1|3925945_3926722_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AYE29422.1|3927100_3928564_+|transposase	IS5/IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	6.8e-80
AYE29423.1|3928643_3929792_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
AYE29424.1|3929803_3932215_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
AYE29425.1|3932398_3932911_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AYE29426.1|3932907_3933981_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AYE29427.1|3934100_3935144_-	rod shape-determining protein	NA	NA	NA	NA	NA
AYE29428.1|3935509_3935809_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit C	tRNA	NA	NA	NA	NA
AYE29429.1|3935921_3937412_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A	tRNA	NA	NA	NA	NA
AYE29430.1|3937414_3938887_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit B	tRNA	NA	NA	NA	NA
AYE29431.1|3939013_3939853_+	polyphosphate kinase	NA	NA	NA	NA	NA
AYE29432.1|3939884_3940655_+	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
AYE29433.1|3940826_3942290_+|transposase	IS5/IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.8	4.0e-80
>prophage 1
CP023776	Burkholderia pseudomallei strain BPHN1 chromosome 2, complete sequence	3217986	302074	368167	3217986	plate,transposase,holin	Ralstonia_phage(28.57%)	58	NA	NA
AYE30230.1|302074_304270_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AYE30231.1|304461_304617_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30232.1|304755_305502_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30233.1|305902_307225_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	30.1	2.1e-32
AYE30234.1|308109_308598_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30235.1|308587_308842_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AYE30236.1|308838_309858_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYE32635.1|309877_310330_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYE32636.1|310665_310890_-	hypothetical protein	NA	NA	NA	NA	NA
AYE30237.1|310813_311734_+	ABC transporter permease	NA	NA	NA	NA	NA
AYE30238.1|311717_312572_+	ABC transporter permease	NA	NA	NA	NA	NA
AYE30239.1|312568_313600_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE30240.1|314187_314493_+	HNS-like regulatory protein	NA	NA	NA	NA	NA
AYE32637.1|314822_317600_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.8	8.9e-89
AYE30241.1|317613_319854_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	27.4	6.8e-23
AYE30242.1|319992_321531_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AYE30243.1|321540_321804_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30244.1|322218_322638_-	hypothetical protein	NA	NA	NA	NA	NA
AYE30245.1|322657_322984_-	thioredoxin	NA	NA	NA	NA	NA
AYE30246.1|323069_323285_-	hypothetical protein	NA	NA	NA	NA	NA
AYE32638.1|323216_323444_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30247.1|323455_324148_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30248.1|324186_324501_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30249.1|324540_324729_-	porin	NA	NA	NA	NA	NA
AYE32639.1|324733_325357_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
AYE30250.1|325437_327033_-	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	33.3	1.9e-06
AYE30251.1|326982_327270_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30252.1|328183_329641_-	hypothetical protein	NA	NA	NA	NA	NA
AYE30253.1|329800_329989_-	hypothetical protein	NA	NA	NA	NA	NA
AYE30254.1|330000_330465_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30255.1|331193_333383_+	hypothetical protein	NA	A0A2C9CZG8	Yersinia_phage	46.1	5.1e-07
AYE30256.1|333449_334937_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
AYE30257.1|334972_335188_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30258.1|335198_335753_-	hypothetical protein	NA	NA	NA	NA	NA
AYE30259.1|336337_336883_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYE30260.1|336947_337685_+	pilus assembly protein	NA	NA	NA	NA	NA
