The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	16011	199641	5032769	head,terminase,plate,tRNA,transposase,protease,tail,portal,lysis	Enterobacteria_phage(42.27%)	172	NA	NA
AYE43657.1|16011_16749_-|tRNA	tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AYE43658.1|16867_17671_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
AYE43659.1|17815_18670_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYE43660.1|18860_20141_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
AYE43661.1|20132_21272_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
AYE43662.1|21431_22322_-	DNA-binding transcriptional regulator HcaR	NA	NA	NA	NA	NA
AYE43663.1|22457_23819_+	3-phenylpropionate/cinnamic acid dioxygenase subunit alpha	NA	NA	NA	NA	NA
AYE43664.1|23815_24334_+	3-phenylpropionate/cinnamic acid dioxygenase subunit beta	NA	NA	NA	NA	NA
AYE43665.1|24333_24654_+	3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit	NA	NA	NA	NA	NA
AYE43666.1|24650_25463_+	3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase	NA	NA	NA	NA	NA
AYE43667.1|25472_26675_+	phenylpropionate dioxygenase ferredoxin reductase subunit	NA	NA	NA	NA	NA
AYE43668.1|27536_27971_+	DoxX family protein	NA	NA	NA	NA	NA
AYE43669.1|28018_28891_-	aldose 1-epimerase	NA	NA	NA	NA	NA
AYE47966.1|28902_29964_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AYE43670.1|30029_31028_-	ABC transporter permease	NA	NA	NA	NA	NA
AYE43671.1|31052_32564_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	4.3e-13
AYE43672.1|32586_33570_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE43673.1|38452_39706_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
AYE43674.1|40033_41224_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AYE43675.1|41268_41607_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AYE43676.1|41667_43002_-	transcriptional regulator	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
AYE43677.1|42991_43705_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AYE43678.1|43869_45297_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
AYE43679.1|45854_49742_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.3e-130
AYE43680.1|49999_51556_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
AYE43681.1|51552_52089_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AYE43682.1|52113_52749_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AYE43683.1|52957_53806_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AYE43684.1|53910_54093_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43685.1|55192_57019_+	invasion protein	NA	NA	NA	NA	NA
AYE43686.1|57019_57199_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43687.1|57198_57822_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	2.1e-78
AYE43688.1|57772_58939_-|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	38.7	1.4e-56
AYE43689.1|59506_59854_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	5.3e-60
AYE43690.1|60092_61249_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE43691.1|61300_61519_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	2.4e-34
AYE43692.1|61845_62973_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
AYE43693.1|64654_64915_+	hypothetical protein	NA	NA	NA	NA	NA
AYE43694.1|64911_65502_+	hypothetical protein	NA	NA	NA	NA	NA
AYE43695.1|65521_65869_-	hypothetical protein	NA	NA	NA	NA	NA
AYE47967.1|65801_66020_+	hypothetical protein	NA	NA	NA	NA	NA
AYE43696.1|65997_66195_+	hypothetical protein	NA	NA	NA	NA	NA
AYE43697.1|66350_66560_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43698.1|66563_66746_+	hypothetical protein	NA	NA	NA	NA	NA
AYE43699.1|68827_69745_+	iron-regulated protein	NA	NA	NA	NA	NA
AYE43700.1|69752_70529_+	energy transducer TonB	NA	NA	NA	NA	NA
AYE43701.1|70697_72959_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AYE43702.1|72928_74203_+	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
AYE43703.1|75227_76766_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.3	1.0e-283
AYE43704.1|76815_77163_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	5.3e-60
AYE47968.1|77159_77540_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	1.0e-64
AYE43705.1|78667_79795_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
AYE43706.1|79925_81081_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AYE43707.1|81448_81661_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
AYE43708.1|81790_82351_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
AYE43709.1|83172_84591_-	DNA helicase	NA	NA	NA	NA	NA
AYE43710.1|84473_84860_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
AYE43711.1|84856_86128_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
AYE43712.1|86312_86624_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AYE43713.1|88624_89425_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
AYE43714.1|89421_90594_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
AYE43715.1|91034_92222_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYE43716.1|92394_93597_-	recombinase	NA	NA	NA	NA	NA
AYE43717.1|93811_94072_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
AYE43718.1|94265_94346_-	small toxic protein ShoB	NA	NA	NA	NA	NA
AYE43719.1|94567_94948_-	holo-ACP synthase	NA	NA	NA	NA	NA
AYE43720.1|94947_95679_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AYE43721.1|95690_96419_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AYE43722.1|96430_97336_-	GTPase Era	NA	NA	NA	NA	NA
AYE43723.1|97332_98013_-	ribonuclease 3	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
AYE43724.1|97956_98235_+	hypothetical protein	NA	NA	NA	NA	NA
AYE43725.1|98285_99260_-	S26 family signal peptidase	NA	NA	NA	NA	NA
AYE43726.1|99275_101075_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
AYE43727.1|101272_101752_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
AYE43728.1|101748_102705_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AYE43729.1|102704_103355_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AYE43730.1|103387_103963_-	ECF RNA polymerase sigma-E factor	NA	NA	NA	NA	NA
AYE47969.1|108021_108759_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AYE43731.1|108890_110225_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AYE43732.1|110433_111315_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYE43733.1|111417_112005_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AYE43734.1|112060_112444_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
AYE43735.1|112748_113438_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
AYE43736.1|113485_114523_-	methyltransferase	NA	NA	NA	NA	NA
AYE43737.1|114512_114716_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43738.1|114729_115149_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AYE43739.1|115217_115916_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AYE43740.1|115947_118608_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AYE43741.1|118721_120077_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AYE43742.1|120122_120446_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
AYE43743.1|120442_121741_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.2	3.7e-45
AYE43744.1|127516_130090_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
AYE43745.1|130219_130951_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AYE43746.1|130947_131928_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AYE43747.1|132062_132800_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AYE43748.1|132921_134250_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AYE43749.1|134353_134716_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	1.1e-63
AYE43750.1|134777_135933_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE43751.1|135996_137493_+|tail	phage tail protein	tail	Q8W623	Enterobacteria_phage	97.4	5.9e-273
AYE43752.1|137492_137849_+|tail	phage tail protein	tail	Q8W622	Enterobacteria_phage	98.3	5.3e-63
AYE47970.1|137854_138184_+|tail	phage tail assembly protein	tail	Q8W621	Enterobacteria_phage	98.2	8.7e-52
AYE43753.1|138268_140218_+|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	97.8	0.0e+00
AYE47971.1|141338_141545_+	hypothetical protein	NA	NA	NA	NA	NA
AYE43754.1|141591_142983_+	DNA circularization protein	NA	Q8W619	Enterobacteria_phage	95.9	6.1e-248
AYE43755.1|142979_144062_+|plate	baseplate protein	plate	Q8W618	Enterobacteria_phage	98.8	8.0e-195
AYE43756.1|144039_144573_+|plate	phage baseplate assembly protein V	plate	Q8W617	Enterobacteria_phage	96.0	3.7e-92
AYE43757.1|144578_144989_+	hypothetical protein	NA	Q8W616	Enterobacteria_phage	95.6	3.0e-70
AYE43758.1|146337_146841_+|plate	baseplate J/gp47 family protein	plate	Q8W615	Enterobacteria_phage	95.8	3.7e-86
AYE43759.1|146840_147431_+	DUF2313 domain-containing protein	NA	Q8W614	Enterobacteria_phage	98.0	1.4e-113
AYE43760.1|147417_148458_+|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	83.5	1.5e-158
AYE47972.1|148517_149006_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	77.9	6.0e-65
AYE43761.1|149029_150298_+|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	43.7	3.2e-78
AYE43762.1|150248_150872_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	78.0	9.9e-81
AYE43763.1|151180_151999_-	hypothetical protein	NA	I6PD67	Cronobacter_phage	79.2	1.3e-117
AYE43764.1|152002_152251_-	hypothetical protein	NA	I6PCV4	Cronobacter_phage	80.5	3.3e-27
AYE43765.1|152546_153722_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.4	2.7e-148
AYE43766.1|153682_153889_-	excisionase	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
AYE43767.1|153948_154164_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
AYE43768.1|154160_154523_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	96.7	2.6e-65
AYE43769.1|154513_155050_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
AYE43770.1|155177_156002_-	DUF2303 family protein	NA	Q8SBF9	Shigella_phage	99.6	4.6e-150
AYE43771.1|156067_156430_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AYE43772.1|156502_156697_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	100.0	1.0e-31
AYE43773.1|156798_157029_-	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	94.9	1.2e-12
AYE43774.1|157098_157773_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	99.1	1.7e-131
AYE43775.1|157863_158064_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AYE43776.1|158107_158659_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
AYE43777.1|158655_159492_+	ash family protein	NA	Q8SBF3	Shigella_phage	98.6	1.5e-148
AYE47973.1|159496_159721_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.3	9.1e-37
AYE43778.1|159717_160536_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	3.1e-122
AYE43779.1|160532_161027_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	4.3e-87
AYE43780.1|161026_161680_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
AYE43781.1|161676_162003_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
AYE43782.1|161999_162389_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
AYE43783.1|162408_163218_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	100.0	6.0e-155
AYE43784.1|163225_164215_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	9.5e-195
AYE43785.1|164228_164981_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	100.0	2.8e-138
AYE43786.1|165261_165687_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
AYE43787.1|165910_166114_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	2.3e-31
AYE43788.1|166264_167317_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
AYE43789.1|167383_167599_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AYE43790.1|167598_168096_+	lysozyme	NA	A5LH83	Enterobacteria_phage	100.0	1.3e-91
AYE43791.1|168092_168560_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	100.0	1.6e-75
AYE43792.1|168581_168944_+	DNA-binding protein	NA	A5LH85	Enterobacteria_phage	99.2	8.9e-66
AYE43793.1|169397_169892_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
AYE43794.1|169891_171994_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.9	0.0e+00
AYE43795.1|171990_172203_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AYE43796.1|172202_173711_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	3.5e-289
AYE43797.1|173655_175683_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.8	0.0e+00
AYE43798.1|175724_176093_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
AYE43799.1|176085_176361_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AYE43800.1|176372_176951_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
AYE43801.1|176947_177349_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
AYE43802.1|177359_178103_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.6	1.0e-132
AYE47974.1|178163_178550_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
AYE43803.1|178558_178888_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AYE43804.1|178859_181925_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.6	0.0e+00
AYE43805.1|181924_182254_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AYE43806.1|182263_182962_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	8.6e-134
AYE43807.1|182967_183711_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	4.7e-146
AYE43808.1|183608_184256_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.8	9.5e-111
AYE43809.1|184316_187814_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.2	0.0e+00
AYE43810.1|187884_188484_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
AYE47975.1|188548_191509_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.8	2.4e-55
AYE43811.1|191508_192093_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.3	3.0e-103
AYE43812.1|192162_192936_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
AYE43813.1|193342_194776_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
AYE43814.1|194810_196019_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
AYE43815.1|196830_197313_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AYE43816.1|197444_197921_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AYE43817.1|197910_198201_+	RnfH family protein	NA	NA	NA	NA	NA
AYE43818.1|198312_199641_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	208306	250759	5032769	terminase,tRNA,transposase,holin,portal,lysis	Enterobacteria_phage(54.17%)	47	NA	NA
AYE43826.1|208306_209074_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AYE43827.1|209115_209463_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AYE43828.1|209539_210022_-	OmpA family protein	NA	NA	NA	NA	NA
AYE43829.1|211148_211949_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
AYE43830.1|211945_213118_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
AYE43831.1|213191_213332_-	diguanylate cyclase	NA	NA	NA	NA	NA
AYE43832.1|213398_214554_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AYE43833.1|214654_215173_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AYE43834.1|215322_215688_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
AYE43835.1|215896_216967_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
AYE43836.1|216977_218099_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AYE43837.1|218141_219302_-	P-protein	NA	NA	NA	NA	NA
AYE47979.1|219401_219449_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43838.1|219552_219894_-	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AYE43839.1|219928_220144_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43840.1|220153_221482_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AYE43841.1|221549_222581_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	97.6	1.1e-193
AYE43842.1|222705_222888_-	hypothetical protein	NA	Q8W630	Enterobacteria_phage	98.3	2.9e-25
AYE43843.1|222899_224633_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	99.5	0.0e+00
AYE43844.1|224629_225133_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	6.7e-88
AYE43845.1|225245_225596_-	HNH endonuclease	NA	Q8W633	Enterobacteria_phage	99.1	4.7e-64
AYE43846.1|225638_226106_-|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	99.4	6.1e-75
AYE43847.1|226102_226600_-	lysozyme	NA	A5LH83	Enterobacteria_phage	100.0	1.3e-91
AYE43848.1|226599_226815_-|holin	holin	holin	M1FN85	Enterobacteria_phage	91.5	4.2e-31
AYE43849.1|227995_228559_-	ORF6N domain-containing protein	NA	Q8HA19	Enterobacteria_phage	56.9	2.6e-40
AYE43850.1|228810_229035_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43851.1|229039_229426_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.9	1.1e-58
AYE43852.1|229415_229787_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.0	8.0e-38
AYE43853.1|229786_230029_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	95.0	3.9e-33
AYE43854.1|230040_231432_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	96.8	7.0e-260
AYE43855.1|231547_232776_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	6.3e-172
AYE47980.1|232851_234231_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYE43856.1|234569_234788_-	DNA invertase	NA	A0A1S6L009	Salmonella_phage	70.0	4.6e-09
AYE43857.1|235141_236620_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43858.1|238377_239805_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
AYE43859.1|239791_240478_+	hypothetical protein	NA	NA	NA	NA	NA
AYE47981.1|240619_240808_+	DNA-binding protein	NA	NA	NA	NA	NA
AYE43860.1|240818_241481_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AYE43861.1|241473_241794_+	hypothetical protein	NA	NA	NA	NA	NA
AYE43862.1|241800_242100_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AYE43863.1|242096_243914_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.4	5.7e-129