AYE32640.1|337908_340542_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AYE30261.1|340534_341107_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYE32641.1|341171_341828_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AYE30262.1|341830_343507_+	OmpA family protein	NA	NA	NA	NA	NA
AYE30263.1|343641_343839_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30264.1|343884_344424_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AYE30265.1|344457_345957_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AYE30266.1|346156_346639_+	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
AYE30267.1|346766_347309_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AYE32642.1|347314_348664_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AYE30268.1|348660_349962_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
AYE30269.1|349976_353885_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AYE30270.1|354074_354644_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30271.1|354741_357456_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	9.4e-35
AYE30272.1|357530_357800_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30273.1|357812_361265_+	RHS repeat protein	NA	NA	NA	NA	NA
AYE30274.1|361157_362516_-	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	45.5	1.5e-110
AYE30275.1|362548_363577_-	fimbrial protein	NA	NA	NA	NA	NA
AYE30276.1|363631_364702_-	hypothetical protein	NA	NA	NA	NA	NA
AYE30277.1|364720_365770_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYE30278.1|365766_367647_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYE30279.1|367648_368167_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
CP023776	Burkholderia pseudomallei strain BPHN1 chromosome 2, complete sequence	3217986	758598	767347	3217986		Burkholderia_virus(75.0%)	13	NA	NA
AYE30590.1|758598_759192_+	DNA invertase	NA	A0A219Y912	Aeromonas_phage	38.6	5.2e-23
AYE30591.1|759396_759669_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30592.1|759756_761523_+	hypothetical protein	NA	NA	NA	NA	NA
AYE32676.1|761930_763130_-	hypothetical protein	NA	A4JX31	Burkholderia_virus	99.5	1.1e-224
AYE30593.1|763525_764179_+	hypothetical protein	NA	Q8W6Q5	Burkholderia_virus	99.5	6.7e-112
AYE30594.1|764785_765028_-	hypothetical protein	NA	NA	NA	NA	NA
AYE30595.1|765056_765164_-	hypothetical protein	NA	Q6JIH6	Burkholderia_virus	82.9	2.9e-09
AYE30596.1|765165_765297_-	bacteriophage protein Gp48	NA	Q8W6Q2	Burkholderia_virus	97.7	2.6e-15
AYE30597.1|765306_765582_-	bacteriophage protein Gp49	NA	Q6JIH4	Burkholderia_virus	96.7	2.3e-42
AYE30598.1|766152_766422_+	BrnT family toxin	NA	NA	NA	NA	NA
AYE30599.1|766405_766690_+	hypothetical protein	NA	K4NZP3	Burkholderia_phage	50.0	1.4e-10
AYE32678.1|766999_767197_-	hypothetical protein	NA	NA	NA	NA	NA
AYE32677.1|767107_767347_+	HNH endonuclease	NA	Q8W6N0	Burkholderia_virus	89.9	4.8e-36
>prophage 3
CP023776	Burkholderia pseudomallei strain BPHN1 chromosome 2, complete sequence	3217986	930576	998403	3217986	plate,holin	Vibrio_phage(25.0%)	55	NA	NA
AYE30718.1|930576_932439_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYE30719.1|932435_933425_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYE30720.1|933427_936298_+	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	2.4e-60
AYE30721.1|936288_938580_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AYE30722.1|938745_941034_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AYE30723.1|941037_943254_+	type VI secretion protein	NA	NA	NA	NA	NA
AYE30724.1|943253_944324_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30725.1|944326_945043_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
AYE30726.1|945085_945475_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
AYE30727.1|945480_946074_+	type VI secretion system-associated lipoprotein	NA	NA	NA	NA	NA
AYE30728.1|946070_947432_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AYE30729.1|947457_949173_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30730.1|949169_952673_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AYE30731.1|952731_953091_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30732.1|953113_953536_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30733.1|953760_954132_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30734.1|954229_954403_-	hypothetical protein	NA	NA	NA	NA	NA