AYE43864.1|244411_244621_+	hypothetical protein	NA	NA	NA	NA	NA
AYE43865.1|244617_246531_+	peptidase	NA	S5M7Q8	Escherichia_phage	57.1	1.0e-213
AYE43866.1|247572_248058_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	66.9	3.9e-48
AYE43867.1|248060_248342_+	hypothetical protein	NA	NA	NA	NA	NA
AYE43868.1|250061_250565_-|transposase	IS1 family transposase	transposase	U5P0U6	Shigella_phage	98.8	1.1e-93
AYE43869.1|250483_250759_-|transposase	IS1 family transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
>prophage 3
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	284677	377526	5032769	head,plate,tRNA,transposase,protease,tail	Shigella_phage(43.75%)	101	NA	NA
AYE43903.1|284677_287308_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
AYE43904.1|287435_287936_-	recombination regulator RecX	NA	NA	NA	NA	NA
AYE43905.1|288163_289225_-	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
AYE43906.1|289304_289802_-	nicotinamide-nucleotide amidohydrolase PncC	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
AYE43907.1|289946_291032_-	murein transglycosylase	NA	NA	NA	NA	NA
AYE43908.1|291287_291851_+	glucitol/sorbitol permease IIC component	NA	NA	NA	NA	NA
AYE43909.1|291847_292807_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
AYE43910.1|292817_293189_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
AYE43911.1|294066_294426_+	glucitol operon activator protein	NA	NA	NA	NA	NA
AYE43912.1|294492_295266_+	DNA-binding transcriptional repressor	NA	NA	NA	NA	NA
AYE43913.1|295258_296224_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
AYE43914.1|296220_297735_-	NorR family transcriptional regulator	NA	NA	NA	NA	NA
AYE43915.1|297921_299361_+	anaerobic nitric oxide reductase flavorubredoxin	NA	NA	NA	NA	NA
AYE43916.1|299357_300491_+	NADH:flavorubredoxin reductase NorW	NA	NA	NA	NA	NA
AYE43917.1|300618_302871_-	carbamoyltransferase HypF	NA	NA	NA	NA	NA
AYE43918.1|303023_303551_-	electron transporter HydN	NA	NA	NA	NA	NA
AYE47982.1|303697_304708_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
AYE43919.1|304967_306425_+	PTS cellobiose/arbutin/salicin transporter subunit IIBC	NA	NA	NA	NA	NA
AYE47983.1|306433_307858_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AYE43920.1|307971_308391_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYE43921.1|308387_308699_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYE43922.1|308860_309634_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43923.1|309658_310129_-	hydrogenase 3 maturation endopeptidase HyCI	NA	NA	NA	NA	NA
AYE43924.1|310121_310532_-	formate hydrogenlyase maturation protein HycH	NA	NA	NA	NA	NA
AYE43925.1|310528_311296_-	NADH-quinone oxidoreductase subunit NuoB	NA	NA	NA	NA	NA
AYE43926.1|311295_311838_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AYE43927.1|311847_313545_-	hydrogenase large subunit	NA	NA	NA	NA	NA
AYE43928.1|313562_314486_-	hydrogenase 3 membrane subunit	NA	NA	NA	NA	NA
AYE43929.1|315738_316476_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	77.3	1.4e-102
AYE43930.1|316429_316630_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYE47984.1|316919_317180_+	hypothetical protein	NA	NA	NA	NA	NA
AYE43931.1|317347_317602_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
AYE43932.1|317637_317820_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	52.6	5.0e-09
AYE43933.1|317964_320019_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	65.1	1.1e-234
AYE47985.1|320323_320845_+|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	46.2	1.5e-42
AYE43934.1|320876_321758_-|tail	phage tail protein	tail	C9DGQ8	Escherichia_phage	39.9	1.6e-28
AYE43935.1|321757_322318_-	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	49.7	6.0e-45
AYE43936.1|322308_323391_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.4e-98
AYE43937.1|323390_323828_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	56.9	7.7e-40
AYE43938.1|323820_324435_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	50.8	5.6e-52
AYE43939.1|324424_325549_-|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	47.4	1.7e-94
AYE43940.1|325532_326891_-	multidrug DMT transporter permease	NA	A0A0C4UR32	Shigella_phage	30.1	9.8e-49
AYE43941.1|326877_328935_-|tail	tail tape measure protein	tail	A0A0C4UQU8	Shigella_phage	38.9	1.1e-75
AYE43942.1|329062_329542_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	49.2	2.3e-21
AYE43943.1|329556_329922_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYE43944.1|329930_331433_-|tail	phage tail protein	tail	A0A0C4UQS0	Shigella_phage	51.1	1.2e-132
AYE43945.1|331432_331711_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AYE43946.1|331714_332278_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.1	6.3e-42
AYE43947.1|332274_332694_-	DUF1320 domain-containing protein	NA	A0A0C4UR02	Shigella_phage	54.3	4.7e-34
AYE43948.1|332690_333050_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43949.1|333093_334041_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	66.9	2.7e-122
AYE43950.1|334040_335174_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	51.4	1.4e-88
AYE43951.1|335350_335824_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	4.6e-38
AYE43952.1|335945_337277_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.7	2.9e-154
AYE43953.1|337260_338850_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	7.2e-168
AYE43954.1|338849_340514_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	4.8e-231
AYE43955.1|340513_340762_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43956.1|340772_341354_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	4.2e-49
AYE43957.1|341356_341647_-	ArsR family transcriptional regulator	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
AYE43958.1|341639_341951_-	DUF2730 family protein	NA	NA	NA	NA	NA
AYE43959.1|341931_342159_-	TraR/DksA family transcriptional regulator	NA	M4MHG5	Vibrio_phage	41.2	4.2e-05
AYE43960.1|342169_342637_-	lysozyme	NA	B6SD19	Bacteriophage	50.7	7.8e-14
AYE43961.1|342834_343335_-	lysozyme	NA	B6SD29	Bacteriophage	43.2	1.3e-27
AYE43962.1|343406_343829_-	transcriptional regulator	NA	NA	NA	NA	NA
AYE43963.1|343899_344412_-	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	48.3	1.8e-27
AYE43964.1|344476_344887_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
AYE43965.1|344848_345157_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43966.1|345172_345523_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43967.1|345519_345849_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43968.1|345845_346397_-	AsnC family protein	NA	NA	NA	NA	NA
AYE43969.1|346400_346916_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	9.1e-48
AYE43970.1|346915_347449_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	68.4	3.7e-68
AYE43971.1|347594_348125_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	2.5e-48
AYE43972.1|348136_348430_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43973.1|348434_348707_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43974.1|348703_348985_-	host nuclease inhibitor protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
AYE43975.1|348986_349241_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43976.1|349253_349475_-	hypothetical protein	NA	NA	NA	NA	NA
AYE43977.1|349477_350410_-	transcriptional regulator	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
AYE43978.1|350485_352576_-|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	1.8e-166
AYE43979.1|352586_352853_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	46.0	1.4e-07
AYE43980.1|353009_353621_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYE43981.1|354682_355294_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AYE43982.1|355418_355880_-	formate hydrogenlyase regulatory protein HycA	NA	NA	NA	NA	NA
AYE47986.1|356091_356442_+	protein HypA	NA	NA	NA	NA	NA
AYE43983.1|356445_357318_+	hydrogenase isoenzymes nickel incorporation protein HypB	NA	NA	NA	NA	NA
AYE43984.1|357308_357581_+	hydrogenase assembly protein HypC	NA	NA	NA	NA	NA
AYE43985.1|357580_358702_+	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
AYE43986.1|358698_359709_+	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
AYE43987.1|361896_362250_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
AYE43988.1|362536_365098_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
AYE43989.1|366687_367455_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	4.3e-70
AYE43990.1|367650_368559_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	8.6e-118
AYE43991.1|368555_369818_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	1.4e-134
AYE43992.1|369814_370453_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AYE43993.1|370457_371234_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AYE43994.1|371322_372687_+	GntP family transporter	NA	NA	NA	NA	NA
AYE43995.1|373835_374975_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AYE43996.1|375114_375741_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AYE43997.1|375734_376496_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AYE43998.1|376476_377526_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 4
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	386032	436404	5032769	tRNA,transposase	Acinetobacter_phage(37.5%)	40	NA	NA
AYE44008.1|386032_387229_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYE44009.1|387223_387418_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
AYE44010.1|387399_388146_-	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
AYE44011.1|388156_389212_-	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
AYE44012.1|389223_389760_-	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
AYE44013.1|391086_393786_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
AYE44014.1|393980_394133_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
AYE44015.1|394397_395132_-	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
AYE44016.1|395206_396919_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
AYE44017.1|396918_398718_-	NADPH-dependent assimilatory sulfite reductase flavoprotein subunit	NA	NA	NA	NA	NA
AYE44018.1|399033_399399_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AYE44019.1|399476_400748_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AYE44020.1|400738_400999_+	ferredoxin family protein	NA	NA	NA	NA	NA
AYE44021.1|401015_401591_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
AYE44022.1|401738_402599_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
AYE44023.1|402595_403375_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
AYE44024.1|403352_404690_-	MFS transporter	NA	NA	NA	NA	NA
AYE44025.1|404783_406238_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AYE44026.1|407441_408719_+	MFS transporter	NA	NA	NA	NA	NA
AYE44027.1|411980_412652_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
AYE44028.1|412790_412901_+	hypothetical protein	NA	NA	NA	NA	NA
AYE44029.1|412952_414006_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.3	1.7e-61
AYE44030.1|414058_414361_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE44031.1|414306_414783_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.4	4.4e-20
AYE44032.1|414839_415995_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	2.6e-66
AYE44033.1|416105_416855_+	YgcG family protein	NA	NA	NA	NA	NA
AYE44034.1|417871_419200_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AYE44035.1|419254_420553_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
AYE44036.1|420640_422278_-	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
AYE44037.1|422505_423297_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AYE44038.1|423367_423703_-	mRNA interferase MazF	NA	NA	NA	NA	NA
AYE44039.1|423702_423951_-	MazF-MazE toxin-antitoxin system antitoxin MazE	NA	NA	NA	NA	NA
AYE44040.1|424036_426271_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AYE44041.1|426318_427620_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	1.7e-37
AYE44042.1|427676_430433_+	signal transduction histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
AYE44043.1|430664_432005_-	glucarate dehydratase	NA	NA	NA	NA	NA
AYE44044.1|432025_433366_-	glucarate dehydratase-related protein	NA	NA	NA	NA	NA
AYE44045.1|433367_434720_-	MFS transporter	NA	NA	NA	NA	NA
AYE44046.1|435154_435604_-	flavodoxin	NA	NA	NA	NA	NA
AYE44047.1|435621_436404_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
>prophage 5
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	593560	637997	5032769	tRNA,protease,transposase	Staphylococcus_phage(50.0%)	39	NA	NA
AYE44174.1|593560_594319_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYE44175.1|594461_595382_-	agmatinase	NA	NA	NA	NA	NA
AYE44176.1|595519_597496_-	arginine decarboxylase	NA	NA	NA	NA	NA
AYE44177.1|597504_597636_-	virulence promoting factor	NA	NA	NA	NA	NA
AYE44178.1|597771_597987_+	hypothetical protein	NA	NA	NA	NA	NA
AYE44179.1|597983_598235_-	DUF2684 family protein	NA	NA	NA	NA	NA
AYE44180.1|598290_599445_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
AYE44181.1|599880_601275_+	galactose-proton symporter	NA	NA	NA	NA	NA
AYE44182.1|601351_601849_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
AYE44183.1|601943_602651_+	endonuclease-1	NA	NA	NA	NA	NA
AYE44184.1|602730_603462_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYE44185.1|603474_604425_+	glutathione synthetase	NA	NA	NA	NA	NA
AYE44186.1|604533_605097_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
AYE44187.1|605096_605513_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AYE44188.1|605687_606668_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
AYE44189.1|606685_607390_+	YggS family pyridoxal phosphate enzyme	NA	NA	NA	NA	NA
AYE44190.1|607407_607974_+	YggT family protein	NA	NA	NA	NA	NA
AYE44191.1|607970_608261_+	YggU family protein	NA	NA	NA	NA	NA
AYE44192.1|608268_608862_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
AYE44193.1|608854_609991_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
AYE44194.1|610301_611288_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE44195.1|611332_611548_+	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
AYE44196.1|613001_614033_-|transposase	IS630 family transposase IS630	transposase	NA	NA	NA	NA
AYE44197.1|617628_618675_-	L-asparaginase 2	NA	NA	NA	NA	NA
AYE44198.1|618850_619570_-	DUF2884 family protein	NA	NA	NA	NA	NA
AYE44199.1|619753_620080_-	DUF469 domain-containing protein	NA	NA	NA	NA	NA
AYE44200.1|620079_620799_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AYE44201.1|620959_622012_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYE44202.1|622039_622315_+	Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
AYE44203.1|622379_623459_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
AYE44204.1|623660_624917_+	nucleoside permease NupG	NA	NA	NA	NA	NA
AYE44205.1|625350_626478_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
AYE44206.1|626674_628612_-	ornithine decarboxylase	NA	NA	NA	NA	NA
AYE44207.1|628783_628909_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AYE44208.1|629019_629727_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AYE44209.1|631214_632234_+|transposase	IS110 family transposase ISEc11	transposase	NA	NA	NA	NA
AYE44210.1|632909_633173_-	hypothetical protein	NA	NA	NA	NA	NA
AYE44211.1|633261_636777_+	DNA helicase	NA	NA	NA	NA	NA
AYE44212.1|636841_637997_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 6
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	1177799	1186488	5032769	transposase	uncultured_Caudovirales_phage(42.86%)	8	NA	NA
AYE44695.1|1177799_1178153_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
AYE44696.1|1178206_1179496_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
AYE44697.1|1179508_1179934_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
AYE44698.1|1180067_1180364_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYE44699.1|1180835_1182008_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
AYE44700.1|1182004_1182805_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
AYE44701.1|1183868_1185024_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE44702.1|1185215_1186488_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 7
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	1247096	1288240	5032769	transposase	Escherichia_phage(44.44%)	38	NA	NA
AYE44750.1|1247096_1248305_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.8	1.6e-207
AYE44751.1|1248553_1249003_-	hypothetical protein	NA	NA	NA	NA	NA
AYE44752.1|1249111_1249459_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
AYE44753.1|1249448_1249811_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
AYE44754.1|1249807_1250305_+	radical SAM protein	NA	NA	NA	NA	NA
AYE44755.1|1250312_1251497_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
AYE44756.1|1251776_1251866_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AYE44757.1|1251998_1252157_-	hypothetical protein	NA	NA	NA	NA	NA
AYE44758.1|1252153_1252444_-	hypothetical protein	NA	NA	NA	NA	NA
AYE44759.1|1252430_1252529_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AYE44760.1|1252634_1254323_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.4	6.0e-56
AYE44761.1|1254326_1254617_+	acetolactate synthase isozyme 1 small subunit	NA	NA	NA	NA	NA
AYE44762.1|1254691_1255282_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYE44763.1|1255281_1256784_+	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
AYE44764.1|1256793_1258113_+	MFS transporter family glucose-6-phosphate receptor UhpC	NA	NA	NA	NA	NA
AYE44765.1|1258250_1259642_+	hexose phosphate transporter	NA	NA	NA	NA	NA
AYE44766.1|1259686_1261453_-	adenine deaminase	NA	NA	NA	NA	NA
AYE44767.1|1261549_1261738_+	sulfate permease	NA	NA	NA	NA	NA
AYE44768.1|1263414_1263867_+	DUF1198 domain-containing protein	NA	NA	NA	NA	NA
AYE44769.1|1263887_1264079_-	hypothetical protein	NA	NA	NA	NA	NA
AYE44770.1|1265298_1265592_-	hypothetical protein	NA	NA	NA	NA	NA
AYE48015.1|1265628_1265817_+	hypothetical protein	NA	NA	NA	NA	NA
AYE44771.1|1265813_1266581_+	lipoprotein NlpA	NA	NA	NA	NA	NA
AYE44772.1|1267343_1267550_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	91.2	9.3e-28
AYE44773.1|1267565_1267964_-	hypothetical protein	NA	A0A0N7C1X7	Escherichia_phage	97.6	9.1e-64
AYE44774.1|1268049_1268325_-	hypothetical protein	NA	A0A0N7C1Z2	Escherichia_phage	94.5	3.6e-43
AYE48016.1|1268288_1269185_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.3	1.3e-60
AYE44775.1|1269689_1269980_-	hypothetical protein	NA	NA	NA	NA	NA
AYE44776.1|1271500_1271698_+	hypothetical protein	NA	NA	NA	NA	NA
AYE44777.1|1271683_1273963_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AYE44778.1|1273884_1275222_-	lysine 6-monooxygenase	NA	NA	NA	NA	NA
AYE44779.1|1275218_1276961_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
AYE44780.1|1276960_1277908_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYE48017.1|1277908_1279696_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
AYE44781.1|1279768_1280962_+	MFS transporter	NA	NA	NA	NA	NA
AYE44782.1|1280911_1281838_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE44783.1|1283353_1284510_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE44784.1|1287067_1288240_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.7	4.9e-230
>prophage 8
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	1348279	1416282	5032769	tRNA,transposase	Acidithiobacillus_phage(18.18%)	59	NA	NA
AYE44835.1|1348279_1348753_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
AYE44836.1|1348948_1350139_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AYE44837.1|1350135_1350912_-	transcriptional regulator LldR	NA	NA	NA	NA	NA
AYE44838.1|1350911_1352567_-	L-lactate permease	NA	NA	NA	NA	NA
AYE44839.1|1357827_1358379_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
AYE44840.1|1358870_1358963_+	IS1 encoded protein	NA	NA	NA	NA	NA
AYE44841.1|1359048_1359411_-	YibL family ribosome-associated protein	NA	NA	NA	NA	NA
AYE44842.1|1359695_1359905_+	hypothetical protein	NA	NA	NA	NA	NA
AYE44843.1|1359916_1360504_-	MltR family transcriptional regulator	NA	NA	NA	NA	NA
AYE44844.1|1360503_1361652_-	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AYE44845.1|1361881_1363795_-	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
AYE44846.1|1364331_1364694_+	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
AYE44847.1|1364832_1365507_-|transposase	transposase	transposase	K4HZD4	Acidithiobacillus_phage	37.9	4.9e-33
AYE44848.1|1365523_1367059_-|transposase	IS21-like element ISSso4 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	1.7e-102
AYE44849.1|1367231_1368395_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AYE44850.1|1368854_1369292_-	hypothetical protein	NA	NA	NA	NA	NA
AYE44851.1|1373783_1374392_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYE44852.1|1374489_1375881_+|tRNA	L-selenocysteinyl-tRNA(Sec) synthase	tRNA	NA	NA	NA	NA
AYE44853.1|1375877_1377722_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2H4UTS4	Bodo_saltans_virus	29.0	6.9e-05
AYE44854.1|1378538_1379861_+	xylose isomerase	NA	NA	NA	NA	NA
AYE44855.1|1379932_1380244_+	hypothetical protein	NA	NA	NA	NA	NA
AYE44856.1|1381698_1382040_+	hypothetical protein	NA	NA	NA	NA	NA
AYE44857.1|1382085_1382271_+	hypothetical protein	NA	NA	NA	NA	NA
AYE44858.1|1382241_1383515_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AYE44859.1|1383753_1384909_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE44860.1|1384958_1385126_+	hypothetical protein	NA	NA	NA	NA	NA
AYE44861.1|1385167_1386163_-	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
AYE44862.1|1386402_1387434_-|transposase	IS630 family transposase IS630	transposase	NA	NA	NA	NA
AYE44863.1|1387519_1387792_+	hypothetical protein	NA	NA	NA	NA	NA
AYE44864.1|1387886_1388798_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AYE44865.1|1388807_1390877_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYE44866.1|1391202_1391355_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AYE44867.1|1391542_1391755_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
AYE44868.1|1392035_1392326_-	transcriptional regulator	NA	NA	NA	NA	NA
AYE44869.1|1392759_1393470_+	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
AYE44870.1|1393519_1394494_-	bifunctional glyoxylate/hydroxypyruvate reductase B	NA	NA	NA	NA	NA
AYE44871.1|1394597_1395257_-	OmpA family lipoprotein	NA	NA	NA	NA	NA
AYE44872.1|1396677_1399011_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.8	3.7e-72
AYE44873.1|1398979_1399420_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYE44874.1|1399416_1399980_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
AYE44875.1|1400137_1400836_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AYE44876.1|1400891_1401071_-	hypothetical protein	NA	NA	NA	NA	NA
AYE44877.1|1401064_1402273_+	oxalate/formate antiport family MFS transporter	NA	NA	NA	NA	NA
AYE48019.1|1402596_1404288_+	phosphoethanolamine transferase EptB	NA	NA	NA	NA	NA
AYE44878.1|1404678_1405017_+	hypothetical protein	NA	NA	NA	NA	NA
AYE44879.1|1405368_1406976_+	periplasmic dipeptide transporter	NA	NA	NA	NA	NA
AYE44880.1|1407038_1407266_-	hypothetical protein	NA	NA	NA	NA	NA
AYE44881.1|1407283_1408303_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYE44882.1|1408312_1409215_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYE44883.1|1409225_1410209_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.7e-15
AYE44884.1|1410205_1411210_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	7.0e-20
AYE44885.1|1411239_1412511_-	transporter	NA	NA	NA	NA	NA
AYE44886.1|1412660_1412822_+	hypothetical protein	NA	NA	NA	NA	NA
AYE48020.1|1412986_1413094_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
AYE44887.1|1413469_1413577_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
AYE44888.1|1413861_1414059_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
AYE44889.1|1414434_1414542_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
AYE44890.1|1414827_1415025_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
AYE44891.1|1415126_1416282_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
>prophage 9
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	1893555	1961378	5032769	tRNA,protease,transposase	Acinetobacter_phage(21.43%)	57	NA	NA
AYE45269.1|1893555_1894828_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	4.0e-177
AYE45270.1|1895367_1895547_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45271.1|1897080_1898727_-	class I fumarate hydratase	NA	NA	NA	NA	NA
AYE45272.1|1898804_1900145_-	anaerobic C4-dicarboxylate transporter DcuB	NA	NA	NA	NA	NA
AYE45273.1|1900715_1901435_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
AYE45274.1|1901431_1903063_-	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
AYE45275.1|1903243_1903474_+	4Fe-4S mono-cluster protein YjdI	NA	NA	NA	NA	NA
AYE45276.1|1903485_1903758_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYE45277.1|1903984_1904281_+	endoribonuclease GhoS	NA	NA	NA	NA	NA
AYE45278.1|1904308_1904482_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
AYE45279.1|1904600_1906118_-|tRNA	lysine--tRNA ligase heat inducible	tRNA	A0A1V0SAC0	Catovirus	38.0	1.6e-87
AYE45280.1|1906354_1907812_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.4	5.2e-48
AYE45281.1|1908945_1910101_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AYE45282.1|1911555_1912829_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AYE45283.1|1913967_1914315_-	calcium-binding protein	NA	NA	NA	NA	NA
AYE45284.1|1914426_1915582_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE48041.1|1915687_1917016_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AYE45285.1|1920196_1920415_+	hypothetical protein	NA	NA	NA	NA	NA
AYE45286.1|1920708_1921284_-	transcriptional regulator	NA	NA	NA	NA	NA
AYE45287.1|1921320_1923018_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
AYE45288.1|1922993_1923332_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AYE45289.1|1923447_1924749_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
AYE45290.1|1924866_1926303_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
AYE45291.1|1926639_1927110_+	membrane protein FxsA	NA	NA	NA	NA	NA
AYE45292.1|1927131_1928388_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
AYE45293.1|1928663_1928957_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
AYE45294.1|1929000_1930647_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
AYE45295.1|1930784_1931138_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AYE45296.1|1931340_1932210_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45297.1|1932599_1933628_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
AYE45298.1|1933669_1934236_+	elongation factor P	NA	NA	NA	NA	NA
AYE45299.1|1934287_1934413_+	entericidin A	NA	NA	NA	NA	NA
AYE45300.1|1934523_1934670_+	entericidin B	NA	NA	NA	NA	NA
AYE45301.1|1934844_1935162_+	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
AYE45302.1|1935158_1935692_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
AYE45303.1|1935780_1936914_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
AYE45304.1|1936976_1937336_-	fumarate reductase subunit D	NA	NA	NA	NA	NA
AYE45305.1|1937346_1937742_-	fumarate reductase subunit C	NA	NA	NA	NA	NA
AYE45306.1|1937752_1938487_-	fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AYE45307.1|1938479_1940288_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
AYE45308.1|1940612_1941590_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
AYE45309.1|1941808_1941997_+	transporter	NA	NA	NA	NA	NA
AYE45310.1|1942720_1944088_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
AYE45311.1|1944238_1947562_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
AYE45312.1|1947583_1948552_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AYE45313.1|1948648_1949701_-	ribosome small subunit-dependent GTPase	NA	NA	NA	NA	NA
AYE45314.1|1949795_1950341_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
AYE48042.1|1950971_1951025_+	hypothetical protein	NA	NA	NA	NA	NA
AYE45315.1|1951007_1952147_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AYE45316.1|1952145_1953693_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AYE45317.1|1953664_1954126_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
AYE45318.1|1954144_1955482_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
AYE45319.1|1955491_1957339_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
AYE45320.1|1957331_1958282_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AYE45321.1|1958367_1958676_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AYE45322.1|1958752_1960033_+	GTPase HflX	NA	NA	NA	NA	NA
AYE45323.1|1960118_1961378_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	1.2e-05
>prophage 10
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	2015594	2078874	5032769	tRNA,protease,integrase,transposase	Enterobacteria_phage(16.67%)	52	2032662:2032721	2080997:2081765
AYE45376.1|2015594_2016947_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AYE45377.1|2017130_2017517_+	soluble cytochrome b562	NA	NA	NA	NA	NA
AYE45378.1|2017561_2018026_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
AYE45379.1|2018183_2020322_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	1.1e-264
AYE45380.1|2020715_2022371_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AYE45381.1|2022420_2023842_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AYE45382.1|2023960_2024908_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
AYE48044.1|2025092_2025146_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
AYE45383.1|2025286_2027983_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
AYE45384.1|2028188_2028575_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AYE45385.1|2028647_2029109_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AYE45386.1|2029121_2030057_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.2e-52
AYE45387.1|2030060_2030195_-	pyrBI operon leader peptide	NA	NA	NA	NA	NA
AYE45388.1|2030324_2030507_+	hypothetical protein	NA	NA	NA	NA	NA
AYE45389.1|2030475_2030871_-	RidA family protein	NA	NA	NA	NA	NA
AYE45390.1|2031001_2031715_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYE45391.1|2031785_2032379_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
2032662:2032721	attL	CGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGG	NA	NA	NA	NA
AYE45392.1|2035285_2036305_+	hypothetical protein	NA	NA	NA	NA	NA
AYE45393.1|2036376_2037381_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AYE45394.1|2037542_2037959_+	regulator of ribonuclease activity B	NA	NA	NA	NA	NA
AYE45395.1|2038004_2038508_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYE45396.1|2039049_2040222_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
AYE45397.1|2040218_2041019_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
AYE45398.1|2041490_2042687_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
AYE45399.1|2042742_2045598_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
AYE48045.1|2045597_2046041_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AYE45400.1|2046174_2047686_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AYE45401.1|2047952_2049053_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AYE45402.1|2049052_2050135_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AYE45403.1|2050253_2051756_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	1.8e-83
AYE45404.1|2052656_2053976_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
AYE45405.1|2054040_2054805_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AYE45406.1|2054828_2055860_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
AYE45407.1|2056076_2056640_+	gluconokinase	NA	NA	NA	NA	NA
AYE45408.1|2056643_2057663_-	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	9.3e-44
AYE45409.1|2058676_2059833_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE45410.1|2060110_2061278_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AYE45411.1|2061794_2062562_-	iron-dicitrate ABC transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	24.3	1.4e-12
AYE45412.1|2062562_2063519_-	iron-dicitrate ABC transporter permease FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.8e-17
AYE45413.1|2063515_2064514_-	Fe3+ dicitrate ABC transporter permease	NA	NA	NA	NA	NA
AYE45414.1|2064510_2065413_-	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AYE45415.1|2065457_2067782_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AYE45416.1|2067868_2068822_-	fec operon regulator FecR	NA	NA	NA	NA	NA
AYE45417.1|2068818_2069340_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AYE45418.1|2070422_2071119_+|transposase	IS1-like element IS1A family transposase	transposase	A0A077SLN4	Escherichia_phage	98.7	1.4e-131
AYE45419.1|2071867_2072125_+	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
AYE45420.1|2073189_2074170_-	sialate O-acetylesterase	NA	Q08JA2	Stx2-converting_phage	56.6	2.7e-101
AYE45421.1|2074234_2075341_-	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
AYE45422.1|2075360_2076077_-	N-acetylneuraminic acid outer membrane channel protein NanC	NA	NA	NA	NA	NA
AYE45423.1|2076441_2076591_+	hypothetical protein	NA	NA	NA	NA	NA
AYE45424.1|2077751_2078045_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45425.1|2078304_2078874_+|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	53.5	9.4e-54
2080997:2081765	attR	CCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCGTAACAGCCATTATGCATATTTAAACCTACAGAGTGGGCTAAATATTGGTGCGTGGCGTTTACGCGACAATACCACCTGGAGTTATAACAGTAGCGACAGTTCATCAGGTAGCAAAAATAAATGGCAGCATATCAATACCTGGCTTGAGCGAGACATAATTCCGTTACGTTCCCGGCTGACGCTGGGTGATGGTTATACCCAGGGCGATATTTTCGATGGTATTAACTTTCGCGGCGCACAATTGGCCTCAGATGACAATATGTTACCCGATAGCCAAAGAGGATTTGCCCCGGTGATCCACGGTATTGCTCGTGGTACTGCACAGGTCACTATTAAACAAAATGGGTATGACATTTATAATAGTACGGTGCCGCCGGGGCCTTTTACCATCAACGATATCTATGCCGCAGGTAATAGTGGTGACTTGCAGGTAACGATTAAAGAGGCTGACGGCAGCACGCAGATCTTTACCGTACCCTATTCGTCAGTCCCGCTTTTGCAACGTGAAGGGCATACTCGTTATTCCATTACGGCAGGAGAATACCGTAGTGGAAATGCGCAGCAGGAAAAAACCCGCTTTTTCCAGAGTACATTACTCCACGGCCTTCCGGCTGGCTGGACAATATATGGTGGAACGCAACTGGCGGATCGTTATCGTGCGTTTAATTTCGGTATCGGGAAAAACATGGGGGCACTGGGCGCTCTGTCT	NA	NA	NA	NA
>prophage 11
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	2355768	2500027	5032769	plate,tRNA,transposase,holin,protease	Shigella_phage(11.54%)	118	NA	NA
AYE45646.1|2355768_2357193_+|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
AYE45647.1|2357347_2358505_+	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
AYE45648.1|2358593_2358980_-	DUF3461 family protein	NA	NA	NA	NA	NA
AYE45649.1|2359141_2359954_-	phosphodiesterase YaeI	NA	NA	NA	NA	NA
AYE45650.1|2360008_2360833_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AYE45651.1|2360863_2363536_-	bifunctional uridylyltransferase/uridylyl-removing protein	NA	NA	NA	NA	NA
AYE45652.1|2363597_2364392_-	methionine aminopeptidase	NA	NA	NA	NA	NA
AYE45653.1|2364759_2365485_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
AYE45654.1|2365742_2366594_+	elongation factor Ts	NA	NA	NA	NA	NA
AYE45655.1|2366740_2367466_+	UMP kinase	NA	NA	NA	NA	NA
AYE45656.1|2367757_2368315_+	ribosome-recycling factor	NA	NA	NA	NA	NA