AYE30735.1|954682_955582_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYE30736.1|955679_955808_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30737.1|955815_957135_+	glycosyltransferase	NA	NA	NA	NA	NA
AYE30738.1|957131_958715_+	MFS transporter	NA	NA	NA	NA	NA
AYE30739.1|958973_959969_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AYE30740.1|960094_960277_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30741.1|960273_961857_+	outer membrane efflux protein	NA	NA	NA	NA	NA
AYE30742.1|961931_962141_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30743.1|962208_962397_-	hypothetical protein	NA	NA	NA	NA	NA
AYE32692.1|962631_963885_+	hemolysin secretion protein D	NA	NA	NA	NA	NA
AYE32693.1|964133_964436_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30744.1|964430_966095_-	levanase	NA	F8WPR5	Bacillus_phage	31.6	4.1e-57
AYE30745.1|966227_967793_-	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
AYE30746.1|967981_968998_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AYE30747.1|969451_970651_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
AYE30748.1|970828_971854_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
AYE30749.1|972012_972276_+	hypothetical protein	NA	NA	NA	NA	NA
AYE30750.1|972287_973562_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	5.3e-105
AYE30751.1|973634_974606_+	membrane dipeptidase	NA	NA	NA	NA	NA
AYE30752.1|974756_975290_+	4-vinyl reductase	NA	NA	NA	NA	NA
AYE30753.1|975350_977414_+	N-methylproline demethylase	NA	NA	NA	NA	NA
AYE30754.1|977416_979342_+	DUF3483 domain-containing protein	NA	NA	NA	NA	NA
AYE30755.1|979346_980519_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
AYE30756.1|980515_981301_+	drug:proton antiporter	NA	NA	NA	NA	NA
AYE30757.1|981325_982594_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AYE30758.1|982614_983760_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYE30759.1|983869_984733_+	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE30760.1|984913_986569_+	amino acid permease	NA	NA	NA	NA	NA
AYE30761.1|986655_987531_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AYE30762.1|987674_988574_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYE30763.1|988709_990263_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
AYE32694.1|990298_991297_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
AYE30764.1|991293_991416_+	porin	NA	NA	NA	NA	NA
AYE30765.1|991524_992667_+	porin	NA	NA	NA	NA	NA
AYE30766.1|992721_993948_-	aminopeptidase	NA	NA	NA	NA	NA
AYE30767.1|994065_995769_-	thermolysin metallopeptidase	NA	NA	NA	NA	NA
AYE30768.1|996240_997185_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
AYE30769.1|997452_998403_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 4
CP023776	Burkholderia pseudomallei strain BPHN1 chromosome 2, complete sequence	3217986	2659290	2717659	3217986	integrase,tRNA,portal,transposase,tail	Burkholderia_phage(23.08%)	66	2683602:2683621	2701844:2701863
AYE32880.1|2659290_2659485_+	hypothetical protein	NA	Q774Z5	Bordetella_phage	57.1	1.1e-11
AYE32091.1|2659508_2659709_+	hypothetical protein	NA	Q774Z5	Bordetella_phage	66.2	3.2e-17
AYE32092.1|2659933_2661976_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
AYE32093.1|2662034_2662373_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AYE32094.1|2662419_2664294_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.2	4.9e-67
AYE32095.1|2664388_2664835_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	48.6	8.8e-23
AYE32096.1|2665001_2665214_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AYE32097.1|2665293_2666517_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AYE32881.1|2666662_2667703_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.1	2.2e-93
AYE32098.1|2668124_2668934_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
AYE32099.1|2669084_2670989_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AYE32100.1|2671072_2671957_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