AYE45657.1|2368406_2369603_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AYE45658.1|2369791_2370550_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
AYE45659.1|2370562_2371420_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AYE45660.1|2371431_2372784_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
AYE45661.1|2372813_2375246_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AYE45662.1|2375367_2375853_+	chaperone protein Skp	NA	NA	NA	NA	NA
AYE45663.1|2375856_2376882_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AYE45664.1|2376986_2377442_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AYE45665.1|2377445_2378234_+	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AYE45666.1|2378233_2379382_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AYE45667.1|2379378_2379975_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
AYE45668.1|2380011_2383494_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	7.4e-210
AYE45669.1|2383506_2384466_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AYE45670.1|2384514_2385843_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AYE45671.1|2386003_2388145_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
AYE45672.1|2388201_2388591_+	VOC family protein	NA	NA	NA	NA	NA
AYE45673.1|2388655_2389954_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AYE48056.1|2390002_2390257_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
AYE45674.1|2390617_2391163_+	YaeQ family protein	NA	NA	NA	NA	NA
AYE45675.1|2391594_2392305_+	copper homeostasis/adhesion lipoprotein NlpE	NA	NA	NA	NA	NA
AYE45676.1|2392459_2393284_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
AYE45677.1|2393336_2395055_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AYE45678.1|2395165_2395873_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AYE45679.1|2395869_2396274_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AYE45680.1|2396391_2397207_-	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AYE45681.1|2397246_2397900_-	methionine ABC transporter	NA	NA	NA	NA	NA
AYE45682.1|2397892_2398924_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
AYE45683.1|2399111_2399687_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AYE45684.1|2405584_2406388_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	7.1e-39
AYE45685.1|2406384_2407299_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYE45686.1|2407539_2408340_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AYE45687.1|2408806_2410079_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AYE45688.1|2411781_2412537_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AYE45689.1|2412570_2413293_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYE45690.1|2413289_2413757_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AYE48057.1|2413821_2414553_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
AYE45691.1|2415091_2415877_+	hypothetical protein	NA	NA	NA	NA	NA
AYE45692.1|2416013_2416493_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45693.1|2416502_2417444_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45694.1|2417487_2417970_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AYE45695.1|2417993_2419346_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45696.1|2422899_2424378_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AYE45697.1|2424316_2425060_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AYE45698.1|2427854_2428616_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AYE45699.1|2428620_2429952_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AYE45700.1|2429954_2430479_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AYE45701.1|2430475_2431756_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AYE45702.1|2431780_2432863_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYE45703.1|2432826_2434677_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYE45704.1|2434680_2435094_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AYE45705.1|2436626_2436851_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45706.1|2436885_2437386_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AYE45707.1|2438082_2438601_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AYE45708.1|2438633_2438771_+	hypothetical protein	NA	NA	NA	NA	NA
AYE45709.1|2438810_2440427_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	2.1e-26
AYE45710.1|2440641_2442177_+|transposase	IS21-like element ISSso4 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	1.7e-102
AYE45711.1|2442193_2442949_+	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	43.4	2.4e-44
AYE45712.1|2443671_2447889_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	1.1e-21
AYE45713.1|2450194_2450572_+	hypothetical protein	NA	NA	NA	NA	NA
AYE45714.1|2451040_2452177_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AYE45715.1|2452218_2452989_-	amidohydrolase	NA	NA	NA	NA	NA
AYE45716.1|2453142_2453616_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
AYE45717.1|2453658_2456103_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYE45718.1|2456342_2456921_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AYE45719.1|2457126_2457894_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AYE45720.1|2457864_2458605_-	transpeptidase	NA	NA	NA	NA	NA
AYE45721.1|2458760_2459039_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
AYE45722.1|2459041_2459302_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
AYE45723.1|2459511_2460261_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
AYE45724.1|2461127_2461430_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AYE45725.1|2461500_2461998_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE45726.1|2462120_2463860_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
AYE48058.1|2463819_2464590_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
AYE45727.1|2464660_2465716_+	DNA polymerase IV	NA	NA	NA	NA	NA
AYE45728.1|2465712_2466165_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYE45729.1|2466199_2466463_+	hypothetical protein	NA	NA	NA	NA	NA
AYE45730.1|2469004_2469619_+	peptide chain release factor H	NA	NA	NA	NA	NA
AYE45731.1|2469675_2471133_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
AYE45732.1|2471393_2471852_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AYE45733.1|2471943_2473188_+	esterase FrsA	NA	NA	NA	NA	NA
AYE45734.1|2473245_2473647_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
AYE45735.1|2473685_2474741_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
AYE45736.1|2475028_2476132_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AYE45737.1|2476143_2477397_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
AYE45738.1|2477645_2477960_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45739.1|2478682_2479018_+	hypothetical protein	NA	NA	NA	NA	NA
AYE45740.1|2479974_2481006_+|transposase	IS630 family transposase IS630	transposase	NA	NA	NA	NA
AYE48059.1|2482049_2482325_+|transposase	IS1 family transposase	transposase	Q71TE9	Escherichia_phage	97.8	4.5e-46
AYE45741.1|2482243_2482747_+|transposase	IS1 family transposase	transposase	U5P0U6	Shigella_phage	98.2	9.1e-93
AYE45742.1|2482748_2483720_+	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	32.7	5.6e-14
AYE45743.1|2483763_2485036_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AYE45744.1|2485282_2486167_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.4	2.8e-52
AYE45745.1|2486326_2486920_-	protein RclC	NA	NA	NA	NA	NA
AYE45746.1|2486931_2487168_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYE45747.1|2487276_2488602_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
AYE45748.1|2488827_2489682_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYE45749.1|2490209_2490929_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AYE45750.1|2490939_2492367_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AYE45751.1|2492359_2493055_+	lactate utilization protein C	NA	NA	NA	NA	NA
AYE45752.1|2493009_2493222_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45753.1|2493128_2493326_-	universal stress protein	NA	NA	NA	NA	NA
AYE45754.1|2493297_2493966_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45755.1|2494178_2495849_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	6.8e-60
AYE45756.1|2495862_2497335_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AYE45757.1|2497348_2497936_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
AYE48060.1|2497852_2498068_+	hypothetical protein	NA	NA	NA	NA	NA
AYE45758.1|2498080_2500027_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	4.3e-21
>prophage 12
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	2517173	2567091	5032769	head,plate,tail,transposase	Vibrio_phage(38.78%)	61	NA	NA
AYE45770.1|2517173_2518330_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE45771.1|2518644_2518890_+	hypothetical protein	NA	NA	NA	NA	NA
AYE45772.1|2518906_2519554_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45773.1|2520652_2523727_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.8	0.0e+00
AYE48061.1|2523849_2524932_-	lactose operon repressor	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
AYE45774.1|2525883_2527548_+	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
AYE45775.1|2527549_2528494_+	2,3-dihydroxyphenylpropionate/2, 3-dihydroxicinnamic acid 1,2-dioxygenase	NA	NA	NA	NA	NA
AYE45776.1|2528511_2529378_+	2-hydroxy-6-oxononadienedioate/2-hydroxy-6- oxononatrienedioate hydrolase	NA	NA	NA	NA	NA
AYE45777.1|2529387_2530197_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AYE45778.1|2530193_2531144_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
AYE45779.1|2531140_2532154_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	7.1e-44
AYE45780.1|2532938_2533634_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	95.7	1.1e-128
AYE45781.1|2533584_2533770_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	71.0	2.9e-20
AYE45782.1|2533894_2534521_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	70.1	3.9e-69
AYE45783.1|2534471_2535875_-|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	45.8	6.6e-40
AYE45784.1|2535861_2536407_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	72.5	5.1e-73
AYE48062.1|2536409_2537087_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	76.2	1.4e-96
AYE45785.1|2537513_2538098_-	DUF2313 domain-containing protein	NA	M4M9M8	Vibrio_phage	45.1	2.8e-45
AYE45786.1|2538082_2539159_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	50.1	6.9e-90
AYE45787.1|2539148_2539601_-	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	41.4	2.9e-21
AYE45788.1|2539597_2540134_-|plate	phage baseplate assembly protein V	plate	M4MCP6	Vibrio_phage	40.2	3.0e-25
AYE45789.1|2540124_2541195_-|tail	phage tail protein	tail	A0A2I7S9G1	Vibrio_phage	46.9	4.9e-88
AYE45790.1|2541194_2542469_-	multidrug DMT transporter	NA	A0A2I7S9E8	Vibrio_phage	39.9	2.2e-79
AYE45791.1|2542468_2544262_-|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	51.7	6.7e-122
AYE45792.1|2544348_2544744_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	44.5	1.2e-12
AYE45793.1|2544745_2545102_-|tail	phage tail protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	35.5	2.9e-13
AYE45794.1|2545111_2546587_-|tail	phage tail protein	tail	M1Q565	Vibrio_phage	55.9	1.1e-154
AYE45795.1|2546586_2546772_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AYE45796.1|2546752_2547364_-	hypothetical protein	NA	M1PJ94	Vibrio_phage	44.3	1.6e-35
AYE45797.1|2547360_2547903_-	phage morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	62.0	8.7e-57
AYE45798.1|2547902_2548340_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	48.3	7.0e-33
AYE45799.1|2548339_2548651_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45800.1|2548722_2549628_-|head	phage head protein	head	M4MB71	Vibrio_phage	57.1	1.7e-97
AYE45801.1|2549635_2550592_-	peptidase	NA	M1Q578	Vibrio_phage	47.2	1.6e-77
AYE45802.1|2550806_2551571_-	hypothetical protein	NA	M4M9M5	Vibrio_phage	60.1	1.4e-92
AYE45803.1|2551563_2553135_-	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	57.9	1.1e-157
AYE48063.1|2553131_2554658_-	hypothetical protein	NA	M1NVQ0	Vibrio_phage	68.4	6.0e-196
AYE45804.1|2554663_2555245_-	DUF3486 family protein	NA	M1PJ86	Vibrio_phage	54.5	5.5e-49
AYE45805.1|2555234_2555522_-	hypothetical protein	NA	NA	NA	NA	NA
AYE48064.1|2555524_2555812_-	ArsR family transcriptional regulator	NA	A0A0C4UR00	Shigella_phage	60.6	2.7e-25
AYE45806.1|2555817_2556123_-	DUF2730 family protein	NA	M1Q558	Vibrio_phage	38.3	3.6e-12
AYE45807.1|2556107_2556335_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
AYE45808.1|2556331_2556940_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45809.1|2556927_2557338_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45810.1|2557321_2557549_-	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	67.1	6.9e-24
AYE45811.1|2557550_2558138_-	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	39.4	1.2e-32
AYE45812.1|2558223_2558673_-	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	61.1	2.7e-40
AYE45813.1|2558669_2559221_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	79.7	1.6e-82
AYE45814.1|2559294_2559561_+	hypothetical protein	NA	Q38493	Escherichia_phage	53.5	4.7e-16
AYE45815.1|2559499_2559814_-	hypothetical protein	NA	A0A0C4UQY6	Shigella_phage	71.7	7.3e-32
AYE45816.1|2559982_2560522_-	hypothetical protein	NA	C9DGL9	Escherichia_phage	82.4	7.7e-82
AYE45817.1|2560525_2561080_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	100.0	3.4e-109
AYE45818.1|2561171_2561696_-	host-nuclease inhibitor protein Gam	NA	A0A0C4UQY5	Shigella_phage	96.6	1.4e-88
AYE45819.1|2561714_2562002_-	hypothetical protein	NA	A0A0C4UQR4	Shigella_phage	96.8	8.1e-46
AYE45820.1|2562014_2562434_-	hypothetical protein	NA	A0A0C4UR25	Shigella_phage	98.6	1.3e-76
AYE45821.1|2562448_2562712_-	hypothetical protein	NA	A0A0C4UQU1	Shigella_phage	95.4	2.2e-37
AYE45822.1|2562744_2562972_-	hypothetical protein	NA	C9DGL3	Escherichia_phage	92.0	2.5e-34
AYE45823.1|2562987_2563938_-	transcriptional regulator	NA	A0A0C4UQR3	Shigella_phage	41.0	1.5e-56
AYE45824.1|2564013_2566110_-|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	48.9	1.0e-174
AYE45825.1|2566111_2566363_-	DNA-binding protein	NA	A0A2D1GNH1	Pseudomonas_phage	51.8	3.1e-17
AYE45826.1|2566527_2567091_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	55.8	1.1e-35
>prophage 13
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	2652923	2718331	5032769	tRNA,protease,transposase	Bacillus_phage(17.65%)	57	NA	NA
AYE45906.1|2652923_2653547_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
AYE45907.1|2653672_2654947_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
AYE45908.1|2655134_2657489_+|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
AYE45909.1|2657697_2657970_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
AYE45910.1|2658161_2660033_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AYE45911.1|2660352_2661508_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE45912.1|2661915_2662314_+	long-chain acyl-CoA thioesterase FadM	NA	NA	NA	NA	NA
AYE45913.1|2662365_2663061_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
AYE45914.1|2663125_2664826_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
AYE45915.1|2664925_2665744_+	HMP-PP phosphatase	NA	NA	NA	NA	NA
AYE45916.1|2666383_2668156_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	2.0e-49
AYE45917.1|2668148_2669930_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	5.2e-42
AYE45918.1|2670110_2670449_+	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
AYE45919.1|2670478_2671765_+	ammonia channel	NA	NA	NA	NA	NA
AYE45920.1|2671813_2672674_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
AYE45921.1|2672891_2673464_+	hypothetical protein	NA	NA	NA	NA	NA
AYE45922.1|2673494_2673884_-	MGMT family protein	NA	NA	NA	NA	NA
AYE45923.1|2674184_2674538_+	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
AYE45924.1|2676291_2676762_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45925.1|2676877_2677429_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
AYE45926.1|2677599_2677818_-	hemolysin expression-modulating protein Hha	NA	NA	NA	NA	NA
AYE45927.1|2677843_2678218_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
AYE45928.1|2678763_2681913_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
AYE45929.1|2681935_2683129_-	MexE family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYE45930.1|2683270_2683918_+	transcriptional regulator	NA	NA	NA	NA	NA
AYE45931.1|2683848_2684040_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45932.1|2684045_2687408_+	mechanosensitive channel MscK	NA	NA	NA	NA	NA
AYE45933.1|2687619_2687781_-	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AYE45934.1|2687794_2688322_-	primosomal replication protein N''	NA	NA	NA	NA	NA
AYE45935.1|2688391_2688769_+	DUF454 family protein	NA	NA	NA	NA	NA
AYE45936.1|2688921_2689473_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
AYE45937.1|2689601_2691527_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
AYE45938.1|2691579_2691909_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AYE45939.1|2691908_2692514_+	recombination protein RecR	NA	NA	NA	NA	NA
AYE45940.1|2692623_2694498_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
AYE45941.1|2694678_2695323_+	adenylate kinase	NA	NA	NA	NA	NA
AYE45942.1|2695454_2696417_+	ferrochelatase	NA	NA	NA	NA	NA
AYE45943.1|2696413_2697373_-	acetylesterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	2.9e-15
AYE45944.1|2697524_2698829_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
AYE45945.1|2698961_2700638_-	Kef family K(+) transporter	NA	NA	NA	NA	NA
AYE45946.1|2701012_2702169_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
AYE45947.1|2703580_2705233_+	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
AYE45948.1|2705269_2705749_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
AYE45949.1|2705764_2706043_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45950.1|2705952_2706747_-	hypothetical protein	NA	NA	NA	NA	NA
AYE45951.1|2706884_2707226_+	addiction module antidote protein, HigA family	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
AYE45952.1|2707440_2709945_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.1	5.0e-115
AYE45953.1|2710206_2711139_+	glutaminase 1	NA	NA	NA	NA	NA
AYE45954.1|2711141_2712434_+	amino acid permease	NA	NA	NA	NA	NA
AYE45955.1|2712558_2712966_+	transcriptional regulator	NA	NA	NA	NA	NA
AYE45956.1|2712966_2713425_-	NfeD family protein	NA	NA	NA	NA	NA
AYE45957.1|2713421_2714339_-	paraslipin	NA	NA	NA	NA	NA
AYE45958.1|2714484_2715162_+	iron export ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
AYE45959.1|2715148_2715928_+	iron export permease FetB	NA	NA	NA	NA	NA
AYE45960.1|2715990_2716845_-	co-chaperone YbbN	NA	NA	NA	NA	NA
AYE45961.1|2716905_2717715_-	short-chain dehydrogenase/reductase	NA	NA	NA	NA	NA
AYE45962.1|2717704_2718331_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 14
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	2899221	3006874	5032769	head,terminase,integrase,transposase,tail,lysis	Escherichia_phage(18.18%)	99	2926466:2926502	3017612:3017648
AYE46115.1|2899221_2900757_+|transposase	IS21-like element ISSso4 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.6	3.9e-102
AYE46116.1|2900773_2901529_+	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	43.4	2.4e-44
AYE46117.1|2905829_2907248_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.2	4.0e-61
AYE46118.1|2907244_2907754_-	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AYE46119.1|2909084_2910566_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.2	3.2e-45
AYE46120.1|2910836_2911580_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AYE46121.1|2911602_2912259_+	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
AYE46122.1|2912252_2913185_+	5-oxoprolinase/urea amidolyase family protein	NA	NA	NA	NA	NA
AYE46123.1|2913174_2913909_+	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
AYE46124.1|2913944_2914736_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.5	2.2e-08
AYE46125.1|2914732_2915779_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AYE46126.1|2915930_2916992_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYE46127.1|2916988_2917720_-	molecular chaperone	NA	NA	NA	NA	NA
AYE46128.1|2920243_2920810_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYE46129.1|2921199_2922483_-	type II citrate synthase	NA	NA	NA	NA	NA
AYE46130.1|2922470_2922656_+	hypothetical protein	NA	NA	NA	NA	NA
AYE46131.1|2922919_2923159_-	hypothetical protein	NA	NA	NA	NA	NA
AYE48071.1|2923191_2923581_+	succinate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
AYE46132.1|2923574_2923922_+	succinate dehydrogenase hydrophobic membrane anchor subunit	NA	NA	NA	NA	NA
AYE46133.1|2923921_2925688_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AYE46134.1|2925703_2926420_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
2926466:2926502	attL	TGCCGGATGCGGCGTGAACGCCTTATCCGGCCTACAA	NA	NA	NA	NA
AYE46135.1|2926720_2929522_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
AYE46136.1|2929536_2930754_+	dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex	NA	NA	NA	NA	NA
AYE46137.1|2930847_2932014_+	succinyl-CoA ligase subunit beta	NA	NA	NA	NA	NA
AYE46138.1|2932013_2932883_+	succinyl-CoA ligase subunit alpha	NA	NA	NA	NA	NA
AYE46139.1|2932986_2933709_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYE48072.1|2933817_2935794_+	PTS 2-O-a-mannosyl-D-glycerate transporter subunit IIABC	NA	NA	NA	NA	NA
AYE46140.1|2938468_2938696_+	hypothetical protein	NA	NA	NA	NA	NA
AYE46141.1|2939291_2940860_+	cytochrome bd-I ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
AYE46142.1|2940875_2942015_+	cytochrome bd-I ubiquinol oxidase subunit 2	NA	NA	NA	NA	NA
AYE46143.1|2942029_2942143_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
AYE46144.1|2942142_2942436_+	cyd operon protein YbgE	NA	NA	NA	NA	NA
AYE46145.1|2942585_2942990_+	acyl-CoA thioester hydrolase YbgC	NA	NA	NA	NA	NA
AYE46146.1|2942986_2943679_+	protein TolQ	NA	NA	NA	NA	NA
AYE46147.1|2943682_2944111_+	protein TolR	NA	NA	NA	NA	NA
AYE46148.1|2944175_2945408_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AYE46149.1|2945540_2946833_+	protein TolB	NA	NA	NA	NA	NA
AYE46150.1|2946867_2947389_+	peptidoglycan-associated lipoprotein	NA	NA	NA	NA	NA
AYE46151.1|2947398_2948190_+	cell division protein CpoB	NA	NA	NA	NA	NA
AYE46152.1|2950449_2951622_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
AYE46153.1|2951618_2952419_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
AYE46154.1|2952681_2953401_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
AYE46155.1|2953397_2954339_-	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	7.5e-24
AYE46156.1|2954452_2954833_-	hypothetical protein	NA	NA	NA	NA	NA
AYE46157.1|2955148_2956201_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	8.9e-82
AYE46158.1|2956359_2957112_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AYE46159.1|2957314_2958355_-	galactose-1-epimerase	NA	NA	NA	NA	NA
AYE46160.1|2958348_2959497_-	galactokinase	NA	NA	NA	NA	NA
AYE46161.1|2959500_2960547_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AYE46162.1|2960556_2961573_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
AYE46163.1|2963363_2964152_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AYE46164.1|2964280_2964430_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
AYE46165.1|2964595_2965369_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE46166.1|2965368_2966058_+	molybdenum ABC transporter permease	NA	NA	NA	NA	NA
AYE46167.1|2966060_2967119_+	molybdenum import ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
AYE46168.1|2967119_2967248_-	hydrolase	NA	NA	NA	NA	NA
AYE46169.1|2967424_2967868_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	49.3	9.9e-35
AYE46170.1|2967945_2969101_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE46171.1|2969007_2969415_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE46172.1|2969360_2970269_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	7.4e-69
AYE46173.1|2971047_2971203_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.8e-07
AYE46174.1|2971405_2971813_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
AYE46175.1|2971889_2972117_+	transcriptional regulator	NA	NA	NA	NA	NA
AYE46176.1|2972126_2972522_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.2	1.6e-60
AYE46177.1|2973392_2974139_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	81.7	2.0e-112
AYE46178.1|2974153_2974576_+	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	76.6	5.9e-53
AYE46179.1|2974805_2975962_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE46180.1|2976425_2977091_+	hypothetical protein	NA	NA	NA	NA	NA
AYE46181.1|2977261_2977474_+	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	90.0	4.0e-26
AYE46182.1|2977723_2978011_+	hypothetical protein	NA	NA	NA	NA	NA
AYE46183.1|2978049_2978649_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	8.5e-106
AYE46184.1|2978648_2978939_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	1.5e-47
AYE46185.1|2978935_2979490_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	6.5e-68
AYE46186.1|2979758_2980927_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AYE46187.1|2981040_2981337_+	hypothetical protein	NA	NA	NA	NA	NA
AYE46188.1|2981756_2983030_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	7.5e-176
AYE46189.1|2982995_2983190_+	hypothetical protein	NA	NA	NA	NA	NA
AYE46190.1|2983098_2983596_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	96.4	3.9e-88
AYE46191.1|2983592_2984063_+|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	94.8	2.2e-72
AYE46192.1|2984151_2984661_-	DedA family protein	NA	NA	NA	NA	NA
AYE46193.1|2984858_2985623_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	53.8	5.9e-11
AYE46194.1|2985573_2986977_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.8	1.8e-186
AYE46195.1|2988333_2989077_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	84.4	5.3e-89
AYE46196.1|2989080_2990301_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	86.1	4.5e-194
AYE46197.1|2990304_2990811_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	3.7e-70
AYE46198.1|2991610_2991742_+	DNA invertase	NA	A0A0C4UR34	Shigella_phage	84.4	8.8e-08
AYE46199.1|2992001_2992997_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AYE46200.1|2993037_2993991_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYE46201.1|2994945_2997126_+	hydratase	NA	NA	NA	NA	NA
AYE46202.1|2997359_2998643_-	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
AYE46203.1|2998777_2999182_-	hypothetical protein	NA	K7PMH8	Enterobacteria_phage	98.2	1.6e-55
AYE46204.1|2999111_3000280_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AYE46205.1|3001077_3001296_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AYE46206.1|3001380_3002004_-	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	86.0	2.1e-94
AYE46207.1|3002325_3003048_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	69.7	1.5e-85
AYE46208.1|3003126_3003657_-	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	73.0	6.1e-47
AYE46209.1|3003874_3005031_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE46210.1|3005046_3006300_+|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	40.2	1.3e-63
AYE46211.1|3006250_3006874_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	5.4e-79
3017612:3017648	attR	TTGTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 15
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	3144109	3207163	5032769	tRNA,protease,transposase	Bacillus_phage(25.0%)	45	NA	NA
AYE46336.1|3144109_3144430_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AYE46337.1|3144460_3146737_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AYE48078.1|3146745_3146967_-	hypothetical protein	NA	NA	NA	NA	NA
AYE46338.1|3147483_3147702_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYE46339.1|3147986_3148691_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYE46340.1|3148732_3150454_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	2.9e-21
AYE46341.1|3150454_3152221_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	22.1	1.2e-22
AYE46342.1|3152343_3153309_-	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AYE46343.1|3153853_3154348_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
AYE46344.1|3154482_3158550_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.7e-86
AYE46345.1|3158704_3159316_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AYE46346.1|3159326_3160670_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
AYE46347.1|3160760_3162053_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AYE46348.1|3162291_3164736_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	3.9e-221
AYE46349.1|3164746_3165364_+	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AYE46350.1|3165365_3166229_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AYE46351.1|3166264_3166891_-	hydrolase	NA	NA	NA	NA	NA
AYE46352.1|3167205_3168354_+	MFS transporter	NA	NA	NA	NA	NA
AYE46353.1|3168563_3169994_+	inner membrane transporter YcaM	NA	NA	NA	NA	NA
AYE46354.1|3171779_3172370_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
AYE46355.1|3172451_3173192_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
AYE46356.1|3173383_3175666_-	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AYE46357.1|3175720_3176578_-	formate transporter FocA	NA	NA	NA	NA	NA
AYE46358.1|3176983_3178744_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AYE46359.1|3178873_3179566_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AYE46360.1|3179764_3180853_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
AYE46361.1|3180923_3182207_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AYE46362.1|3182350_3183679_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AYE46363.1|3183814_3184579_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYE46364.1|3184751_3185435_+	cytidylate kinase	NA	NA	NA	NA	NA
AYE46365.1|3185545_3187219_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AYE46366.1|3187378_3187663_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AYE46367.1|3189252_3190526_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.0e-177
AYE46368.1|3191506_3193255_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
AYE46369.1|3193251_3194238_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AYE46370.1|3194274_3195507_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYE46371.1|3195558_3195741_+	protein YcaR	NA	NA	NA	NA	NA
AYE46372.1|3195737_3196484_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AYE46373.1|3196637_3197531_+	hypothetical protein	NA	NA	NA	NA	NA
AYE46374.1|3197507_3198287_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AYE46375.1|3198422_3199208_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AYE46376.1|3199204_3200527_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AYE46377.1|3200507_3201212_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
AYE46378.1|3201211_3205672_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
AYE46379.1|3205834_3207163_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	3457783	3586017	5032769	tRNA,tail,integrase,transposase	Acinetobacter_phage(19.51%)	119	3457720:3457779	3582914:3584179
3457720:3457779	attL	TGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGCT	NA	NA	NA	NA
AYE46600.1|3457783_3458939_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE46601.1|3459674_3460831_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE46602.1|3461396_3462971_+	flagellin FliC	NA	NA	NA	NA	NA
AYE46603.1|3463135_3463855_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
AYE46604.1|3464995_3465184_+	flagellar protein FliZ	NA	NA	NA	NA	NA
AYE46605.1|3465316_3466117_+	cystine-binding periplasmic protein	NA	NA	NA	NA	NA
AYE46606.1|3466170_3467202_-|transposase	IS630 family transposase IS630	transposase	NA	NA	NA	NA
AYE46607.1|3467376_3468363_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
AYE46608.1|3468377_3469046_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYE46609.1|3469042_3469795_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	41.4	6.0e-32
AYE46610.1|3470024_3470747_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
AYE46611.1|3470813_3471038_-	DUF2594 family protein	NA	NA	NA	NA	NA
AYE46612.1|3471496_3472153_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYE46613.1|3472149_3473982_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AYE46614.1|3474038_3474587_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AYE46615.1|3475236_3475902_+	YecA family protein	NA	NA	NA	NA	NA
AYE46616.1|3475963_3477175_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
AYE46617.1|3477365_3477605_+	DUF2492 family protein	NA	NA	NA	NA	NA
AYE46618.1|3477642_3478140_-	non-heme ferritin	NA	NA	NA	NA	NA
AYE46619.1|3478164_3478371_+	hypothetical protein	NA	NA	NA	NA	NA
AYE46620.1|3478481_3480017_+|transposase	IS21-like element ISSso4 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	1.7e-102
AYE46621.1|3480033_3480789_+	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	43.4	2.4e-44
AYE46622.1|3480954_3481278_-	hypothetical protein	NA	NA	NA	NA	NA
AYE46623.1|3481540_3481627_+	stress response protein AzuC	NA	NA	NA	NA	NA
AYE46624.1|3481741_3481993_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AYE46625.1|3482071_3482575_-	non-heme ferritin	NA	NA	NA	NA	NA
AYE46626.1|3483371_3484361_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE46627.1|3484430_3485945_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
AYE46628.1|3485959_3486946_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
AYE46629.1|3487112_3487913_+	trehalose-6-phosphate phosphatase	NA	NA	NA	NA	NA
AYE46630.1|3487887_3489312_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AYE46631.1|3489318_3489747_-	universal stress protein UspC	NA	NA	NA	NA	NA
AYE46632.1|3490526_3490877_+	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
AYE46633.1|3490879_3491458_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
AYE46634.1|3491583_3492471_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AYE46635.1|3492467_3493394_+	motility protein B	NA	NA	NA	NA	NA
AYE46636.1|3493398_3495363_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
AYE46637.1|3495383_3495887_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AYE46638.1|3496031_3497693_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	7.6e-11
AYE46639.1|3497738_3499340_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	6.4e-15
AYE46640.1|3499358_3500219_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AYE46641.1|3500221_3501271_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AYE46642.1|3501285_3501675_+	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AYE46643.1|3501685_3502330_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
AYE46644.1|3505891_3507970_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AYE46645.1|3507969_3508362_+	flagellar biosynthesis protein FlhE	NA	NA	NA	NA	NA
AYE46646.1|3508481_3508970_-	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
AYE46647.1|3509146_3510883_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	34.7	1.1e-84