AYE32101.1|2671953_2672247_-	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
AYE32102.1|2672516_2673623_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
AYE32103.1|2673774_2675238_-|transposase	IS5/IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.7	2.0e-79
AYE32104.1|2675361_2676231_+	sulfurtransferase	NA	NA	NA	NA	NA
AYE32882.1|2676289_2677165_-	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
AYE32105.1|2677324_2677546_-	hypothetical protein	NA	NA	NA	NA	NA
AYE32106.1|2677618_2677711_-	hypothetical protein	NA	NA	NA	NA	NA
AYE32883.1|2677884_2679678_+	hypothetical protein	NA	NA	NA	NA	NA
AYE32107.1|2679983_2681366_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AYE32108.1|2681684_2684456_-	DNA polymerase I	NA	S5M8J1	Bacillus_phage	30.0	6.4e-71
2683602:2683621	attL	CTTGAAGCCGTACTTCGCGA	NA	NA	NA	NA
AYE32109.1|2684457_2685207_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
AYE32110.1|2685203_2685473_+	hypothetical protein	NA	NA	NA	NA	NA
AYE32111.1|2685624_2685909_+	hypothetical protein	NA	NA	NA	NA	NA
AYE32884.1|2686079_2686268_-	hypothetical protein	NA	NA	NA	NA	NA
AYE32112.1|2686568_2687060_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AYE32113.1|2687394_2687571_-	hypothetical protein	NA	NA	NA	NA	NA
AYE32114.1|2687495_2687759_-	hypothetical protein	NA	NA	NA	NA	NA
AYE32115.1|2687757_2687931_+	hypothetical protein	NA	NA	NA	NA	NA
AYE32116.1|2687937_2689164_-	hypothetical protein	NA	NA	NA	NA	NA
AYE32117.1|2689718_2689856_-	hypothetical protein	NA	NA	NA	NA	NA
AYE32118.1|2690124_2691387_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYE32885.1|2691356_2691629_-|tail	phage tail protein	tail	K4NZQ8	Burkholderia_phage	60.8	4.5e-14
AYE32119.1|2691554_2691842_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	94.4	6.4e-43
AYE32120.1|2691838_2692525_+|integrase	integrase	integrase	E5E3N4	Burkholderia_phage	83.0	5.4e-96
AYE32121.1|2692608_2694135_-	AMP nucleosidase	NA	NA	NA	NA	NA
AYE32122.1|2694290_2694689_+	hypothetical protein	NA	NA	NA	NA	NA
AYE32123.1|2694782_2695778_+	homoserine kinase	NA	NA	NA	NA	NA
AYE32124.1|2695768_2696581_+	hypothetical protein	NA	NA	NA	NA	NA
AYE32125.1|2696577_2697087_+	hypothetical protein	NA	NA	NA	NA	NA
AYE32126.1|2697083_2697536_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYE32127.1|2697673_2698093_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
AYE32128.1|2698205_2698364_-	DUF3563 domain-containing protein	NA	NA	NA	NA	NA
AYE32886.1|2698460_2699564_-	esterase	NA	NA	NA	NA	NA
AYE32129.1|2699859_2700558_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AYE32130.1|2700689_2700818_-	acetate permease	NA	NA	NA	NA	NA
AYE32131.1|2701086_2701887_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
2701844:2701863	attR	TCGCGAAGTACGGCTTCAAG	NA	NA	NA	NA
AYE32132.1|2701899_2702574_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AYE32133.1|2702575_2703277_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.9e-20
AYE32134.1|2703255_2703432_+	hypothetical protein	NA	NA	NA	NA	NA
AYE32135.1|2703612_2703795_-	hypothetical protein	NA	NA	NA	NA	NA
AYE32887.1|2703819_2704608_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AYE32136.1|2704702_2706778_-	metal-binding protein	NA	NA	NA	NA	NA
AYE32137.1|2706831_2707215_-	tautomerase family protein	NA	NA	NA	NA	NA
AYE32138.1|2707312_2708188_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYE32139.1|2708254_2709175_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AYE32140.1|2709267_2710047_+	sensor histidine kinase	NA	NA	NA	NA	NA
AYE32141.1|2710132_2711473_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AYE32888.1|2711508_2712099_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AYE32142.1|2712257_2713901_-	alpha-amylase	NA	NA	NA	NA	NA
AYE32143.1|2713881_2714178_-	hypothetical protein	NA	NA	NA	NA	NA
AYE32144.1|2714176_2714890_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYE32145.1|2715210_2715693_+	hypothetical protein	NA	NA	NA	NA	NA
AYE32146.1|2715757_2716996_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
AYE32147.1|2717221_2717659_+|transposase	transposase	transposase	NA	NA	NA	NA