AYE46648.1|3511098_3511665_+	VOC family protein	NA	NA	NA	NA	NA
AYE46649.1|3511678_3512425_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AYE46650.1|3512812_3513913_+	cytochrome C	NA	NA	NA	NA	NA
AYE46651.1|3513937_3516367_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AYE46652.1|3516531_3517503_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AYE46653.1|3517499_3518243_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	2.7e-24
AYE46654.1|3518283_3518679_-	hypothetical protein	NA	NA	NA	NA	NA
AYE46655.1|3518731_3519079_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
AYE46656.1|3519665_3520217_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	40.9	8.6e-28
AYE46657.1|3520585_3521161_+	DNA methylase	NA	NA	NA	NA	NA
AYE46658.1|3521217_3522373_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE46659.1|3522537_3523356_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	3.9e-61
AYE46660.1|3524219_3524393_-	DUF1737 domain-containing protein	NA	Q5MBW4	Stx1-converting_phage	95.3	2.1e-17
AYE46661.1|3524653_3524989_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	73.8	3.4e-43
AYE46662.1|3525269_3525401_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
AYE48096.1|3525436_3525763_-	hypothetical protein	NA	NA	NA	NA	NA
AYE46663.1|3526255_3527110_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	9.7e-79
AYE46664.1|3527106_3527481_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.2	2.9e-35
AYE46665.1|3527480_3527723_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	95.0	3.5e-34
AYE46666.1|3528072_3528873_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
AYE46667.1|3528869_3530042_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
AYE48097.1|3529892_3531195_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AYE46668.1|3532497_3533451_+|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	36.7	2.0e-32
AYE46669.1|3533401_3534025_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	77.5	6.4e-80
AYE46670.1|3534024_3534204_+	hypothetical protein	NA	NA	NA	NA	NA
AYE46671.1|3534204_3535956_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
AYE46672.1|3536556_3536805_-	damage-inducible protein DinI	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
AYE46673.1|3537159_3537726_-	hydrolase	NA	NA	NA	NA	NA
AYE46674.1|3538035_3539808_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AYE46675.1|3539925_3540378_+	NUDIX pyrophosphatase	NA	NA	NA	NA	NA
AYE46676.1|3540406_3541147_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYE46677.1|3541181_3541703_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	1.0e-09
AYE46678.1|3541704_3542307_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
AYE48098.1|3542379_3542445_+	hypothetical protein	NA	NA	NA	NA	NA
AYE46679.1|3542583_3543195_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AYE46680.1|3543203_3544214_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.9	1.6e-08
AYE46681.1|3544360_3545146_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AYE46682.1|3545142_3545898_-	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AYE48099.1|3545976_3546909_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE46683.1|3546924_3548247_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	6.9e-15
AYE46684.1|3548366_3549338_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AYE46685.1|3549557_3550853_-	alpha-mannosidase	NA	NA	NA	NA	NA
AYE46686.1|3551624_3551918_-	alpha-mannosidase	NA	NA	NA	NA	NA
AYE46687.1|3551898_3553284_-	hypothetical protein	NA	NA	NA	NA	NA
AYE46688.1|3553320_3555189_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AYE48100.1|3556504_3557299_+	NGG1p interacting factor NIF3	NA	NA	NA	NA	NA
AYE46689.1|3557358_3558801_-	pyruvate kinase	NA	NA	NA	NA	NA
AYE46690.1|3558928_3559798_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AYE46691.1|3560135_3561611_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
AYE46692.1|3561845_3563657_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AYE46693.1|3563693_3564335_+	KHG/KDPG aldolase	NA	NA	NA	NA	NA
AYE46694.1|3564390_3565569_-	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
AYE46695.1|3565702_3565993_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
AYE46696.1|3566059_3566416_+	protein YebF	NA	NA	NA	NA	NA
AYE46697.1|3566742_3567402_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
AYE46698.1|3567610_3569671_+	oligopeptidase B	NA	NA	NA	NA	NA
AYE46699.1|3569667_3570330_-	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AYE46700.1|3570353_3571010_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AYE46701.1|3571111_3571342_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AYE46702.1|3571480_3571855_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AYE46703.1|3571858_3572731_+	hypothetical protein	NA	NA	NA	NA	NA
AYE46704.1|3572743_3573085_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AYE46705.1|3573477_3574554_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	1.2e-97
AYE46706.1|3575430_3576587_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE46707.1|3576743_3576971_-	exodeoxyribonuclease VIII	NA	A0A088CD28	Shigella_phage	66.7	2.0e-15
AYE46708.1|3577311_3578467_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.0e-67
AYE46709.1|3578373_3578583_+	hypothetical protein	NA	NA	NA	NA	NA
AYE46710.1|3578588_3579757_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AYE46711.1|3579835_3581542_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
AYE46712.1|3581752_3582909_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE46713.1|3584861_3586017_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.0e-67
3582914:3584179	attR	AGCTCCTTCTGATGCCATTCTATTTCAGGAAGGAGTGTCCGTTAAACTCAGGCTACCTCATAGCTTGCTTGCACCGTATTGTTCTTGTTTTTCGGTTAGTTAAACATCGTACTTCATATTTGAACGTTCTGCCGGAATGCATTATCAATAGAGGTAAAGTCGCAACCCCAAATCGTAAAGGAAACCGTAGCACGTCGTATGCAAGAACGTGCCACGGCTGGCTGATGGATGTTCGATAGCGCGAGTTTGAATGAAAATCAGCCGGAGATGATTTTACATAATTGCTACGGAATTATTCAATACAGGAATTGCTTGCGTCTGCATGGATTGACCTGAAATATTCCCGAAAATTTCTCTAAAAAACTCGAAAAAAATGGTAACTGGTTGAATGTATTAATATGCAATGGTACGTGTCAGGGATTAAAAGATGAACGTAAATTTATTTAACGCATTAATTTTAAAGGGTTTTATTGTTTGTTGACGAAAACAGGAATCGTGTTCGGTCTCTTTTTATCTGTTAAAAGCCAGAAGCATTTCCTTCGCTGACTTTATAGTCAACCATAACACACACTCTACTGTCTGAGTCCAACGTTTTTTAACATTCTTGTTAAAATTATGTGATCTTTAGCGCGGGAGGAAAATATTGATGAAACAGCCTGCGCCCGTTTATCAGAGAATTGCGGGTCATCAATGGCGACATATCTGGCTTTCTGGCGATATACACGGTTGTCTTGAGCAGTTGCGCCGCAAATTATGGCATTGTCGTTTTGATCCGTGGCGAGATTTACTTATCTCAGTGGGAGACGTTATCGATCGTGGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGACTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACATAGCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGC	NA	NA	NA	NA
>prophage 17
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	3658122	3772142	5032769	head,terminase,plate,tRNA,transposase,tail,portal,capsid,integrase	Enterobacteria_phage(58.62%)	120	3680796:3680855	3767958:3768725
AYE46780.1|3658122_3658820_-|transposase	IS1-like element IS1A family transposase	transposase	A0A077SLN4	Escherichia_phage	98.3	4.0e-131
AYE46781.1|3658979_3660020_+	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
AYE46782.1|3660136_3661480_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
AYE46783.1|3661715_3661988_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
AYE46784.1|3661953_3662361_-	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
AYE46785.1|3662447_3662723_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
AYE46786.1|3663472_3663844_+	hypothetical protein	NA	NA	NA	NA	NA
AYE48107.1|3663852_3663975_-	thiosulfate sulfurtransferase ynjE	NA	NA	NA	NA	NA
AYE46787.1|3664003_3665276_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AYE46788.1|3666562_3667216_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	4.9e-14
AYE46789.1|3668724_3669891_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE46790.1|3669900_3670449_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AYE46791.1|3670448_3671156_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
AYE46792.1|3671170_3671848_-	protein YdjY	NA	NA	NA	NA	NA
AYE46793.1|3671852_3672563_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
AYE46794.1|3672729_3673536_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AYE46795.1|3673981_3675202_+	succinylornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.6	2.5e-27
AYE46796.1|3675198_3676233_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
AYE46797.1|3677704_3679048_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
AYE46798.1|3679040_3680009_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
AYE46799.1|3680338_3680800_+	ATP-independent periplasmic protein-refolding chaperone	NA	NA	NA	NA	NA
3680796:3680855	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
AYE46800.1|3681803_3682379_+	protein Ves	NA	NA	NA	NA	NA
AYE46801.1|3682338_3683226_-	nucleotide excision repair endonuclease	NA	NA	NA	NA	NA
AYE46802.1|3683455_3684283_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	5.9e-73
AYE46803.1|3684484_3684823_+	osmotically-inducible lipoprotein E	NA	NA	NA	NA	NA
AYE46804.1|3685121_3685442_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AYE46805.1|3685526_3686885_+	PTS N,N'-diacetylchitobiose transporter subunit IIC	NA	NA	NA	NA	NA
AYE46806.1|3686935_3687286_+	N,N'-diacetylchitobiose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AYE46807.1|3687293_3688136_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYE46808.1|3688240_3689593_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AYE46809.1|3689605_3690364_+	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
AYE46810.1|3690621_3692883_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
AYE46811.1|3693065_3693329_+	cell division activator CedA	NA	NA	NA	NA	NA
AYE46812.1|3694425_3695817_-	L-cystine transporter	NA	NA	NA	NA	NA
AYE46813.1|3695949_3696540_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYE46814.1|3696702_3697371_-	2-deoxyglucose-6-phosphate phosphatase	NA	NA	NA	NA	NA
AYE46815.1|3697517_3698054_+	hypothetical protein	NA	NA	NA	NA	NA
AYE46816.1|3698094_3698955_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
AYE46817.1|3699060_3699351_-	endoribonuclease GhoS	NA	NA	NA	NA	NA
AYE46818.1|3699451_3700381_-	6-phosphofructokinase II	NA	NA	NA	NA	NA
AYE46819.1|3700667_3701426_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
AYE46820.1|3701478_3701586_-	hypothetical protein	NA	NA	NA	NA	NA
AYE46821.1|3701757_3702519_-	hypothetical protein	NA	NA	NA	NA	NA
AYE46822.1|3702540_3703656_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
AYE46823.1|3704180_3706109_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
AYE46824.1|3706112_3706655_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AYE46825.1|3706751_3706949_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AYE46826.1|3707001_3707358_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AYE48108.1|3707480_3707525_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AYE46827.1|3707807_3708791_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.7	4.9e-34
AYE46828.1|3708805_3711193_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYE46829.1|3711197_3711497_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYE46830.1|3711803_3711944_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
AYE46831.1|3712134_3712395_-	hypothetical protein	NA	NA	NA	NA	NA
AYE46832.1|3712638_3714141_-	DNA-binding protein	NA	NA	NA	NA	NA
AYE46833.1|3714366_3715476_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.8e-203
AYE46834.1|3715633_3716818_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.0	1.6e-220
AYE46835.1|3716817_3717330_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	9.2e-93
AYE46836.1|3717384_3717750_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	3.2e-55
AYE46837.1|3717677_3717914_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	8.7e-22
AYE46838.1|3717900_3720708_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.4	0.0e+00
AYE46839.1|3720714_3721209_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	6.2e-86
AYE46840.1|3721244_3721832_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.5	1.0e-103
AYE46841.1|3721961_3723117_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AYE46842.1|3723203_3724190_+|tail	phage tail protein	tail	A0A0C4UQV0	Shigella_phage	98.1	7.0e-190
AYE46843.1|3724191_3724719_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.1	3.7e-89
AYE46844.1|3724921_3726078_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AYE46845.1|3726134_3726548_-|tail	tail fiber assembly protein	tail	A0A0C4UQZ5	Shigella_phage	100.0	3.8e-73
AYE46846.1|3726550_3728521_-|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	60.0	1.7e-211
AYE46847.1|3728523_3729054_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	95.7	1.2e-90
AYE46848.1|3729046_3729943_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	3.3e-154
AYE46849.1|3729946_3730297_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	96.6	1.9e-57
AYE46850.1|3730293_3730875_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	94.3	2.2e-98
AYE46851.1|3730871_3731507_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	3.4e-113
AYE46852.1|3731499_3731967_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	1.7e-85
AYE46853.1|3732038_3732512_-	hypothetical protein	NA	A0A0A7NPY2	Enterobacteria_phage	38.9	1.3e-13
AYE48109.1|3732508_3733054_-	lysozyme	NA	A0A0H4TH14	Yersinia_phage	42.5	2.2e-28
AYE46854.1|3733037_3733340_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYE46855.1|3733333_3733531_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	93.8	6.8e-28
AYE46856.1|3733530_3734025_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	9.2e-90
AYE46857.1|3734126_3734927_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	85.3	1.4e-119
AYE46858.1|3734972_3736025_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	96.0	5.2e-191
AYE46859.1|3736048_3736885_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.2	1.3e-147
AYE46860.1|3737039_3738791_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.8	0.0e+00
AYE46861.1|3738790_3739837_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AYE46862.1|3740328_3740514_-	hypothetical protein	NA	NA	NA	NA	NA
AYE46863.1|3740528_3740768_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	82.3	7.5e-29
AYE46864.1|3740764_3741289_-	hypothetical protein	NA	NA	NA	NA	NA
AYE46865.1|3741349_3741661_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	7.2e-40
AYE46866.1|3741665_3742625_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	9.9e-181
AYE48110.1|3742701_3745386_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.0	0.0e+00
AYE46867.1|3745530_3745896_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
AYE46868.1|3746037_3746283_-	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	86.4	1.0e-33
AYE46869.1|3746279_3746483_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
AYE46870.1|3746679_3746922_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AYE46871.1|3746933_3747221_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	74.7	1.6e-30
AYE46872.1|3747231_3747570_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	86.2	8.9e-52
AYE46873.1|3747584_3747863_-	DNA-binding protein	NA	NA	NA	NA	NA
AYE46874.1|3747958_3748270_+	XRE family transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	49.5	8.3e-20
AYE46875.1|3748358_3749297_+|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	5.1e-81
AYE46876.1|3749299_3749800_+	hypothetical protein	NA	NA	NA	NA	NA
AYE46877.1|3749900_3750338_+	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
AYE46878.1|3750530_3751511_+	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AYE46879.1|3751573_3752125_+	glutathione peroxidase	NA	NA	NA	NA	NA
AYE46880.1|3752124_3752874_+	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
AYE46881.1|3752951_3753416_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
AYE46882.1|3753516_3754548_+|transposase	IS630 family transposase IS630	transposase	NA	NA	NA	NA
AYE46883.1|3754817_3755531_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYE46884.1|3755593_3757030_+	YdiU family protein	NA	NA	NA	NA	NA
AYE46885.1|3757033_3757225_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
AYE46886.1|3757356_3758403_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	2.5e-84
AYE46887.1|3758559_3759393_-	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AYE46888.1|3759504_3759672_+	hypothetical protein	NA	NA	NA	NA	NA
AYE46889.1|3759725_3762104_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	2.1e-171
AYE46890.1|3764640_3764934_-	ferredoxin family protein	NA	NA	NA	NA	NA
AYE46891.1|3766275_3767214_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
AYE46892.1|3767995_3768775_-	electron transfer flavoprotein	NA	NA	NA	NA	NA
3767958:3768725	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCAGGGCTTTCTTCAGATGTTCCACCAGCTCGGCAATGGCCTCCGGCGAATCGTTATCGAGAATGATGTGCTTACGTTCTGTTTGCGGCGGTACGCGAATGCCGGTCAGTTCAGCAAGTGGCGCGCTCTGGCTCCAGCCAATATCACTTGCCTGCCACTGATTTACCGGTTTTTTACCCGCGCCGAGAATGGCTTTCATCGAAGGAATACGTGGCATGTTAATATCGGAGGTGACGCAGAGCACGGCTGGAACAGAGAGCTCAATAACTTCAACATCATCTTCAAGCGTGCGTTCAATCACCAGTGTATTGCCCTGACGCTGAATAGCACTCACTGCATTAATCACCGGAAGTTGCAGAATTTCTCCGACCAGCAAGCCAACCTGCTGGGCATAAAGGTCGCCGGAACCTTCACTAAAGATCAGTAAATCGAAGCCGATCTTTTCAACTGCTGCCGCCAGCGCCTTTGCGGTATCGAGAGGCAGTGCATGTTCAAGTTGCGCATCCTGCACCAAATACAGGCTGTGCGGCCCGCGGGATAGCACGTCTTTGCGCACTTTCGAGTTCTGCAACAATGAGCCACCAATGGTCAGCGCGGCTATCTCATCGTCATCTGTTGCAAGCTGGCTTGCAGCTTCAATGGCATTGAGATCGAACTGGCTGATTTTGGCGTCGGCATTGTCGAAATTCAGGGTGTATTCTGGAGTGACA	NA	NA	NA	NA
AYE46893.1|3768811_3768988_+	hypothetical protein	NA	NA	NA	NA	NA
AYE46894.1|3769090_3769291_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	3.9e-07
AYE46895.1|3770985_3772142_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
>prophage 18
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	3833822	3975310	5032769	tRNA,protease,transposase	Escherichia_phage(24.0%)	113	NA	NA
AYE46948.1|3833822_3835097_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
AYE46949.1|3835155_3836019_+	pyridoxal kinase	NA	NA	NA	NA	NA
AYE46950.1|3836573_3837902_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AYE46951.1|3837969_3838107_-	glutathione S-transferase	NA	NA	NA	NA	NA
AYE46952.1|3838211_3839714_-	dipeptide and tripeptide permease A	NA	NA	NA	NA	NA
AYE46953.1|3840324_3840960_-	endonuclease III	NA	NA	NA	NA	NA
AYE46954.1|3840959_3841655_-	electron transporter RsxE	NA	NA	NA	NA	NA
AYE46955.1|3841658_3842279_-	electron transport complex subunit G	NA	NA	NA	NA	NA
AYE46956.1|3842282_3843341_-	electron transport complex subunit D	NA	NA	NA	NA	NA
AYE46957.1|3843341_3845564_-	electron transporter RsxC	NA	NA	NA	NA	NA
AYE46958.1|3845556_3846135_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
AYE46959.1|3846134_3846716_-	electron transport complex subunit A	NA	NA	NA	NA	NA
AYE46960.1|3846792_3847233_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
AYE46961.1|3847318_3847534_-	nucleoid-associated protein	NA	NA	NA	NA	NA
AYE48113.1|3847798_3847924_-	division septum protein Blr	NA	NA	NA	NA	NA
AYE46962.1|3848167_3849208_+	oxidoreductase	NA	NA	NA	NA	NA
AYE46963.1|3849243_3850245_-	adenosine deaminase	NA	NA	NA	NA	NA
AYE46964.1|3850348_3851521_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AYE46965.1|3851530_3853123_-	PTS maltose- and glucose EIICB component	NA	NA	NA	NA	NA
AYE46966.1|3853297_3854326_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
AYE46967.1|3854486_3855815_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AYE46968.1|3855967_3857123_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE48114.1|3857116_3857911_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
AYE46969.1|3858131_3858722_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYE46970.1|3859110_3860922_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
AYE46971.1|3860918_3862292_+	glucuronide transporter	NA	NA	NA	NA	NA
AYE46972.1|3862330_3863641_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
AYE46973.1|3863821_3865330_-	DUF945 domain-containing protein	NA	NA	NA	NA	NA
AYE46974.1|3865430_3866606_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYE46975.1|3866804_3868451_+	fumarate hydratase	NA	NA	NA	NA	NA
AYE46976.1|3868593_3869997_+	class II fumarate hydratase	NA	NA	NA	NA	NA
AYE46977.1|3869993_3870923_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
AYE46978.1|3870998_3872300_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	5.5e-17
AYE46979.1|3872303_3873023_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYE46980.1|3873151_3873487_+	GlpM family protein	NA	NA	NA	NA	NA
AYE46981.1|3873483_3874206_-	dihydrofolate reductase FolM	NA	NA	NA	NA	NA
AYE46982.1|3874242_3875625_-	amino acid permease	NA	NA	NA	NA	NA
AYE46983.1|3875810_3876755_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYE46984.1|3877278_3878811_+	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit alpha	NA	NA	NA	NA	NA
AYE46985.1|3878821_3880210_+	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
AYE46986.1|3880234_3881269_-	AI-2 transporter TqsA	NA	NA	NA	NA	NA
AYE46987.1|3881403_3881574_+	hypothetical protein	NA	NA	NA	NA	NA
AYE46988.1|3881680_3882046_+	multidrug transporter subunit MdtJ	NA	NA	NA	NA	NA
AYE46989.1|3882032_3882362_+	spermidine export protein MdtI	NA	NA	NA	NA	NA
AYE46990.1|3882400_3883222_-|protease	serine protease	protease	NA	NA	NA	NA
AYE46991.1|3883321_3883405_-	hypothetical protein	NA	NA	NA	NA	NA
AYE46992.1|3883497_3883770_-	acid shock protein	NA	NA	NA	NA	NA
AYE46993.1|3884575_3885376_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
AYE46994.1|3885372_3886545_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
AYE46995.1|3887699_3888953_-	MFS transporter	NA	NA	NA	NA	NA
AYE46996.1|3889059_3889953_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYE46997.1|3890087_3891308_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AYE46998.1|3891432_3892128_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AYE46999.1|3892080_3893373_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AYE47000.1|3893531_3894146_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AYE47001.1|3894188_3895043_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AYE47002.1|3895044_3895662_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	8.0e-75
AYE48115.1|3895672_3898096_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	4.8e-208
AYE47003.1|3899115_3900271_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE47004.1|3901323_3901860_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYE47005.1|3901932_3903894_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.9	9.2e-24
AYE47006.1|3903985_3904216_-	DUF2554 family protein	NA	NA	NA	NA	NA
AYE48116.1|3904637_3905054_+	antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
AYE47007.1|3905132_3906539_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AYE47008.1|3906783_3907929_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AYE47009.1|3907946_3908960_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
AYE47010.1|3909850_3910645_+	ABC transporter permease	NA	NA	NA	NA	NA
AYE47011.1|3910666_3912091_+	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
AYE47012.1|3913173_3913269_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
AYE47013.1|3913265_3913481_-	hypothetical protein	NA	NA	NA	NA	NA
AYE48117.1|3913463_3913637_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
AYE47014.1|3913722_3913956_+	DUF2526 domain-containing protein	NA	NA	NA	NA	NA
AYE47015.1|3913956_3914406_-	DMT family transporter	NA	NA	NA	NA	NA
AYE47016.1|3914402_3914921_-	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
AYE47017.1|3915101_3916139_+	NADP-dependent oxidoreductase	NA	A0A2L1IV26	Escherichia_phage	100.0	2.7e-06
AYE47018.1|3917465_3918622_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE47019.1|3919081_3921184_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
AYE47020.1|3921098_3921278_+	hypothetical protein	NA	NA	NA	NA	NA
AYE47021.1|3921425_3922487_+	YncE family protein	NA	NA	NA	NA	NA
AYE47022.1|3922601_3924101_-	L-asparagine permease	NA	NA	NA	NA	NA
AYE47023.1|3924367_3924985_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AYE47024.1|3925060_3925273_+	hypothetical protein	NA	NA	NA	NA	NA
AYE47025.1|3926093_3928202_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.4	8.1e-26
AYE47026.1|3929154_3932265_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.5	3.6e-22
AYE47027.1|3934018_3938236_+	RHS element protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	4.9e-22
AYE47028.1|3938213_3938453_+	hypothetical protein	NA	NA	NA	NA	NA
AYE47029.1|3940298_3941834_+|transposase	IS21-like element ISSso4 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	1.7e-102
AYE47030.1|3941850_3942606_+	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	43.4	2.4e-44
AYE47031.1|3944620_3945757_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AYE47032.1|3947131_3947359_+	tautomerase PptA	NA	NA	NA	NA	NA
AYE47033.1|3947362_3947932_-	flavin reductase family protein	NA	NA	NA	NA	NA
AYE47034.1|3948104_3948950_+	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
AYE47035.1|3949045_3949939_-	PhzF family isomerase	NA	NA	NA	NA	NA
AYE47036.1|3950017_3950698_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AYE47037.1|3950694_3951390_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AYE47038.1|3951389_3952934_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
AYE47039.1|3952930_3956671_-	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
AYE47040.1|3956752_3958141_-	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
AYE47041.1|3959263_3960295_-|transposase	IS630 family transposase IS630	transposase	NA	NA	NA	NA
AYE47042.1|3960378_3960951_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
AYE47043.1|3961711_3962812_-	porin	NA	Q1MVN1	Enterobacteria_phage	65.1	7.0e-138
AYE47044.1|3963070_3963952_-	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
AYE47045.1|3964183_3964771_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE47046.1|3964819_3967231_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
AYE47047.1|3967243_3968128_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
AYE47048.1|3968120_3968774_+	formate dehydrogenase nitrate-inducible cytochrome b556(Fdn) subunit	NA	NA	NA	NA	NA
AYE47049.1|3969001_3969286_-	transcriptional regulator	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
AYE47050.1|3970567_3972265_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
AYE47051.1|3972421_3972559_-	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
AYE47052.1|3972660_3972876_-	biofilm-dependent modulation protein	NA	NA	NA	NA	NA
AYE47053.1|3973220_3973652_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AYE47054.1|3973707_3974142_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYE47055.1|3974153_3975310_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
>prophage 19
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	4075039	4189157	5032769	tRNA,holin,lysis,transposase	Escherichia_phage(31.58%)	111	NA	NA
AYE47143.1|4075039_4075396_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	6.3e-56
AYE47144.1|4075453_4075876_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.5	2.1e-66
AYE47145.1|4075891_4076617_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	70.5	9.7e-88
AYE47146.1|4076638_4077385_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	82.1	4.0e-113
AYE47147.1|4077391_4078456_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	7.1e-63
AYE47148.1|4078527_4078953_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AYE47149.1|4078949_4079213_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYE47150.1|4079324_4079825_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	34.9	1.5e-15
AYE47151.1|4079844_4080039_+	antitoxin	NA	NA	NA	NA	NA
AYE47152.1|4080038_4080329_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYE48123.1|4080607_4080760_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.7e-07
AYE48124.1|4080771_4081137_+	hypothetical protein	NA	NA	NA	NA	NA
AYE47153.1|4082144_4082333_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AYE47154.1|4082329_4082521_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYE47155.1|4083716_4084873_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE47156.1|4085220_4086429_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.3	9.5e-205
AYE47157.1|4088703_4089297_-	tellurite methyltransferase	NA	NA	NA	NA	NA
AYE47158.1|4089293_4090286_-	TDT family transporter	NA	NA	NA	NA	NA
AYE47159.1|4090409_4091390_+	hypothetical protein	NA	NA	NA	NA	NA
AYE47160.1|4091384_4091921_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
AYE47161.1|4091983_4092208_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AYE47162.1|4092223_4092427_+	hypothetical protein	NA	NA	NA	NA	NA
AYE47163.1|4092347_4094003_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AYE47164.1|4094269_4095571_-	VOC family protein	NA	NA	NA	NA	NA
AYE48125.1|4095787_4096711_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYE47165.1|4096748_4098389_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
AYE47166.1|4098787_4098937_+	protein HokB	NA	NA	NA	NA	NA
AYE47167.1|4099001_4099181_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	68.2	3.0e-06
AYE47168.1|4099425_4099956_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	4.1e-19
AYE47169.1|4100144_4101017_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYE47170.1|4101013_4102170_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE47171.1|4104264_4105421_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE47172.1|4105477_4106158_-	YdcF family protein	NA	NA	NA	NA	NA
AYE47173.1|4106429_4110332_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
AYE47174.1|4110532_4111138_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AYE48127.1|4111188_4112481_-	hypothetical protein	NA	NA	NA	NA	NA
AYE47175.1|4112494_4114252_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AYE48126.1|4114267_4115191_-	hypothetical protein	NA	NA	NA	NA	NA
AYE47176.1|4116034_4117203_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AYE47177.1|4119355_4119568_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYE47178.1|4119739_4120066_-	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
AYE47179.1|4120073_4120259_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
AYE47180.1|4120255_4122895_-	YdbH family protein	NA	NA	NA	NA	NA
AYE47181.1|4123102_4124092_+	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
AYE47182.1|4124202_4124625_+	heat-shock protein HslJ	NA	NA	NA	NA	NA
AYE47183.1|4124621_4124888_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AYE47184.1|4125161_4128686_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AYE47185.1|4129051_4130185_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.5	5.4e-117
AYE47186.1|4130325_4130760_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AYE47187.1|4131345_4132260_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE47188.1|4132259_4133087_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
AYE47189.1|4133083_4133941_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AYE47190.1|4133937_4134795_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AYE47191.1|4134995_4135619_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	78.6	3.6e-83
AYE47192.1|4136670_4137033_-	hypothetical protein	NA	NA	NA	NA	NA
AYE47193.1|4137060_4138217_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE47194.1|4138638_4139133_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
AYE47195.1|4139588_4140745_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE47196.1|4141340_4142513_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
AYE47197.1|4142692_4142893_-	hypothetical protein	NA	K7PJR7	Enterobacteria_phage	90.9	2.5e-30
AYE47198.1|4143209_4143362_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
AYE47199.1|4143349_4143817_-|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	96.1	2.3e-74
AYE47200.1|4143813_4144311_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.6	4.2e-90
AYE47201.1|4144310_4144526_-|holin	holin	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
AYE47202.1|4145097_4146266_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AYE47203.1|4147837_4148392_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	6.5e-68
AYE47204.1|4148388_4148679_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	1.5e-47
AYE47205.1|4148678_4149278_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.5	2.9e-106
AYE47206.1|4149349_4149619_-	hypothetical protein	NA	NA	NA	NA	NA
AYE47207.1|4150473_4150686_-	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	91.4	6.8e-26
AYE47208.1|4151083_4151449_-	DUF551 domain-containing protein	NA	Q08J61	Stx2-converting_phage	53.0	2.3e-29
AYE47209.1|4151448_4152114_-	hypothetical protein	NA	A0A076G611	Escherichia_phage	44.9	4.6e-36
AYE47210.1|4152110_4152476_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
AYE47211.1|4152477_4152696_-	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	6.8e-29
AYE47212.1|4152788_4153112_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.1	3.8e-52
AYE47213.1|4153959_4155115_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE47214.1|4155112_4155529_-	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	75.2	1.4e-46
AYE47215.1|4155543_4156290_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	88.8	6.2e-122
AYE47216.1|4156828_4157985_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE47217.1|4158775_4159198_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	96.4	1.4e-70
AYE47218.1|4159194_4159437_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
AYE47219.1|4159533_4159953_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
AYE47220.1|4160258_4160414_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.4e-07
AYE47221.1|4160558_4161590_+|transposase	IS630 family transposase IS630	transposase	NA	NA	NA	NA
AYE47222.1|4161570_4161774_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	62.5	2.2e-05
AYE47223.1|4161750_4162041_-	hypothetical protein	NA	NA	NA	NA	NA
AYE48128.1|4162174_4162393_-	hypothetical protein	NA	NA	NA	NA	NA
AYE47224.1|4162442_4163288_+	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	58.0	1.4e-56
AYE47225.1|4163298_4163487_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AYE47226.1|4163483_4163675_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYE47227.1|4163759_4164035_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	4.4e-41
AYE47228.1|4164230_4165386_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.0e-67
AYE47229.1|4165972_4166908_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AYE47230.1|4167036_4168410_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AYE47231.1|4168439_4168613_-	hypothetical protein	NA	NA	NA	NA	NA
AYE47232.1|4168887_4169871_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AYE48129.1|4170125_4171358_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
AYE47233.1|4171378_4171942_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
AYE47234.1|4172271_4173180_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYE47235.1|4173355_4174666_+	amidohydrolase	NA	NA	NA	NA	NA
AYE47236.1|4174665_4176111_+	amidohydrolase	NA	NA	NA	NA	NA
AYE48130.1|4176023_4176218_+	hypothetical protein	NA	NA	NA	NA	NA
AYE47237.1|4177309_4178465_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	7.2e-69
AYE47238.1|4178951_4179467_+	methylated-DNA--protein-cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
AYE47239.1|4179661_4180414_+	transcriptional regulator FNR	NA	NA	NA	NA	NA
AYE47240.1|4180565_4181516_+	universal stress protein E	NA	NA	NA	NA	NA
AYE47241.1|4181565_4181823_-	DUF2534 family protein	NA	NA	NA	NA	NA
AYE47242.1|4183926_4185540_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE47243.1|4185876_4186776_-	transcriptional regulator	NA	NA	NA	NA	NA
AYE47244.1|4186913_4187834_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYE47245.1|4187883_4189157_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 20
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	4254293	4328767	5032769	transposase,holin,tail,protease,capsid	Escherichia_phage(34.09%)	73	NA	NA
AYE47303.1|4254293_4255343_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AYE47304.1|4255562_4256321_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	2.6e-06
AYE47305.1|4256317_4256908_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AYE47306.1|4256947_4257820_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AYE47307.1|4259174_4259795_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AYE47308.1|4259791_4260673_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
AYE48131.1|4260810_4260855_+	trp operon leader peptide	NA	NA	NA	NA	NA
AYE47309.1|4260946_4262509_+	anthranilate synthase component I	NA	NA	NA	NA	NA
AYE47310.1|4262508_4264104_+	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AYE48132.1|4264107_4265466_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
AYE47311.1|4265477_4266671_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AYE47312.1|4266670_4267477_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AYE47313.1|4268652_4268928_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
AYE47314.1|4268924_4269482_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
AYE48133.1|4271038_4271665_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYE47315.1|4271609_4271747_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AYE48134.1|4271863_4272046_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
AYE47316.1|4273037_4273571_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	85.9	3.4e-82
AYE47317.1|4273599_4274127_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	84.0	7.1e-80
AYE47318.1|4274128_4276885_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	46.5	1.0e-108
AYE47319.1|4277036_4277636_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.4	1.7e-106
AYE47320.1|4280951_4281155_-	host specificity protein J	NA	H6WZM6	Escherichia_phage	98.5	3.4e-30
AYE47321.1|4281498_4282179_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.1	9.1e-112
AYE47322.1|4282076_4282820_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	7.7e-149
AYE47323.1|4282830_4283529_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
AYE47324.1|4283528_4283858_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AYE47325.1|4283854_4286428_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
AYE47326.1|4286408_4286822_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	83.2	4.1e-43
AYE47327.1|4286848_4287280_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
AYE47328.1|4287293_4288046_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	2.3e-132
AYE47329.1|4288053_4288449_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AYE47330.1|4288445_4289021_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
AYE47331.1|4289211_4290384_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
AYE47332.1|4290994_4292150_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE47333.1|4292584_4292899_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
AYE47334.1|4292903_4293119_-|holin	holin	holin	G9L6J5	Escherichia_phage	98.6	2.6e-33
AYE47335.1|4293269_4295123_-	DUF1737 domain-containing protein	NA	Q08JA2	Stx2-converting_phage	90.0	0.0e+00
AYE47336.1|4296388_4297447_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	94.6	2.3e-199
AYE47337.1|4297597_4297795_-	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
AYE47338.1|4298019_4298841_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.7	1.4e-79
AYE47339.1|4298837_4299218_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.5e-34
AYE47340.1|4299218_4300277_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.4	1.3e-88
AYE47341.1|4300278_4300557_-	hypothetical protein	NA	NA	NA	NA	NA
AYE47342.1|4300623_4300884_-	hypothetical protein	NA	NA	NA	NA	NA
AYE47343.1|4301104_4301317_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
AYE47344.1|4301551_4301896_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
AYE47345.1|4301892_4302060_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
AYE47346.1|4302070_4302301_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	76.9	5.0e-22
AYE47347.1|4302312_4303469_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE47348.1|4303536_4303923_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.0	9.5e-58
AYE47349.1|4304806_4305019_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	2.9e-32
AYE47350.1|4305051_4305270_+	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
AYE47351.1|4305690_4306329_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
AYE47352.1|4306685_4307429_+	UPF0259 family protein	NA	NA	NA	NA	NA
AYE47353.1|4307458_4307998_+	intracellular septation protein A	NA	NA	NA	NA	NA
AYE47354.1|4308102_4308501_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AYE48135.1|4308540_4309260_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
AYE47355.1|4309350_4310871_+	recombinase family protein	NA	NA	NA	NA	NA
AYE47356.1|4310903_4311674_-	hypothetical protein	NA	A0A291AY96	Shigella_phage	63.6	2.2e-82
AYE47357.1|4312293_4313450_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE47358.1|4313758_4315012_+	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
AYE47359.1|4315066_4315351_-	hypothetical protein	NA	NA	NA	NA	NA
AYE47360.1|4315382_4316843_+	cardiolipin synthase A	NA	NA	NA	NA	NA
AYE47361.1|4316877_4317207_+	DUF440 family protein	NA	NA	NA	NA	NA
AYE47362.1|4317259_4318264_-	oligopeptide ABC transporter ATP-binding protein OppF	NA	G9BWD6	Planktothrix_phage	35.6	1.1e-23
AYE47363.1|4318260_4319274_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
AYE47364.1|4319285_4320194_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYE47365.1|4320208_4321129_-	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
AYE48136.1|4321214_4322846_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
AYE47366.1|4323129_4323426_+	hypothetical protein	NA	NA	NA	NA	NA
AYE47367.1|4323583_4324231_-	NAAT family transporter YchE	NA	NA	NA	NA	NA
AYE47368.1|4324708_4327384_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
AYE47369.1|4327438_4328767_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 21
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	4555698	4563140	5032769		Enterobacteria_phage(100.0%)	7	NA	NA
AYE47564.1|4555698_4556835_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
AYE47565.1|4556831_4558832_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
AYE47566.1|4558956_4559418_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AYE47567.1|4559458_4559929_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AYE47568.1|4559975_4560695_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYE48145.1|4560691_4562377_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
AYE47569.1|4562891_4563140_+	DNA damage-inducible protein DinI	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
>prophage 22
CP032523	Shigella sonnei strain AR_0030 chromosome, complete genome	5032769	4777283	4886917	5032769	head,terminase,tRNA,transposase,holin,tail,portal,capsid,lysis	Enterobacteria_phage(53.85%)	101	NA	NA
AYE47744.1|4777283_4778174_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	43.9	9.8e-66
AYE47745.1|4778370_4779144_-	histidine transport ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	38.1	2.4e-23
AYE47746.1|4779151_4779868_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
AYE47747.1|4779864_4780551_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
AYE47748.1|4780640_4781423_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
AYE47749.1|4781643_4782426_-	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
AYE47750.1|4782691_4783261_-	3-octaprenyl-4-hydroxybenzoate carboxy-lyase partner protein	NA	NA	NA	NA	NA
AYE47751.1|4783355_4784873_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
AYE47752.1|4784909_4785398_-	colicin V production protein	NA	NA	NA	NA	NA
AYE47753.1|4785656_4786319_-	protein DedD	NA	NA	NA	NA	NA
AYE47754.1|4786308_4787577_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AYE47755.1|4787646_4788561_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
AYE47756.1|4788716_4789376_-	DedA family protein	NA	NA	NA	NA	NA
AYE47757.1|4789458_4790271_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AYE47758.1|4790270_4791284_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYE47759.1|4791349_4792486_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
AYE47760.1|4792584_4793580_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AYE47761.1|4793576_4794755_-	MFS transporter	NA	NA	NA	NA	NA
AYE47762.1|4794696_4794918_+	hypothetical protein	NA	NA	NA	NA	NA
AYE47763.1|4795029_4796250_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AYE47764.1|4796408_4798415_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AYE47765.1|4798535_4798814_-	YfcL family protein	NA	NA	NA	NA	NA
AYE47766.1|4798847_4799396_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AYE47767.1|4799395_4800205_-	hypothetical protein	NA	NA	NA	NA	NA
AYE47768.1|4800204_4801029_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AYE47769.1|4801032_4802118_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
AYE47770.1|4802152_4803085_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AYE47771.1|4803250_4803802_+	endonuclease SmrB	NA	NA	NA	NA	NA
AYE47772.1|4803923_4804781_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AYE47773.1|4804782_4805307_-	fimbrial protein	NA	NA	NA	NA	NA
AYE47774.1|4805303_4805774_-	fimbrial protein	NA	NA	NA	NA	NA
AYE47775.1|4805770_4806385_-	fimbrial protein	NA	NA	NA	NA	NA
AYE47776.1|4807064_4809707_-	outer membrane usher protein	NA	NA	NA	NA	NA
AYE47777.1|4809788_4810352_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYE47778.1|4811035_4811521_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AYE47779.1|4811723_4813868_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AYE47780.1|4813867_4815178_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AYE47781.1|4815357_4815642_-	DUF406 family protein	NA	NA	NA	NA	NA
AYE47782.1|4816013_4817354_+	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AYE47783.1|4821205_4821961_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AYE47784.1|4821986_4822157_-	hypothetical protein	NA	NA	NA	NA	NA
AYE47785.1|4822254_4823187_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
AYE47786.1|4823498_4824656_+	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	99.5	1.4e-221
AYE47787.1|4827634_4828216_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	8.0e-101
AYE47788.1|4828215_4831299_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	7.3e-68
AYE47789.1|4831950_4835448_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
AYE47790.1|4835508_4836180_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.3	6.4e-102
AYE47791.1|4836077_4836821_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	7.5e-152
AYE47792.1|4836826_4837525_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	8.1e-132
AYE47793.1|4837524_4837854_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	97.2	3.1e-57
AYE47794.1|4837850_4840412_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.5	0.0e+00
AYE47795.1|4840404_4840839_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
AYE47796.1|4840820_4841243_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
AYE48151.1|4841258_4841999_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	1.0e-129
AYE47797.1|4842006_4842402_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AYE47798.1|4842398_4842977_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	89.6	2.0e-80
AYE47799.1|4842988_4843342_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
AYE48152.1|4843353_4843752_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	83.3	1.2e-50
AYE47800.1|4843793_4844819_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	98.8	4.3e-190
AYE47801.1|4844874_4845207_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AYE47802.1|4845216_4846536_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	2.9e-231
AYE47803.1|4846516_4848118_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	2.2e-310
AYE47804.1|4848114_4848321_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AYE47805.1|4848317_4850243_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AYE47806.1|4850217_4850763_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
AYE47807.1|4851151_4851385_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
AYE47808.1|4851442_4851853_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AYE47809.1|4852032_4853306_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AYE48153.1|4853585_4853774_+	hypothetical protein	NA	NA	NA	NA	NA
AYE47810.1|4853777_4854035_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	98.8	1.5e-38
AYE47811.1|4854031_4854529_-	DNA-binding protein	NA	A0A220NRM9	Escherichia_phage	100.0	1.1e-93
AYE47812.1|4854730_4855189_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	80.9	1.2e-56
AYE47813.1|4855185_4855683_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	94.5	2.1e-86
AYE47814.1|4855682_4855898_-|holin	holin	holin	A5LH82	Enterobacteria_phage	100.0	2.6e-33
AYE47815.1|4857246_4858329_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
AYE47816.1|4858517_4858901_-	antitermination protein	NA	A0A088CD47	Shigella_phage	82.5	8.3e-54
AYE47817.1|4858986_4859127_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
AYE47818.1|4859123_4859486_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
AYE47819.1|4859482_4859773_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	3.0e-48
AYE47820.1|4859765_4859936_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
AYE47821.1|4859935_4860391_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	2.7e-59
AYE47822.1|4860655_4861033_+	hypothetical protein	NA	NA	NA	NA	NA
AYE47823.1|4861029_4861458_+	hypothetical protein	NA	NA	NA	NA	NA
AYE47824.1|4861897_4863070_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.7	1.1e-229
AYE47825.1|4863066_4863867_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
AYE47826.1|4866376_4866577_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AYE47827.1|4866699_4867044_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	1.0e-58
AYE47828.1|4867236_4867467_+	hypothetical protein	NA	NA	NA	NA	NA
AYE47829.1|4867357_4867888_+	hypothetical protein	NA	NA	NA	NA	NA
AYE48154.1|4868799_4869147_-	fructokinase	NA	NA	NA	NA	NA
AYE47830.1|4869103_4870272_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	5.8e-183
AYE47831.1|4870998_4872327_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AYE47832.1|4872571_4874005_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	5.3e-29
AYE48155.1|4874012_4875008_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYE47833.1|4875474_4876803_+	D-serine dehydratase	NA	NA	NA	NA	NA
AYE47834.1|4876910_4878449_-	multidrug efflux MFS transporter subunit EmrY	NA	NA	NA	NA	NA
AYE47835.1|4878448_4879612_-	multidrug efflux MFS transporter subunit EmrK	NA	NA	NA	NA	NA
AYE47836.1|4880027_4880642_+	DNA-binding transcriptional activator EvgA	NA	NA	NA	NA	NA
AYE47837.1|4880646_4884240_+	two-component system sensor histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	6.0e-37
AYE47838.1|4884295_4885441_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
AYE47839.1|4885761_4886917_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
>prophage 1
CP032524	Shigella sonnei strain AR_0030 plasmid unnamed1, complete sequence	94537	4372	17102	94537	transposase	Enterobacteria_phage(33.33%)	13	NA	NA
AYE48165.1|4372_5529_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AYE48166.1|5544_6105_+	hypothetical protein	NA	NA	NA	NA	NA
AYE48167.1|6469_7330_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYE48168.1|7512_8070_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.5	2.0e-93
AYE48169.1|8233_11239_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.9	0.0e+00
AYE48260.1|11647_11827_-	Par-like protein	NA	NA	NA	NA	NA
AYE48170.1|11946_12573_-	cobyrinic acid ac-diamide synthase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
AYE48171.1|12760_14032_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.4	2.2e-143
AYE48172.1|14031_14469_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
AYE48173.1|14465_14714_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
AYE48261.1|14824_15094_+	hypothetical protein	NA	NA	NA	NA	NA
AYE48174.1|15062_16034_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AYE48175.1|16418_17102_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	5.1e-30
